Next Article in Journal
Insights for Deriving Induced Pluripotent Stem Cells in Marsh Deer (Blastocerus dichotomus)
Previous Article in Journal
Chlorography or Chlorotyping from the Decomposition of Chlorophyll and Natural Pigments in Leaves and Flowers as a Natural Alternative for Photographic Development
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
JZBG
Volume 6
Issue 3
10.3390/jzbg6030042
jzbg-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Presence of Extended-Spectrum Beta-Lactamase-Producing Escherichia coli and Klebsiella pneumoniae Isolated from Avian Species in a Petting Zoological Garden

by
Juan Casas-Paul
1,†,
José Luis Bravo-Ramos
1,*,†,
María Guadalupe Sánchez-Otero
1,*,
Sokani Sánchez-Montes
2,3,*,
Sashenka Bonilla-Rojas
1,
Luis Arturo Ortíz-Carbajal
1,
Gerardo Gabriel Ballados-González
4,
Jannete Gamboa-Prieto
4,
Alejandra Chong-Guzmán
4 and
Angelica Olivares Muñoz
4
1
Maestría en Química Clínica, Facultad de Bioanálisis, Universidad Veracruzana, Veracruz 91700, Mexico
2
Centro de Medicina Tropical, División de Investigación, Facultad de Medicina, Universidad Nacional Autónoma de México, México City 04510, Mexico
3
Facultad de Ciencias Biológicas y Agropecuarias, Universidad Veracruzana, Tuxpan de Rodríguez Cano, Veracruz 92870, Mexico
4
Facultad de Medicina Veterinaria y Zootecnia, Universidad Veracruzana, Veracruz 91697, Mexico
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
J. Zool. Bot. Gard. 2025, 6(3), 42; https://doi.org/10.3390/jzbg6030042
Submission received: 13 April 2025 / Revised: 29 July 2025 / Accepted: 12 August 2025 / Published: 19 August 2025
Browse Figure
Versions Notes

Abstract

Extended-spectrum beta-lactamase (ESBL)-producing Enterobacteriaceae pose a significant public health risk. As zoos grow in popularity, exotic animals come into closer contact with humans, making them potential reservoirs of ESBLs. However, data on ESBL presence in Mexican zoos remains limited. For this reason, this study aimed to isolate and assess the antimicrobial susceptibility of Enterobacteriaceae that colonize avian species in a petting zoo and to identify any ESBL-producing isolates. Cloacal swabs were collected from 34 healthy birds at Miguel Angel de Quevedo Zoo, Veracruz, Mexico. Samples were analyzed microbiologically and molecularly to detect ESBL-encoding genes. A total of seventeen E. coli and one K. pneumoniae strains were isolated from cloacal swabs of bird species, and multidrug resistance (MDR) was found. The most frequently detected genes were blaCTX-M-1 (16/18) and blaTEM-1 (12/18). The detection of multidrug-resistant (MDR) strains carrying blaCTX-M-1, blaTEM-1, and blaSHV genes highlights the potential role of birds as reservoirs and disseminators of antimicrobial resistance (AMR) in urban environments. To the best of our knowledge, this is the first study conducted in Mexico. In conclusion, MDR ESBL-producing bacteria were found in the fecal microbiota of bird species at a petting zoo in Mexico. The limitations of this study emphasize the need for a One Health approach to analyze the genome-wide isolates and epidemiology of antimicrobial-resistant bacteria in captive zoo animals in Mexico. This would support targeted surveillance efforts and help reduce the emergence and spread of resistant bacteria among zoo animals and visitors.

Graphical Abstract

1. Introduction

Zoological gardens are popular urban recreational areas, often designed with a semi-forested or park-like setting. The semi-natural, fragmented environment typical of zoos is carefully created to support a variety of animal species, each with specific habitat needs. Animals in these environments can serve as reservoirs for various pathogens, increasing their spread within local ecosystems [1]. Despite their educational and recreational value, zoos raise concerns about zoonotic pathogen transmission through visitor–animal interactions, mainly via the oral–fecal route [2]. For example, the Veracruz petting zoo welcomes about 300 visitors daily and offers workshops and opportunities for direct contact with different animals, which increases the risk of infection. The Enterobacteriaceae family includes bacteria that commonly colonize and cause infections in both humans and animals [3]. Resistance to β-lactam antimicrobials is becoming more common in Escherichia coli and Klebsiella pneumoniae, including strains responsible for common hospital-acquired infections. In these bacteria, β-lactam resistance is often caused by the production of enzymes called extended-spectrum beta-lactamases (ESBLs) [4]. Multidrug resistance (MDR) is generally defined as resistance to at least three different classes of antimicrobial agents. Infections caused by MDR bacteria pose serious public health risks, leading to treatment failures and higher mortality rates in both humans and animals [5]. Fecal carriage of ESBL and AmpC-producing Enterobacteriaceae has been documented in zoo animals [6,7,8,9,10,11,12,13]. The class Aves is considered the second most species-rich group among vertebrates [14]. Bird species are recognized as potential reservoirs of antimicrobial-resistant bacteria, as their intestinal and cloacal microbiota can vary based on their habits. Although birds may not be directly exposed to antibiotics, their interactions with contaminated waste, water, and food, as well as their migration and contact with humans, could lead to the acquisition of resistant bacteria. However, while transmission routes have been proposed, the prevalence and severity of antimicrobial resistance in birds remain poorly understood [12]. Given the direct contact between visitors and animals and the growing threat of antibiotic-resistant bacteria in zoo animals, this study aimed to isolate and assess the antimicrobial susceptibility of Enterobacteriaceae to colonize avian species in a petting zoo and identify any ESBL-producing isolates.

