Next Article in Journal
The Challenge of Bacterial Strain Identification: Leptospira interrogans Serovars Australis in a Dog and Long-Term Clinical Follow-Up
Next Article in Special Issue
Pan African Vivax and Ovale Network (PAVON) Malaria Diagnostic Competency Training: Offering Training Opportunities to Impact Malaria Elimination Strategies in Sub-Saharan Africa
Previous Article in Journal
Evaluation of Serological Tests for Different Disease Stages of Leptospirosis Infection in Humans
Previous Article in Special Issue
A Five-Year Malaria Prevalence/Frequency in Makenene in a Forest–Savannah Transition Ecozone of Central Cameroon: The Results of a Retrospective Study
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Review

Genotyping and Characterizing Plasmodium falciparum to Reveal Genetic Diversity and Multiplicity of Infection by Merozoite Surface Proteins 1 and 2 (msp-1 and msp-2) and Glutamate-Rich Protein (glurp) Genes

1
Department of Clinical Laboratory Science, College of Applied Medical Sciences, Jouf University, Sakaka 72388, Saudi Arabia
2
Medical Surgical Nursing Department, Faculty of Nursing, King Abdulaziz University, Jeddah 21589, Saudi Arabia
3
School of Medicine, Pharmacy and Biomedical Sciences, University of Portsmouth, Portsmouth PO1 2DT, UK
*
Authors to whom correspondence should be addressed.
Trop. Med. Infect. Dis. 2024, 9(11), 284; https://doi.org/10.3390/tropicalmed9110284
Submission received: 10 October 2024 / Revised: 10 November 2024 / Accepted: 11 November 2024 / Published: 20 November 2024
(This article belongs to the Special Issue The Global Burden of Malaria and Control Strategies)

Abstract

:
Resistance to current antimalarial drugs is steadily increasing, and new drugs are required. Drug efficacy trials remain the gold standard to assess the effectiveness of a given drug. The World Health Organization (WHO)’s recommendation for the optimal duration of follow-up for assessing antimalarial efficacy is a minimum of 28 days. However, assessing antimalarial drug efficacy in highly endemic regions can be challenging due to the potential risks of acquiring a new infection in the follow-up period, and thus, it may underestimate the efficacy of the given drugs. A new treatment should be introduced if treatment failure rates exceed 10%. Overestimation occurs as a result of retaining a drug with a clinical efficacy of less than 90% with increases in morbidity and mortality, while underestimation may occur due to a misclassification of new infections as treatment failures with tremendous clinical and economic implications. Therefore, molecular genotyping is necessary to distinguish true new infections from treatment failures to ensure accuracy in determining antimalarial efficacy. There are three genetic markers that are commonly used in antimalarial efficiency trials to discriminate between treatment failures and new infections. These include merozoite surface protein 1 (msp-1), merozoite surface protein 2 (msp-2), and glutamate-rich protein (glurp). The genotyping of P. falciparum by nested polymerase chain reaction (n-PCR) targeting these markers is discussed with the inherent limitations and uncertainties associated with the PCR technique and limitations enforced by the parasite’s biology itself.