2. Materials and Methods

The study was conducted from October 2024 to February 2025 at the Miguel Ángel de Quevedo Petting Zoological Garden in Veracruz, Mexico. The zoo currently houses 72 bird species (Table 1). The selection of each species was made using convenience sampling (a non-probability sampling method). At the same time, the choice of birds—including their age, sex, and clinical condition—was made at random. Cloacal swabs were collected from 34 healthy birds, stored in commercial transport gel, and transported in an ice-packed cool box to the Bioanalysis Faculty, Veracruzana University, within two to three hours. Then, the samples were cultured selectively on MacConkey agar, with the media incubated aerobically at 35 °C overnight. One colony grown on the selective media per animal was subsequently subcultured on blood agar for biochemical testing. All isolates were identified using the Vitek-2 system (AST-N270 Vitek-2 card, BioMérieux, Inc., Marcy-l’Étoile, France). Antibiotic susceptibility testing was performed using broth microdilution (AST-N270 Vitek-2 card, BioMérieux, Inc., Marcy-l’Étoile, France). MIC results were interpreted according to Clinical and Laboratory Standards Institute breakpoints CLSI VET01S ED6:2023 [15]. ESBL production was evaluated using the double-disk test, as recommended by CLSI M100-S25, 2015 [16]. The resistance phenotype of strains was classified as multidrug resistance (MDR), as previously reported [17]. After species identification, one isolate per sample was stored for subsequent molecular analysis. Using a microbiological loop, isolates were placed in 1.5 mL conical tubes. Each tube received 500 μL of a 10% Chelex 100 chelating resin solution (Bio-Rad®, Hercules, CA, USA) and was incubated at 56 °C for one hour. The temperature then increased to 94 °C for 15 min, followed by centrifugation at 16,000× g for 5 min. Samples were cooled to room temperature; the supernatant was transferred to new tubes and stored at −20 °C until use.
All isolates were screened for the detection of extended-spectrum β-lactamase (ESBL)-encoding genes using previously published protocols for the blaCTX-M, blaTEM, and blaSHV-type β-lactamases [11,16,17]. Isolates positive for the blaCTX-M gene underwent further analysis by PCR targeting the blaCTX-M-1 and blaCTX-M-9 groups [18]. A total reaction volume of 25 µL was prepared by combining 12.5 µL of master mix (containing dNTPs, Taq DNA polymerase, MgCl2, and PCR buffer, Promega Corporation, Madison, WI, USA), 1 µL each of the selected forward and reverse primers, 5 µL of DNA template, and 5.5 µL of nuclease free water in a PCR tube. The primer sequences, amplification product sizes, and references used in this study are detailed in Table 2. PCR products were visualized by electrophoresis (Shelton Scientific, QS-710, Waltham, MA, USA) in 1.5% agarose gels stained with ethidium bromide and run in 1.5% TAE buffer at 85 V for 40 min. Amplification products were then purified and sequenced at Macrogen Inc., Seoul, Korea, and the resulting sequences were deposited in GenBank under accession numbers PV999952, PV992846, and PV994033. Subsequently, the sequences were compared with those available in GenBank using the Basic Local Alignment Search Tool (BLASTn).

3. Results

Of the thirty-four animals sampled, seventeen E. coli and one K. pneumoniae strains were isolated from the cloacal swabs of peafowls, guinea peafowls, caracara cheriways, chachalacas, red-lored Amazons, domestic ducks, greylag geese, and keel-billed toucans. E. coli exhibiting the ESBL phenotype was detected in 7 out of 18 (38.8%) birds, confirmed by the detection of the blaCTX-M-1 gene. Additionally, 11 E. coli isolates showing the presence of blaCTX-M-1, blaTEM, and/or blaSHV genes were characterized by the absence of ESBL phenotype. The phenotypic and genetic characterization results of the E. coli and K. pneumoniae isolates are summarized in Table 3. Resistance to ampicillin was the most common, occurring in 40.6% (13/18) of the E. coli isolates. Resistance to cefotaxime was present in 10/18 (38.8%) isolates. Resistance to piperacillin/tazobactam and trimethoprim/sulfamethoxazole was observed in 7 out of 18 (38.8%) isolates. Additionally, 5 out of 18 (27.7%) isolates showed resistance to ciprofloxacin. Resistance to amikacin and gentamicin was detected in 2 (11.1%) and 8 (44.4%) isolates, respectively. Based on antimicrobial susceptibility testing, 8 out of 18 (44.4%) isolates were classified as multidrug-resistant (MDR) [19]. All 18 isolates carried the blaCTX-M-1 gene, as confirmed by PCR analysis. The blaCTX-M-9 gene was not detected in any isolates. One E. coli isolate from a peafowl was also positive for the blaTEM and blaSHV genes, carrying all three genes simultaneously. Furthermore, a peafowl was found to carry two different enterobacteria, E. coli and K. pneumoniae, both of which produce ESBLs, as indicated by the detection of the blaCTX-M-1 gene in both.

4. Discussion

ESBLs are the primary resistance mechanism to third-generation cephalosporins in Enterobacteriaceae, especially E. coli and K. pneumoniae. They originate from point mutations in broad-spectrum β-lactamases (TEM-1, TEM-2, and SHV-1). More than 10 ESBL families have been identified, including CTX-M, SHV, TEM, PER, VEB, BES, GES, TLA, SFO, and OXA [19,20]. However, CTX-M enzymes are the most common worldwide, mainly hydrolyzing cefotaxime rather than ceftazidime. In recent years, variants such as blaCTX-M-15, blaCTX-M-16, blaCTX-M-27, and blaCTX-M-19 have emerged with increased activity against ceftazidime [21]. Captive wild animals are considered a source of 70% of emerging diseases, including increasing antimicrobial resistance [22]. Several studies have found that some human infectious diseases are associated with visits to animal exhibition sites, such as circuses and zoos [22,23,24]. In this study, about 19.3% (95% CI: 8.4–36.0%) of the sampled bird species (6/31) carried fecal ESBL-producing Enterobacteriaceae, which is lower than rates reported in zoo animals from different countries [6,7,8,9,10,11,12,13]. These differences might be due to factors such as small sample size, geographic differences, or zoo management practices. The prevalence of ESBL producers in zoo animals could also be underestimated due to limited studies. In contrast, the occurrence of ESBL in livestock has been studied extensively, with prevalence rates up to 80% [25]. Our results may indicate a rising prevalence of ESBL-producing bacteria in zoo animals, mirroring trends in humans, pets, and livestock. Consistent with previous studies, most isolates were identified as E. coli, with a predominance of the ESBL phenotype blaCTX-M-1, similar to findings in captive and wild birds from zoos and rescue centers [10,11,12,13,26,27]. Although the pathogenic significance of E. coli strains carrying this enzyme remains unclear, a higher prevalence of blaCTX-M-1 has been reported in companion animals and livestock carrying disease compared to healthy animals. The frequent use of first-generation cephalosporins, penicillins, and amoxicillin in sick animals might contribute to this prevalence [28]. Other studies found that zoo animals carrying E. coli strains with the blaCTX-M-1 gene were healthy, though data on prior antibiotic treatments were lacking [6,29]. The absence of the ESBL phenotype in nine E. coli strains with ESBL-encoding genes may be due to other resistance mechanisms masking it or the presence of blaTEM or blaSHV, which produce narrow-spectrum β-lactamases [30]. Various resistance gene combinations seen in this study have been previously reported in zoo animals. The detection of multidrug-resistant (MDR) phenotypes in 44.4% of isolates is concerning and highlights the potential clinical risks of zoonotic transmission. Resistance to third-generation cephalosporins (e.g., cefotaxime) was notably widespread, reflecting the distribution of CTX-M-type β-lactamases in both human and veterinary settings [25,27]. Additionally, the presence of blaCTX-M-1, blaTEM, and blaSHV in some isolates shows the genetic complexity of resistance and its spread in wild bird populations, warranting genomic studies to understand the diversity of plasmids and integrons. Besides E. coli, ESBL-producing K. pneumoniae is a well-documented, common opportunist in animals and humans, with cases of zoonotic and reverse zoonotic transmission [31]. K. pneumoniae isolates were resistant to penicillin and third-generation cephalosporins and carried the blaCTX-M1 gene. The gut microbiota of seemingly healthy animals requires attention during capture, quarantine, and translocation, as infections caused by K. pneumoniae and E. coli mainly affect immunocompromised hosts. Newly captured and captive animals are under high stress, which raises cortisol levels and reduces immunity, potentially triggering disease [32]. However, Klebsiella and Escherichia are part of the normal gut microbiota, and their presence usually does not impede translocation [33,34]. In birds, insects like cockroaches are a natural part of their diet. Cockroaches are significant carriers of infectious pathogens, and studies suggest that they can transmit K. pneumoniae in human environments [35]. Given that this animal population lives in urban areas close to humans and domestic animals, attention should be paid to the potential for cross-species transmission. Our findings align with previous research confirming K. pneumoniae in captive birds [10,36,37]. From a One Health perspective, birds play a role in spreading antimicrobial resistance. They often come into contact with contaminated water, soil, and waste, creating opportunities for horizontal gene transfer with bacteria associated with humans. Petting zoos are especially notable as ecological interfaces where resistant bacteria may circulate among wildlife and humans through direct contact, environmental contamination (such as soil, feathers, and feces), or fomites [22,26]. Our study has limitations: it was performed at a single zoo with a small sample size (n = 34), limiting the ability to generalize the prevalence estimates. We also lacked detailed data on antibiotic exposure, diet, or previous medical treatments of the birds, which could influence resistance patterns. Future research should include multi-site surveillance across different regions of Mexico, larger sample sizes, longitudinal studies, and whole-genome sequencing (WGS) to explore the genetic context of resistance genes and their potential for horizontal transfer. In conclusion, our results highlight the emerging role of wild birds as reservoirs of clinically relevant ESBL-producing Enterobacteriaceae in Mexico, providing vital baseline data for antimicrobial resistance monitoring. From a One Health perspective, these findings emphasize the intricate interconnection between wildlife, environment, and human health, and underscore the urgent need for integrated surveillance systems that recognize wildlife as sentinel species in the global effort to combat antimicrobial resistance.