1. Introduction

Plasmodium falciparum is the most common and harmful species of malarial parasite that infects humans [1]. There were approximately 241 million documented cases and 627,000 fatalities attributed to malaria worldwide in 2023 [2]. Africa is the home of more than 95% of malarial infections and deaths [2]. Resistance towards antimalarial drugs and the emergence of resistant mosquitoes to insecticides are the main hurdles to the control and elimination of malaria [3].
Resistance to P. falciparum is a growing concern globally since resistance to almost all available antimalarial drugs has been reported [4]. Resistance is defined as the “capacity of a strain of parasite to persist and reproduce even when a medicine is given in dosages that are equivalent to or greater than the typically advised amounts, but the subject is still able to tolerate it” [5]. Recurrent or persistent P. falciparum infection up to 28 days after treatment with antimalarial drugs is a sign of resistant parasites [6]. Hence, it is imperative to expedite the development of novel antimalarial therapies and closely observe the emergence and spread of resistance parasites [7].
The mechanisms underlying genetic resistance towards antimalarial drugs have been demonstrated for certain drugs [8]. Single nucleotide polymorphisms (SNPs) in the P. falciparum dihydrofolate reductase gene (pfdhfr) provide resistance to pyrimethamine, whereas mutations in the P. falciparum dihydropteroate synthase gene (pfdhps) mediate resistance to sulfadoxine [9,10]. In addition, chloroquine resistance has been attributed to a key gene called the P. falciparum chloroquine resistance transporter gene (pfcrt), which is also linked to decreased sensitivity to amodiaquine [11]. Other genes have also been identified, such as P. falciparum multidrug resistance protein 1 (pfmdr1) and multidrug resistance-associated protein (pfmrp1), which encode proteins located on the digestive vacuole or the plasma membrane [12].
In antimalarial drug efficacy studies, resistance markers would not be sufficient to discriminate between recrudescent and new infections. Even though in vitro assays are standard methods to determine resistance, they can be confusing as not all parasite strains grow equally. In addition, sequestered parasites in deep tissues may go undetected during sampling [13,14].
For practical purpose, resistance to a given antimalarial drug can be estimated by comparing the treatment failures to the number of successfully treated individuals [5,6]. However, treatment failures might occur due to recrudescence or new infections [5]. Recrudescence is defined as the recurrence of the asexual stage of parasites of the same genotypes that caused the initial infection [5]. New infections result from new inoculation by mosquitoes, resulting in the introduction of new parasites which are more likely to be genetically distinct. Given the fact that the incubation period of P. falciparum might be as brief as seven days, in areas with high malaria transmission, new infections cannot be ruled out, and therefore, it is difficult to discriminate recrudescence from new infections, which may influence the accuracy of resistance estimates to a given drug [15]. Most antimalarial drugs act on asexual erythrocytic blood stages; parasites like P. vivax and P. ovale develop hypnozoite stages, resulting in a relapsing form classified as recrudescence [8].
In antimalarial drug efficacy studies, there is a need for a technique to differentiate between recrudescence and new infections to better estimate the efficacy of a given drug [16]. P. falciparum is known to be genetically diverse, and this genetic diversity has been studied intensively with respect to many aspects [17,18,19]. The simplest polymorphisms found in P. falciparum are SNPs resulting from a single base substitution, and most of these mutations are associated with non-synonymous mutations, such as mutations found in pfdhfr, pfdhps, and pfcrt, which confer resistance to antimalarial drugs [9,10,11]. Other polymorphisms are attributed to the presence of repetitive sequences, and based on their number and arrangement, parasite lines can be classified into distinct families [20,21]. While any polymorphic sequences can be utilized as genetic markers, there are some conditions which must be met in order to consider a specific sequence suitable as a genetic marker. These conditions include the following: (1) a given sequence must present in a single copy, (2) the polymorphic region has to be found in all of the parasites, and no null variants can be found naturally, and (3) the variable region needs to be stable and cannot mutate through the successive mitotic division during asexual reproduction. The effectiveness of genetic markers depends on the degree of polymorphism, the frequency of these markers in a specific population, and the ease with which these genetic markers can be detected and discriminated.
In P. falciparum, three genes have been widely used as genetic markers, and these genes include msp-1, msp-2, and glurp [22,23,24] (see Table 1). These genes are considered the most commonly selected genetic markers due to the fact that these loci are situated on different chromosomes, which decreases the likelihood of linkage, and because they are highly polymorphic [20,25]. In this review article, we discuss the importance of these genes in characterizing the genetic diversity and multiplicity of infection (MOI) of P. falciparum.

2. The msp-1 Gene

The msp-1 gene is situated on chromosome 9 and encodes a surface protein on the merozoite with a molecular weight ranging from 190 to 200 kDa [26,27]. Merozoite is the infecting stage to erythrocytes, and therefore, msp-1 is the basis for one of the vaccine candidates [28]. Even though the function of msp-1 is not fully understood, it has been suggested that it is essential for Plasmodium development [29]. In addition, it has been thought that msp-1 plays a significant part in the attachment and invasion of erythrocytes [30,31]. msp-1 can be segmented into 17 blocks, each flanked by conserved areas, based on the arrangement of its amino acids [26,27]. Block 2 exhibits the highest degree of polymorphism and contains a highly repetitive variable region through which, based on the number of repeats and their arrangement, msp-1 can be classified into three allelic families: MAD20, K1, and RO33 [32,33]. Block 2 encodes 65 amino acids and is predicated to be unstructured [34]. The schematic gene structure and primers used to amplify conserved and polymorphic regions are shown in Figure 1.
Block 2 is the most polymorphic region and comprises three allelic families: K1, MAD20, and RO33. The primer sequence used to amplify this region can be found in Table 2.

3. The msp-2 Gene

The second most prevalent merozoite surface protein is msp-2. This protein is encoded by the msp-2 gene, which is situated on chromosome 2 and has a molecular weight of 30 kDa [23,32]. Like msp-1, msp-2 seems to be involved in invasion; its the exact role remains unclear, but specific antibodies against msp-2 have been associated with some sort of protection in endemic regions [35,36]. The msp-2 gene consists of five domains, with the central domain being a highly polymorphic region. Although multiple alleles can be found and detected, msp-2 is divided into two major allelic families known as FC27 and 3D7 [23]. A schematic diagram of msp-2 is illustrated in Figure 2.
Block 3 is the most polymorphic region and comprises two allelic families, FC27 and 3D7. The primer sequence used to amplify this region can be found in Table 2.