Author Contributions

J.C.-P.: Methodology, Formal analysis, Investigation, Writing—original draft. J.L.B.-R.: Conceptualization, Methodology, Investigation, Writing—review and editing; M.G.S.-O.: Conceptualization, Methodology, Investigation, Writing—review and editing. S.S.-M.: Investigation, Writing—original draft; S.B.-R.: Methodology, Investigation, Writing—original draft; L.A.O.-C.: Methodology; G.G.B.-G.: Writing—original draft; J.G.-P.: Writing—original draft; A.C.-G.: Writing—original draft, Supervision; A.O.M.: Methodology, Writing—original draft. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

This project was approved by the Bioethics and Animal Welfare Commission (approval number: 003/2024) of the Faculty of Veterinary Medicine at the University of Veracruz.

Data Availability Statement

The data that support the findings of this study are deposited in the GenBank database with accession numbers: PV999952, PV992846, and PV994033.

Acknowledgments

We thank the staff of the Miguel Angel de Quevedo zoological garden for their support during bird sampling and to the Master’s Program in Clinical Chemistry, Faculty of Bioanalysis, Universidad Veracruzana, as well as SECIHTI, for the scholarship granted to one of the authors in this work, grant number 1315531.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Hrnková, J.; Schneiderová, I.; Golovchenko, M.; Grubhoffer, L.; Rudenko, N.; Černý, J. Role of zoo-housed animals in the ecology of ticks and tick-borne pathogens—A review. Pathogens 2021, 10, 210. [Google Scholar] [CrossRef] [PubMed]
  2. Göttling, J.; Heckel, J.O.; Hotzel, H.; Fruth, A.; Pfeifer, Y.; Henning, K.; Pfeffer, M. Zoonotic bacteria in clinically healthy goats in petting zoo settings of zoological gardens in Germany. Zoonoses Public Health 2022, 69, 333–343. [Google Scholar] [CrossRef] [PubMed]
  3. Potter, R.F.; D’Souza, A.W.; Dantas, G. The rapid spread of carbapenem-resistant Enterobacteriaceae. Drug Resist. Updat. 2016, 29, 30–46. [Google Scholar] [CrossRef]
  4. Salleh, M.Z.; Nik Zuraina, N.M.N.; Hajissa, K.; Ilias, M.I.; Banga Singh, K.K.; Deris, Z.Z. Prevalence of multidrug-resistant and extended-spectrum beta-lactamase-producing Shigella Species in Asia: A systematic review and meta-analysis. Antibiotics 2022, 11, 1653. [Google Scholar] [CrossRef]
  5. Parmanik, A.; Das, S.; Kar, B.; Bose, A.; Dwivedi, G.R.; Pandey, M.M. Current treatment strategies against multidrug-resistant bacteria: A review. Curr. Microbiol. 2022, 79, 388. [Google Scholar] [CrossRef]
  6. De Witte, C.; Vereecke, N.; Theuns, S.; De Ruyck, C.; Vercammen, F.; Bouts, T.; Haesebrouck, F. Presence of broad-spectrum beta-lactamase-producing Enterobacteriaceae in zoo mammals. Microorganisms 2021, 9, 834. [Google Scholar] [CrossRef]
  7. Isler, M.; Wissmann, R.; Morach, M.; Zurfluh, K.; Stephan, R.; Nüesch-Inderbinen, M. Animal petting zoos as sources of Shiga toxin-producing Escherichia coli, Salmonella and extended-spectrum β-lactamase (ESBL)-producing Enterobacteriaceae. Zoonoses Public Health 2021, 68, 79–87. [Google Scholar] [CrossRef]
  8. Wang, X.; Zhang, Y.; Li, C.; Li, G.; Wu, D.; Li, T.; Zou, L. Antimicrobial resistance of Escherichia coli, Enterobacter spp., Klebsiella pneumoniae and Enterococcus spp. isolated from the feces of giant panda. BMC Microbiol. 2022, 22, 102. [Google Scholar] [CrossRef] [PubMed]
  9. Min, J.; Kim, P.; Yun, S.; Hong, M.; Park, W. Zoo animal manure as an overlooked reservoir of antibiotic resistance genes and multidrug-resistant bacteria. Environ. Sci. Pollut. Res. 2023, 30, 710–726. [Google Scholar] [CrossRef] [PubMed]
  10. Ramos, C.A.; Ferreira, J.C.; Ballaben, A.S.; Penha Filho, R.A.C.; da Costa Darini, A.L. Analysis of antibiotic resistance in Gram-negative bacilli in wild and exotic healthy birds in Brazil: A warning sign. Vet. Microbiol. 2024, 296, 110196. [Google Scholar] [CrossRef]
  11. Kim, J.; Kwon, Y.; Pai, H.; Kim, J.W.; Cho, D.T. Survey of Klebsiella pneumoniae strains producing extended-spectrum beta-lactamases: Prevalence of SHV-12 and SHV-2a in Korea. J. Clin. Microbiol. 1998, 36, 1446–1449. [Google Scholar] [CrossRef]
  12. Marques, A.R.; Pascoal-Filho, N.M.; Teixeira, R.S.; Silva, I.N.; Melo, L.S.; Lima, B.P.; Maciel, W.C. Investigation of enterobacteria with zoonotic and multi-resistant potential in exotic parrots kept in a domestic environment. Pesq. Vet. Bras. 2024, 44, e07387. [Google Scholar] [CrossRef]
  13. Sem, Y.F.; Abu, J.; Abdul-Aziz, S. Occurrence of antibiotic-resistant Escherichia coli and Salmonella spp. in psittacine birds in selected petting zoos in Klang Valley, Malaysia. J. Vet. Malays. 2024, 36, 7–12. [Google Scholar] [CrossRef]
  14. Šmíd, J. Geographic and taxonomic biases in the vertebrate tree of life. J. Biogeogr. 2022, 49, 2120–2129. [Google Scholar] [CrossRef]
  15. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals. In CLSI VET01S, 6th ed.; CLSI Supplement VET01S; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2023; ISBN 978–1–68440-167-3. [Google Scholar]
  16. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Fifth Informational Supplement; CLSI Document M100-S25; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2015. [Google Scholar]
  17. Edelstein, M.; Pimkin, M.; Palagin, I.; Edelstein, I.; Stratchounski, L. Prevalence and molecular epidemiology of CTX-M extended-spectrum beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae in Russian hospitals. Antimicrob. Agents Chemother. 2003, 47, 3724–3732. [Google Scholar] [CrossRef] [PubMed]
  18. Essack, S.Y.; Hall, L.M.; Pillay, D.G.; McFadyen, M.L.; Livermore, D.M. Complexity and diversity of Klebsiella pneumoniae strains with extended-spectrum beta-lactamases isolated in 1994 and 1996 at a teaching hospital in Durban, South Africa. Antimicrob. Agents Chemother. 2001, 45, 88–95. [Google Scholar] [CrossRef] [PubMed]
  19. Magiorakos, A.P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef]
  20. Bartoloni, A.; Pallecchi, L.; Riccobono, E.; Mantella, A.; Magnelli, D.; Di Maggio, T.; Villagran, A.L.; Yara, L.; Saavedra, C.; Strohmayer, M.; et al. Relentless increase of resistance to fluoroquinolones and expanded-spectrum cephalosporins in Escherichia coli: 20 years of surveillance in resource-limited settings from Latin America. Clin. Microbiol. Infect. 2013, 19, 356–361. [Google Scholar] [CrossRef]
  21. Russo, T.P.; Minichino, A.; Gargiulo, A.; Varriale, L.; Borrelli, L.; Pace, A.; Dipineto, L. Prevalence and phenotypic antimicrobial resistance among ESKAPE bacteria and Enterobacterales strains in wild birds. Antibiotics 2022, 11, 1825. [Google Scholar] [CrossRef]
  22. Saladin, M.; Cao, V.T.; Lambert, T.; Donay, J.L.; Herrmann, J.L.; Ould-Hocine, Z.; Verdet, C.; Delisle, F.; Philippon, A.; Arlet, G. Diversity of CTX-M betalactamases and their promoter regions from Enterobacteriaceae isolated in three Parisian hospitals. FEMS Microbiol. Lett. 2002, 209, 161–168. [Google Scholar] [CrossRef]
  23. Rehman, M.A.; Hasted, T.L.; Persaud-Lachhman, M.G.; Yin, X.; Carrillo, C.; Diarra, M.S. Genome analysis and multiplex PCR method for the molecular detection of Coresistance to Cephalosporins and Fosfomycin in salmonella enterica Serovar Heidelberg. J. Food Prot. 2019, 82, 1938–1949. [Google Scholar] [CrossRef]
  24. Judge, A.; Hu, L.; Sankaran, B.; Van Riper, J.; Venkataram Prasad, B.V.; Palzkill, T. Mapping the determinants of catalysis and substrate specificity of the antibiotic resistance enzyme CTX-M β-lactamase. Commun. Biol. 2023, 6, 35. [Google Scholar] [CrossRef]
  25. Al Noman, Z.; Tasnim, S.; Masud, R.I.; Anika, T.T.; Islam, M.S.; Rahman, M.T. A systematic review on reverse-zoonosis: Global impact and changes in transmission patterns. J. Adv. Vet. 2024, 11, 601. [Google Scholar] [CrossRef]
  26. Esposito, M.M.; Turku, S.; Lehrfield, L.; Shoman, A. The impact of human activities on zoonotic infection transmissions. Animals 2023, 13, 1646. [Google Scholar] [CrossRef]
  27. Siegrist, A.A.; Richardson, K.L.; Ghai, R.R.; Pope, B.; Yeadon, J.; Culp, B.; Boyer, L.V. Probable transmission of SARS-CoV-2 from African lion to zoo employees, Indiana, USA, 2021. Emerg. Infect. Dis. 2023, 29, 1102. [Google Scholar] [CrossRef] [PubMed]
  28. Tuhamize, B.; Bazira, J. Carbapenem-resistant Enterobacteriaceae in the livestock, humans and environmental samples around the globe: A systematic review and meta-analysis. Sci. Rep. 2024, 14, 16333. [Google Scholar] [CrossRef]