4. The glurp Gene

The glurp gene is one of the polymorphic antigens which can act as a genetic marker to characterize P. falciparum populations [20]. The gene is situated on chromosome 10 and codes for a 220 kDa protein which is expressed in all phases of the parasite’s asexual reproduction [24,37]. The glurp is localized on the merozoite surface in a complex protein called Ps38 [38]. This complex protein binds to the erythrocyte through glycoprotein A and acts as a receptor [38]. Evidence supports the function of this gene as an immune target, suggesting that an immune response against this gene may confer some protection [39]. The glurp gene comprises three defined areas, namely R0 (N-terminal non-repetitive), R1 (central repetitive sequence), and R2 (C-terminal repetitive domain) [37]. In fact, antibody levels against the R0 and R2 domains were positively correlated with a decreased risk of symptomatic malaria [40]. Despite the fact that the R2 region is conservative compared to other regions, the number of repeat units of amino is variable amongst P. falciparum isolates, leading to a size polymorphism [41]. Therefore, the glurp gene is one of the genetic markers commonly used as a genetic tool in many studies to characterize the MOI and genetic diversity in P. falciparum populations, indicating the importance of this marker [42,43,44]. The glurp schematic structure is demonstrated in Figure 3.
C-terminal repetitive region RII consists of repeat units, and their numbers and arrangements differ between parasite clones. The primer sequence used to amplify this region can be found in Table 2.

5. Genetic Measurements Used to Characterize Genetic Diversity in P. falciparum

When genotyping P. falciparum populations using the above genetic markers, numerous genetic measurements like expected heterozygosity (HE), MOI, and linkage disequilibrium (LD) can be used to estimate the factors influencing P. falciparum’s population structure [45,46,47,48]. The first two are the most common measurements since they are easily calculated, and their values are relevant to malaria transmission. The expected heterozygosity measures the loci diversity and is defined as the likelihood that at a given locus, any two alleles are different from each other when chosen randomly from a specific population [49]. It is calculated based on the following formula: [n/n − 1] [1 − ΣP2]. n represents the sample size, and P represents the allele frequency. HE has a potential value ranging from 0 to 1, where 0 indicates no allelic diversity, while 1 means that all sampled alleles are different [49]. The MOI refers to the mean number of distinctive P. falciparum genotypes per infected person. The calculation involves dividing the number of P. falciparum genotypes detected by the total number of samples that are positive [50].
The expected heterozygosity and MOIs have been studied in multiple malaria-endemic regions, and they perform a key role in understating malaria transmission [51,52]. In fact, highly malaria-endemic regions tend to be associated with elevated levels of HE and a high MOI, while in contrast, low genetic diversity and MOI are reported in areas with low malaria transmission settings like South America and Southeast Asia [53,54,55,56]. Intensive malaria control measures contribute to the reduction in malaria spread in many areas in sub-Saharan Africa, suggesting that the population structures of P. falciparum in these regions may become similar to populations in regions with a low incidence of malaria. In fact, the intensification of malaria prevention and control measures has shown to reduce malaria transmission and influence the genetic diversity and population structures of P. falciparum [57,58,59]. Hence, genetic diversity and MOI can be employed to evaluate the usefulness of malaria control strategies and to monitor the consequences of eradication programs. In addition, genotyping msp-1, msp-2, and glurp may help in tracing parasite clones with time in cohort studies and evaluate the infection’s duration [60,61]. More importantly, these genetic markers are useful in distinguishing between recrudescence and new infections of P. falciparum in antimalarial drug trials [16,42].
Discriminatory power of markers: The discriminatory power of a particular marker relies on the amount of diversity of alleles and their frequency in the circulating parasite population [20]. The discriminatory power of msp-1, msp-2, and glurp markers is still debatable. While some research states that msp-2 is the most powerful with more alleles detected, other studies have reported that msp-1 is more powerful than msp-2 [16,44]. Even though the selection and number of genetic markers are still controversial, the recommended strategy for P. falciparum genotyping in antimalarial drug efficacy studies stipulate conducting a consecutive analysis starting with a highly polymorphic genetic marker and moving towards the least polymorphic marker [16]. As the number of genetic markers increases, the probability of detecting different alleles from two independent samples also increases [62]. Therefore, identical alleles observed in two samples taken from the same individual might indicate that infection is more likely to be attributable to recrudescence. In such a case in which alleles are distinct, a new infection can be assumed [16]. However, this is especially difficult in highly endemic regions where multiple infections are common.
Techniques to analyze genetic markers: Primary and nested polymerase chain reaction (nPCR) methods targeting an allele-specific family region on the parasite are the most commonly used methods to genotype parasite populations [20]. The advantages of this type of method is that it includes increasing sensitivity to detect minor alleles, and minor variations in amplification conditions means they have little or no impact on detection sensitivity [20]. However, there are of course downsides with this methodology as it is time-consuming and additional materials are required [63]. In addition, there is a substantially increased risk for contamination, which can be mitigated if good lab practice precautions are employed [20]. Several primer sequences have been published in the literature, so a primary PCR is performed by first targeting conserved sequences flanking polymorphic regions, and this is then followed by nested PCR using the product of the first PCR reaction as the DNA template to amplify the polymorphic regions. The primers’ names, sequences, and targeted regions are illustrated in Table 2 [20]. The conserved sequences and flanking polymorphic areas are distinct to each family and shared among allelic variants within the same family. Depending on the number of families present, pairs of primers can be used to amplify the polymorphic region on each family, and the allelic variant will be detected [20].
PCR products are then analyzed by electrophoresis, for example, as they can be easily visualized even if they are obtained from a single parasite. Identifying allelic variants is achieved by determining the size of the DNA fragment following gel electrophoresis.
Restriction fragment length polymorphism (RFLP) is another genotyping method to characterize the genetic diversity of P. falciparum [64]. Although it allows for a rapid evaluation of samples on a large scale with sufficient specificity and discriminatory power, it is important to realize that it requires large sample volumes. The polymorphic region is amplified first by PCR, and then one or more restriction enzymes are used with the PCR products being used as templates. The digested fragments can be analyzed using polyacrylamide gel electrophoresis. This may result in a specific banding pattern, which can distinguish different alleles within the genotyped markers [65].

6. Interpretation and Technical Considerations

Although primers targeting an allele-specific family sequence in msp-1, msp-2, and glurp are highly specific, PCR products are observed only when P. falciparum DNA is present [20]. Only one band may be seen on a gel if a single clone of parasite is expected. Typically, observing multiple bands in a given PCR product is interpreted as an infection with multiple clones or genotypes of the parasite [16]. However, it is important to note that two bands with the same molecular size may not necessarily represent the same allele as two different alleles may have the same molecular size but differ at the sequence level [20]. In addition, this may underestimate the allele frequency as the distinct genotype of the parasite might not be differentiated in such an analysis. However, direct sequencing of the amplified region would overcome this issue, and although using this method is the best way to differentiate between alleles with the same fragment size that differ at the sequence level, it may fail in cases of alleles carrying multiple clones.
Despite the fact that the genotyping of P. falciparum has been described in various studies [46,55,56], there is no consensus on the analysis and interpretation of outcomes, rendering it difficult to compare clinical trials and studies [43,44]. Although it is an arbitrary cut off, it is generally accepted that DNA fragments within 20 base pair ranges are considered one allele for msp-1 and msp-2, and those within 50 base pair ranges are considered one allele for glurp [16,66]. This method can group alleles with a similar fragment size; however, it does not detect the presence or absence of single-point mutation that may be present across amplified regions [20]. Direct sequencing may be the gold standard to distinguish these alleles, but this method is not practical, especially in field situations [16]. Compared to regular gel electrophoresis, capillary electrophoresis can be used, which increases the resolution, and 2–3 base pair differences might be detected [25]. Discrimination between new infection and recrudescence can be complex, especially when using more than one molecular marker. In drug efficacy studies, the genotypic pattern of the parasite which appears during the time of admission is compared with the genotype of the reappearing parasite to discriminate between true recrudescence and a new infection [16]. However, although there is no consensus in how to define recrudescence and a new infection, it is generally accepted that a new infection is considered when all alleles in the parasites observed following treatment are dissimilar from those observed at the admission time for one or more loci [16]. An infection is categorized as recrudescence when at least one allele is shared at each locus in both paired samples [16]. These two definitions are important as they are mutually exclusive. The sample is either categorized as recrudescence or a new infection, but both categories are never assigned as the same time.
It should be noted that it is recommended that for molecular genotyping, blood samples must be taken right before treatment is initiated and on the first reappearance of parasitemia following the clearance of the parasite. Genotyping should be performed sequentially using three markers, msp-1, msp-2, and glurp, and once the infection has been defined as a new infection, the analysis should be stopped. In such a case where no evidence of a new infection is determined by the first marker, the second marker should be analyzed, and if no new infection is indicated, the third marker is used as the last marker. If the analysis of all markers excludes the possibility of a new infection, then the sample would be defined as recrudescence [16].

7. Conclusions

Genotyping P. falciparum is critically important to discriminate between a new infection and recrudescence to evaluate antimalarial drugs’ efficacy. Three key genetic markers, msp-1, msp-2, and glurp, are mostly used to characterize the genetic diversity of P. falciparum. These markers should be used sequentially until a new infection or recrudescence definition is met. Even though discriminating between these two categories can be complicated, confidence in the result can be increased by actions such as protection from further mosquito bites, using a drug that can target the liver stage, and ensuring that enough consecutive samples are analyzed. Genetic diversity and characterizing parasite populations can provide valuable information for selection processes that might be induced by vaccines, mosquito control, or environmental changes. More importantly, this information is needed for decision making and policy making regarding the use of new or established drugs.