  29. Parker, D.; Sniatynski, M.K.; Mandrusiak, D.; Rubin, J.E. Extended-spectrum β-lactamase producing Escherichia coli isolated from wild birds in Saskatoon, Canada. Lett. Appl. Microbiol. 2016, 63, 11–15. [Google Scholar] [CrossRef]
  30. Kim, M.; Kim, M.; Yeo, Y.G.; Lee, Y.T.; Han, J.I. Antimicrobial resistance of commensal Escherichia coli and Enterococcus faecalis isolated from clinically healthy captive wild animals in Seoul zoo. Front. Vet. Sci. 2024, 10, 1283487. [Google Scholar] [CrossRef]
  31. Clemente, L.; Leão, C.; Moura, L.; Albuquerque, T.; Amaro, A. Prevalence and characterization of ESBL/AmpC producing Escherichia coli from fresh meat in Portugal. Antibiotics 2021, 10, 1333. [Google Scholar] [CrossRef] [PubMed]
  32. Dobiasova, H.; Dolejska, M.; Jamborova, I.; Brhelova, E.; Blazkova, L.; Papousek, I.; Literak, I. Extended spectrum beta-lactamase and fluoroquinolone resistance genes and plasmids among Escherichia coli isolates from zoo animals, Czech Republic. FEMS Microbiol. Ecol. 2013, 85, 604–611. [Google Scholar] [CrossRef]
  33. Husna, A.; Rahman, M.M.; Badruzzaman, A.T.M.; Sikder, M.H.; Islam, M.R.; Rahman, M.T.; Ashour, H.M. Extended-spectrum β-lactamases (ESBL): Challenges and opportunities. Biomedicines 2023, 11, 2937. [Google Scholar] [CrossRef] [PubMed]
  34. Martin, R.M.; Bachman, M. AColonization, infection, and the accessory genome of Klebsiella pneumoniae. Front. Cell Infect. Microbiol. 2018, 8, 4. [Google Scholar] [CrossRef] [PubMed]
  35. Fowler, M.E. An overview of wildlife husbandry and diseases in captivity. Rev. Sci. Tech. 1996, 15, 15–42. [Google Scholar] [CrossRef]
  36. Donkor, E.S. Cockroaches and food-borne pathogens. Environ. Health Insights 2020, 14, 1178630220913365. [Google Scholar] [CrossRef]
  37. Li, Y.; Li, D.; Liang, Y.; Cui, J.; He, K.; He, D.; Yuan, L. Characterization of a tigecycline-resistant and bla CTX-M-bearing Klebsiella pneumoniae strain from a peacock in a Chinese Zoo. Appl. Environ. Microbiol. 2023, 89, e01764-22. [Google Scholar] [CrossRef] [PubMed]
Table 1. Bird species sampled at the Miguel Angel de Quevedo petting zoological garden in Veracruz, Mexico.
Table 1. Bird species sampled at the Miguel Angel de Quevedo petting zoological garden in Veracruz, Mexico.
OrderCommon NameScientific NameBirds Sampled
“n”
FalconiformesKarakaraCaracara cheriway1
GalliformesPeafowlPavo cristatus5
GuineafowlNumida meleagris2
ChachalacasOrtalis vetula4
PsittaciformesYellow-headed amazonAmazona oratrix1
White-fronted amazonAmazona albifrons5
Red-lored amazonAmazona autumnalis5
Military macawAra militaris4
PiciformesKeel-billed toucanRamphastos sulfuratus1
AnseriformesDomestic duckAnas platyrhynchos domesticus4
Greylag gooseAnser anser2
Total 34
Table 2. Primers used in the amplification of extended-spectrum β-lactamase (ESBL)-encoding genes.
Table 2. Primers used in the amplification of extended-spectrum β-lactamase (ESBL)-encoding genes.
Antimicrobials ClassTarget GenePrimer Sequence (5′ → 3′)Product Size (bp)Reference
TAGTTGTTTCTGGATTAGAGCCT
β-LactamsblaTEMATGAGTATTCAACATTTCCGTG840[16]
TTACCAATGCTTAATCAGTGAG
blaSHVTGGTTATGCGTTATATTCGCC1051[11]
GCTTAGCGTTGCCAGTGCT
blaCTX-MTTTGCGATGTGCAGTACCAGTAA544[17]
CGATATCGTTGGTGGTGCCATA
blaCTX-M-1ATGGTTAAAAAATCACTG C900[18]
GGTGACGATTTTAGCCGC
blaCTX-M-9GATTGACCGTATTGGGAGTTT831[18]
CGGCTGGGTAAAATAGGTCA
Table 3. Summary of bacterial, antibiotic resistance patterns, and resistance genes of ESBL-producing E. coli and K. pneumoniae isolated in avian species at the Miguel Angel de Quevedo petting zoological garden in Veracruz, Mexico.
Table 3. Summary of bacterial, antibiotic resistance patterns, and resistance genes of ESBL-producing E. coli and K. pneumoniae isolated in avian species at the Miguel Angel de Quevedo petting zoological garden in Veracruz, Mexico.
Avian SpeciesIsolateESBL PhenotypesAntibiotic Resistance Patterns Based on MIC Resultsbla Gene
PeafowlE. coli+Resistance (R): AMP, AZT, CFZ, FEP, CTX, CRO, CIP, LFX, GEN, TOB, TZP.
Intermediate (I): SAM, TET.
Sensible: AMK, CFX, CZA, NIT, ETP, IPM, MPM, TGC, TMP-SMX.		blaCTX-M-1, blaTEM
PeafowlE. coli+Resistance (R): AMP, AZT, CFZ, FEP, CTX, CRO, CIP, LFX, GEN, TOB, TET.