Author Contributions

Conceptualization and methodology, M.A. (Muharib Alruwaili) and A.Y.E.; writing—original draft preparation, M.A. (Muharib Alruwaili), H.E. and A.F.; writing—review and editing, J.M.; project administration and resources, M.A. (Muhammad Atif) and H.A.; funding acquisition, M.A. (Muharib Alruwaili) and A.Y.E. All authors have read and agreed to the published version of the manuscript.

Funding

This research is funded by the Deanship of Graduate Studies and Scientific Research at Jouf University through the Fast-Track Research Funding Program.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Cowman, A.F.; Healer, J.; Marapana, D.; Marsh, K. Malaria: Biology and Disease. Cell 2016, 167, 610–624. [Google Scholar] [CrossRef] [PubMed]
  2. WHO. Malaria; World Health Organization: Geneva, Switzerland, 2022.
  3. Plowe, C.V. Malaria chemoprevention and drug resistance: A review of the literature and policy implications. Malar. J. 2022, 21, 104. [Google Scholar] [CrossRef] [PubMed]
  4. Shibeshi, M.A.; Kifle, Z.D.; Atnafie, S.A. Antimalarial Drug Resistance and Novel Targets for Antimalarial Drug Discovery. Infect. Drug Resist. 2020, 13, 4047–4060. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  5. WHO. Guidelines for Malaria; World Health Organization: Geneva, Switzerland, 2021. [PubMed]
  6. WHO. Methods for Surveillance of Antimalarial Drug Efficacy; World Health Organization: Geneva, Switzerland, 2009.
  7. East African Network for Monitoring Antimalarial Treatment (EANMAT). Monitoring antimalarial drug resistance within National Malaria Control Programmes: The EANMAT experience. Trop. Med. Int. Health 2001, 6, 891–898. [Google Scholar] [CrossRef] [PubMed]
  8. Antony, H.A.; Parija, S.C. Antimalarial drug resistance: An overview. Trop. Parasitol. 2016, 6, 30–41. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  9. Cowman, A.F.; Morry, M.J.; Biggs, B.A.; Cross, G.A.; Foote, S.J. Amino acid changes linked to pyrimethamine resistance in the dihydrofolate reductase-thymidylate synthase gene of Plasmodium falciparum. Proc. Natl. Acad. Sci. USA 1988, 85, 9109–9113. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  10. Triglia, T.; Cowman, A.F. The mechanism of resistance to sulfa drugs in Plasmodium falciparum. Drug Resist. Updates 1999, 2, 15–19. [Google Scholar] [CrossRef] [PubMed]
  11. Fidock, D.A.; Nomura, T.; Talley, A.K.; Cooper, R.A.; Dzekunov, S.M.; Ferdig, M.T.; Ursos, L.M.; Sidhu, A.B.; Naudé, B.; Deitsch, K.W.; et al. Mutations in the P. falciparum digestive vacuole transmembrane protein PfCRT and evidence for their role in chloroquine resistance. Mol. Cell. 2000, 6, 861–871. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  12. Duraisingh, M.T.; Cowman, A.F. Contribution of the pfmdr1 gene to antimalarial drug-resistance. Acta Trop. 2005, 94, 181–190. [Google Scholar] [CrossRef] [PubMed]
  13. Viriyakosol, S.; Siripoon, N.; Zhu, X.P.; Jarra, W.; Seugorn, A.; Brown, K.N.; Snounou, G. Plasmodium falciparum: Selective growth of subpopulations from field samples following in vitro culture, as detected by the polymerase chain reaction. Exp. Parasitol. 1994, 79, 517–525. [Google Scholar] [CrossRef] [PubMed]
  14. Farnert, A.; Snounou, G.; Rooth, I.; Bjorkman, A. Daily dynamics of Plasmodium falciparum subpopulations in asymptomatic children in a holoendemic area. Am. J. Trop. Med. Hyg. 1997, 56, 538–547. [Google Scholar] [CrossRef] [PubMed]
  15. Orish, V.; Afutu, L.; Ayodele, O.; Likaj, L.; Marinkovic, A.; Sanyaolu, A. A 4-Day Incubation Period of Plasmodium falciparum Infection in a Nonimmune Patient in Ghana: A Case Report. Open Forum Infect. Dis. 2019, 6, ofy169. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  16. WHO. Methods for Surveillance of Antimalarial Drug Efficacy: Genotyping to Identify Parasite Populations: Informal Consultation Organized by the Medicines for Malaria Venture and Cosponsored by the World Health Organization; World Health Organization: Geneva, Switzerland, 2008.
  17. Conway, D.J.; Greenwood, B.M.; McBride, J.S. Longitudinal study of Plasmodium falciparum polymorphic antigens in a malaria-endemic population. Infect. Immun. 1992, 60, 1122–1127. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  18. Engelbrecht, F.; Felger, I.; Genton, B.; Alpers, M.; Beck, H.P. Plasmodium falciparum: Malaria morbidity is associated with specific merozoite surface antigen 2 genotypes. Exp. Parasitol. 1995, 81, 90–96. [Google Scholar] [CrossRef] [PubMed]
  19. Ntoumi, F.; Contamin, H.; Rogier, C.; Bonnefoy, S.; Trape, J.F.; Mercereau-Puijalon, O. Age-dependent carriage of multiple Plasmodium falciparum merozoite surface antigen-2 alleles in asymptomatic malaria infections. Am. J. Trop. Med. Hyg. 1995, 52, 81–88. [Google Scholar] [CrossRef] [PubMed]
  20. Snounou, G. Genotyping of Plasmodium spp. Nested PCR. Methods Mol. Med. 2002, 72, 103–116. [Google Scholar] [CrossRef] [PubMed]
  21. Escalante, A.A.; Lal, A.A.; Ayala, F.J. Genetic polymorphism and natural selection in the malaria parasite Plasmodium falciparum. Genetics 1998, 149, 189–202. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  22. Miller, L.H.; Roberts, T.; Shahabuddin, M.; McCutchan, T.F. Analysis of sequence diversity in the Plasmodium falciparum merozoite surface protein-1 (MSP-1). Mol. Biochem. Parasitol. 1993, 59, 1–14. [Google Scholar] [CrossRef] [PubMed]
  23. Smythe, J.A.; Peterson, M.G.; Coppel, R.L.; Saul, A.J.; Kemp, D.J.; Anders, R.F. Structural diversity in the 45-kilodalton merozoite surface antigen of Plasmodium falciparum. Mol. Biochem. Parasitol. 1990, 39, 227–234. [Google Scholar] [CrossRef] [PubMed]
  24. Borre, M.B.; Dziegiel, M.; Høgh, B.; Petersen, E.; Rieneck, K.; Riley, E.; Meis, J.F.; Aikawa, M.; Nakamura, K.; Harada, M.; et al. Primary structure and localization of a conserved immunogenic Plasmodium falciparum glutamate rich protein (GLURP) expressed in both the pre-erythrocytic and erythrocytic stages of the vertebrate life cycle. Mol. Biochem. Parasitol. 1991, 49, 119–131. [Google Scholar] [CrossRef] [PubMed]
  25. Gupta, V.; Dorsey, G.; Hubbard, A.E.; Rosenthal, P.J.; Greenhouse, B. Gel versus capillary electrophoresis genotyping for categorizing treatment outcomes in two anti-malarial trials in Uganda. Malar. J. 2010, 9, 19. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  26. Tanabe, K.; Mackay, M.; Goman, M.; Scaife, J.G. Allelic dimorphism in a surface antigen gene of the malaria parasite Plasmodium falciparum. J. Mol. Biol. 1987, 195, 273–287. [Google Scholar] [CrossRef] [PubMed]
  27. Takala, S.; Branch, O.; Escalante, A.A.; Kariuki, S.; Wootton, J.; Lal, A.A. Evidence for intragenic recombination in Plasmodium falciparum: Identification of a novel allele family in block 2 of merozoite surface protein 1: Asembo Bay Area Cohort Project XIV. Mol. Biochem. Parasitol. 2002, 125, 163–171. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  28. Thomson-Luque, R.; Stabler, T.C.; Fürle, K.; Silva, J.C.; Daubenberger, C. Plasmodium falciparum merozoite surface protein 1 as asexual blood stage malaria vaccine candidate. Expert. Rev. Vaccines 2024, 23, 160–173. [Google Scholar] [CrossRef] [PubMed]
  29. O’Donnell, R.A.; Saul, A.; Cowman, A.F.; Crabb, B.S. Functional conservation of the malaria vaccine antigen MSP-119 across distantly related Plasmodium species. Nat. Med. 2000, 6, 91–95. [Google Scholar] [CrossRef] [PubMed]
  30. Boyle, M.J.; Richards, J.S.; Gilson, P.R.; Chai, W.; Beeson, J.G. Interactions with heparin-like molecules during erythrocyte invasion by Plasmodium falciparum merozoites. Blood 2010, 115, 4559–4568. [Google Scholar] [CrossRef] [PubMed]
  31. Combe, A.; Giovannini, D.; Carvalho, T.G.; Spath, S.; Boisson, B.; Loussert, C.; Thiberge, S.; Lacroix, C.; Gueirard, P.; Ménard, R. Clonal conditional mutagenesis in malaria parasites. Cell Host Microbe 2009, 5, 386–396. [Google Scholar] [CrossRef] [PubMed]