Intermediate (I): SAM, NIT.
Sensible (S): AMK, CFX, CZA, NIT, ETP, IPM, MPM, TGC, TMP-SMX.		blaCTX-M-1, blaTEM, blaSHV
PeafowlE. coli+Resistance (R): SAM, AMP, AZT, CFZ, FEP, CTX, CRO, CIP, LFX, GEN, TOB, TMP-SMX.
Intermediate (I): TET
Sensible (S): AMK, CFX, CZA, ETP, IPM, MPM, TZP, NIT, TGC.		blaCTX-M-1, blaTEM
PeafowlE. coli
K. pneumoniae		+
+		Resistance (R): AMP, AZT, CFZ, FEP, CTX, CIP, LFX, GEN, TOB, NIT.
Intermediate (I): SAM, CRO.
Sensible (S): AMK, CFX, CZA, ETP, IPM, MPM, TZP, TET, TGC, TMP-SMX.
Resistance (R): AMP, AZT, CFZ, FEP, CFX, CTX, CRO.
Intermediate (I): TET
Sensible (S): AMK, GEN, TOB, SAM, CZA, CIP, LFX, ETP, IPM, MPM, TZP, NIT, TGC, TMP-SMX.		blaCTX-M-1, blaTEM
blaCTX-M-1,
GuineafowlE. coli+Resistance (R): AMP, AZT, CFZ, FEP, CTX, CRO, CIP, LFX, GEN, TOB, TZP.
Intermediate (I): SAM.
Sensible (S): AMK, CFX, CZA, ETP, IPM, MPM, NIT, TET, TGC, TMP-SMX.		blaCTX-M-1, blaTEM,
GuineafowlE. coli+Resistance (R): AMP, AZT, CFZ, FEP, CTX, CIP, GEN, TOB.
Intermediate (I): LFX.
Sensible (S): AMK, SAM, CFX, CZA, CRO, ETP, IPM, MPM, TZP, NIT, TET, TGC, TMP-SMX.		blaCTX-M-1, blaTEM,
KarakaraE. coli-Resistance (R): AMP, SAM, AZT, CZA, TZP, TET, TMP-SMX.
Intermediate (I): IPM.
Sensible (S): AMK, GEN, TOB, FEP, CTX, CRO, CFZ, CFX, CIP, LFX, ETP, MPM, TGC, NIT.		blaCTX-M-1,
ChachalacasE. coli-Resistance (R): AZT, CZA, TZP, TET, TMP-SMX.
Sensible (S): AMP, SAM, AMK, GEN, TOB, FEP, CTX, CRO, CFZ, CFX, CIP, LFX, ETP, IPM, MPM, TGC, NIT.		blaCTX-M-1, blaTEM,
Red-lored amazonE. coli-Intermediate (I): AMK, CTX, LFX
Sensible (S): GEN, SAM, AMP, AZT, CFZ, FEP, CFX, CIP, CZA, CRO, ETP, IPM, MPM, TZP, TET, TGC, TOB, TMP-SMX, NIT.		blaCTX-M-1, blaTEM,
Red-lored amazonE. coli-Intermediate (I): AMK, CTX, LFX
Sensible (S): GEN, SAM, AMP, AZT, CFZ, FEP, CFX, CIP, CZA, CRO, ETP, IPM, MPM, TZP, TET, TGC, TOB, TMP-SMX, NIT		blaCTX-M-1, blaTEM,
Red-lored amazonE. coli Intermediate (I): AMK, CTX, LFX
Sensible (S): GEN, SAM, AMP, AZT, CFZ, FEP, CFX, CIP, CZA, CRO, ETP, IPM, MPM, TZP, TET, TGC, TOB, TMP-SMX, NIT		blaCTX-M-1, blaTEM,
Keel-billed toucanE. coli-Resistance (R): AMP, SAM, TET, TMP-SMX.
Sensible (S): AMK, CTX, LFX, GEN, AZT, CFZ, FEP, CFX, CIP, CZA, CRO, ETP, IPM, MPM, TZP, TGC, TOB, NIT.		blaCTX-M-1, blaTEM,
Domestic duck (1)E. coli-Resistance (R): AMK, GEN, TOB, AMP, SAM, AZT, CFZ, FEP, CTX, CZA, CRO, CIP, LFX, TET, NIT, TMP-SMX
Sensible (S): CFX, ETP, IPM, MPM, TZP, TGC.		blaCTX-M-1,
Domestic duck (2)E. coli-Resistance (R): AMK, GEN, CRO, LFX, TET, TMP-SMX.
Intermediate (I): CFX, ETP.
Sensible: AMP, SAM, AZT, CFZ, FEP, CZA, CIP, IPM, MPM, TZP, TGC, TOB.		blaCTX-M-1
Domestic duck (3) E. coli-Resistance (R): AMP, SAM, TET, TMP-SMX.
Intermediate (I): LFX, TOB.
Sensible (S): AMK, GEN, CFZ, FEP, CFX, CZA, CRO, TZP, ETP, IPM, MPM, CIP, TGC.		blaCTX-M-1, blaTEM,
Greylag goose (1)E. coli-Resistance (R): AMK, AMP, SAM, AZT, CRO, TET, TMP-SMX
Intermediate (I): FEP, CFX.
Sensible (S): AMK, GEN. TOB, CFZ, CZA, CRO, ETP, IPM, MPM, TZP, TGC, CIP, LFX.		blaCTX-M-1
Greylag goose (2)E. coli-Resistance (R): AMK, TOB, AMP, AZT, CTX, CZA, ETP, TET, TMP-SMX.
Intermediate (I): LFX
Sensible (S): AMK, GEN, SAM, CFZ, FEP, CFX, CRO, CIP, IPM, MPM, TZP, TGC, CIP.		blaCTX-M-1, blaTEM,
Amikacin: AMK; Ampicillin–Sulbactam (2:1 ratio of β-lactam to inhibitor): SAM; Ampicillin: AMP; Aztreonam: AZT Cefazolin: CFZ; Cefepime: FEP; Cefotaxime: CTX; Cefoxitin: CFX; Ceftazidime-Avibactam: CZA; Ceftriaxone: CRO; Ciprofloxacin: CIP, Ertapenem; ETP; Gentamicin; GEN; Imipenem: IPM; Levofloxacin: LFX: Meropenem: MPM; Nitrofurantoin: NIT; Piperacillin/Tazobactam: TZP; Tetracycline: TET; Tigecycline: TGC; Tobramycin: TOB; Trimethoprim/Sulfamethxazole: TMP-SMX. ESBLs: Extended-Spectrum Beta-Lactamases.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Casas-Paul, J.; Bravo-Ramos, J.L.; Sánchez-Otero, M.G.; Sánchez-Montes, S.; Bonilla-Rojas, S.; Ortíz-Carbajal, L.A.; Ballados-González, G.G.; Gamboa-Prieto, J.; Chong-Guzmán, A.; Olivares Muñoz, A. Presence of Extended-Spectrum Beta-Lactamase-Producing Escherichia coli and Klebsiella pneumoniae Isolated from Avian Species in a Petting Zoological Garden. J. Zool. Bot. Gard. 2025, 6, 42. https://doi.org/10.3390/jzbg6030042