  32. Snewin, V.A.; Herrera, M.; Sanchez, G.; Scherf, A.; Langsley, G.; Herrera, S. Polymorphism of the alleles of the merozoite surface antigens MSA1 and MSA2 in Plasmodium falciparum wild isolates from Colombia. Mol. Biochem. Parasitol. 1991, 49, 265–275. [Google Scholar] [CrossRef] [PubMed]
  33. File, T.; Chekol, T.; Solomon, G.; Dinka, H.; Golassa, L. Detection of high frequency of MAD20 allelic variants of Plasmodium falciparum merozoite surface protein 1 gene from Adama and its surroundings, Oromia, Ethiopia. Malar. J. 2021, 20, 385. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  34. Dijkman, P.M.; Marzluf, T.; Zhang, Y.; Chang, S.S.; Helm, D.; Lanzer, M.; Bujard, H.; Kudryashev, M. Structure of the merozoite surface protein 1 from Plasmodium falciparum. Sci. Adv. 2021, 7, eabg0465. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  35. Balam, S.; Olugbile, S.; Servis, C.; Diakité, M.; D’Alessandro, A.; Frank, G.; Moret, R.; Nebie, I.; Tanner, M.; Felger, I.; et al. Plasmodium falciparum merozoite surface protein 2: Epitope mapping and fine specificity of human antibody response against non-polymorphic domains. Malar. J. 2014, 13, 510. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  36. Metzger, W.G.; Okenu, D.M.; Cavanagh, D.R.; Robinson, J.V.; Bojang, K.A.; Weiss, H.A.; McBride, J.S.; Greenwood, B.M.; Conway, D.J. Serum IgG3 to the Plasmodium falciparum merozoite surface protein 2 is strongly associated with a reduced prospective risk of malaria. Parasite Immunol. 2003, 25, 307–312. [Google Scholar] [CrossRef] [PubMed]
  37. Høgh, B.; Thompson, R.; Zakiuddin, I.S.; Boudin, C.; Borre, M. Glutamate rich Plasmodium falciparum antigen (GLURP). Parasitologia 1993, 35, 47–50. [Google Scholar] [PubMed]
  38. Paul, G.; Deshmukh, A.; Kaur, I.; Rathore, S.; Dabral, S.; Panda, A.; Singh, S.K.; Mohmmed, A.; Theisen, M.; Malhotra, P. A novel Pfs38 protein complex on the surface of Plasmodium falciparum blood-stage merozoites. Malar. J. 2017, 16, 79. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  39. Dodoo, D.; Theisen, M.; Kurtzhals, J.A.; Akanmori, B.D.; Koram, K.A.; Jepsen, S.; Nkrumah, F.K.; Theander, T.G.; Hviid, L. Naturally acquired antibodies to the glutamate-rich protein are associated with protection against Plasmodium falciparum malaria. J. Infect. Dis. 2000, 181, 1202–1205. [Google Scholar] [CrossRef] [PubMed]
  40. Adu, B.; Cherif, M.K.; Bosomprah, S.; Diarra, A.; Arthur, F.K.; Dickson, E.K.; Corradin, G.; Cavanagh, D.R.; Theisen, M.; Sirima, S.B.; et al. Antibody levels against GLURP R2, MSP1 block 2 hybrid and AS202.11 and the risk of malaria in children living in hyperendemic (Burkina Faso) and hypo-endemic (Ghana) areas. Malar. J. 2016, 15, 123. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  41. Kumar, D.; Dhiman, S.; Rabha, B.; Goswami, D.; Deka, M.; Singh, L.; Baruah, I.; Veer, V. Genetic polymorphism and amino acid sequence variation in Plasmodium falciparum GLURP R2 repeat region in Assam, India, at an interval of five years. Malar. J. 2014, 13, 450. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  42. Cattamanchi, A.; Kyabayinze, D.; Hubbard, A.; Rosenthal, P.J.; Dorsey, G. Distinguishing recrudescence from reinfection in a longitudinal antimalarial drug efficacy study: Comparison of results based on genotyping of msp-1, msp-2, and glurp. Am. J. Trop. Med. Hyg. 2003, 68, 133–139. [Google Scholar] [CrossRef] [PubMed]