AMA Style

Casas-Paul J, Bravo-Ramos JL, Sánchez-Otero MG, Sánchez-Montes S, Bonilla-Rojas S, Ortíz-Carbajal LA, Ballados-González GG, Gamboa-Prieto J, Chong-Guzmán A, Olivares Muñoz A. Presence of Extended-Spectrum Beta-Lactamase-Producing Escherichia coli and Klebsiella pneumoniae Isolated from Avian Species in a Petting Zoological Garden. Journal of Zoological and Botanical Gardens. 2025; 6(3):42. https://doi.org/10.3390/jzbg6030042

Chicago/Turabian Style

Casas-Paul, Juan, José Luis Bravo-Ramos, María Guadalupe Sánchez-Otero, Sokani Sánchez-Montes, Sashenka Bonilla-Rojas, Luis Arturo Ortíz-Carbajal, Gerardo Gabriel Ballados-González, Jannete Gamboa-Prieto, Alejandra Chong-Guzmán, and Angelica Olivares Muñoz. 2025. "Presence of Extended-Spectrum Beta-Lactamase-Producing Escherichia coli and Klebsiella pneumoniae Isolated from Avian Species in a Petting Zoological Garden" Journal of Zoological and Botanical Gardens 6, no. 3: 42. https://doi.org/10.3390/jzbg6030042

APA Style

Casas-Paul, J., Bravo-Ramos, J. L., Sánchez-Otero, M. G., Sánchez-Montes, S., Bonilla-Rojas, S., Ortíz-Carbajal, L. A., Ballados-González, G. G., Gamboa-Prieto, J., Chong-Guzmán, A., & Olivares Muñoz, A. (2025). Presence of Extended-Spectrum Beta-Lactamase-Producing Escherichia coli and Klebsiella pneumoniae Isolated from Avian Species in a Petting Zoological Garden. Journal of Zoological and Botanical Gardens, 6(3), 42. https://doi.org/10.3390/jzbg6030042

Article Metrics

Back to TopTop