  43. Messerli, C.; Hofmann, N.E.; Beck, H.P.; Felger, I. Critical Evaluation of Molecular Monitoring in Malaria Drug Efficacy Trials and Pitfalls of Length-Polymorphic Markers. Antimicrob. Agents Chemother. 2016, 61, e01500-16. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  44. Jones, S.; Kay, K.; Hodel, E.M.; Chy, S.; Mbituyumuremyi, A.; Uwimana, A.; Menard, D.; Felger, I.; Hastings, I. Improving Methods for Analyzing Antimalarial Drug Efficacy Trials: Molecular Correction Based on Length-Polymorphic Markers msp-1, msp-2, and glurp. Antimicrob. Agents Chemother. 2019, 63, e00590-19. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  45. Nkhoma, S.C.; Nair, S.; Al-Saai, S.; Ashley, E.; McGready, R.; Phyo, A.P.; Nosten, F.; Anderson, T.J. Population genetic correlates of declining transmission in a human pathogen. Mol. Ecol. 2013, 22, 273–285. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  46. Mohd Abd Razak, M.R.; Sastu, U.R.; Norahmad, N.A.; Abdul-Karim, A.; Muhammad, A.; Muniandy, P.K.; Jelip, J.; Rundi, C.; Imwong, M.; Mudin, R.N.; et al. Genetic Diversity of Plasmodium falciparum Populations in Malaria Declining Areas of Sabah, East Malaysia. PLoS ONE 2016, 11, e0152415. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  47. Anderson, T.J.; Haubold, B.; Williams, J.T.; Estrada-Franco, J.G.; Richardson, L.; Mollinedo, R.; Bockarie, M.; Mokili, J.; Mharakurwa, S.; French, N.; et al. Microsatellite markers reveal a spectrum of population structures in the malaria parasite Plasmodium falciparum. Mol. Biol. Evol. 2000, 17, 1467–1482. [Google Scholar] [CrossRef] [PubMed]
  48. Mita, T.; Jombart, T. Patterns and dynamics of genetic diversity in Plasmodium falciparum: What past human migrations tell us about malaria. Parasitol. Int. 2015, 64, 238–243. [Google Scholar] [CrossRef] [PubMed]
  49. Joshi, H.; Valecha, N.; Verma, A.; Kaul, A.; Mallick, P.K.; Shalini, S.; Prajapati, S.K.; Sharma, S.K.; Dev, V.; Biswas, S.; et al. Genetic structure of Plasmodium falciparum field isolates in eastern and north-eastern India. Malar. J. 2007, 6, 60. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  50. Patel, P.; Bharti, P.K.; Bansal, D.; Raman, R.K.; Mohapatra, P.K.; Sehgal, R.; Mahanta, J.; Sultan, A.A.; Singh, N. Genetic diversity and antibody responses against Plasmodium falciparum vaccine candidate genes from Chhattisgarh, Central India: Implication for vaccine development. PLoS ONE 2017, 12, e0182674. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  51. Atroosh, W.M.; Al-Mekhlafi, H.M.; Mahdy, M.A.; Saif-Ali, R.; Al-Mekhlafi, A.M.; Surin, J. Genetic diversity of Plasmodium falciparum isolates from Pahang, Malaysia based on MSP-1 and MSP-2 genes. Parasit. Vectors 2011, 4, 233. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  52. Metoh, T.N.; Chen, J.H.; Fon-Gah, P.; Zhou, X.; Moyou-Somo, R.; Zhou, X.N. Genetic diversity of Plasmodium falciparum and genetic profile in children affected by uncomplicated malaria in Cameroon. Malar. J. 2020, 19, 115. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  53. Anthony, T.G.; Conway, D.J.; Cox-Singh, J.; Matusop, A.; Ratnam, S.; Shamsul, S.; Singh, B. Fragmented population structure of Plasmodium falciparum in a region of declining endemicity. J. Infect. Dis. 2005, 191, 1558–1564. [Google Scholar] [CrossRef] [PubMed]
  54. Mobegi, V.A.; Loua, K.M.; Ahouidi, A.D.; Satoguina, J.; Nwakanma, D.C.; Amambua-Ngwa, A.; Conway, D.J. Population genetic structure of Plasmodium falciparum across a region of diverse endemicity in West Africa. Malar. J. 2012, 11, 223. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  55. Pumpaibool, T.; Arnathau, C.; Durand, P.; Kanchanakhan, N.; Siripoon, N.; Suegorn, A.; Sitthi-Amorn, C.; Renaud, F.; Harnyuttanakorn, P. Genetic diversity and population structure of Plasmodium falciparum in Thailand, a low transmission country. Malar. J. 2009, 8, 155. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  56. Iwagami, M.; Rivera, P.T.; Villacorte, E.A.; Escueta, A.D.; Hatabu, T.; Kawazu, S.; Hayakawa, T.; Tanabe, K.; Kano, S. Genetic diversity and population structure of Plasmodium falciparum in the Philippines. Malar. J. 2009, 8, 96. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  57. Khaireh, B.A.; Assefa, A.; Guessod, H.H.; Basco, L.K.; Khaireh, M.A.; Pascual, A.; Briolant, S.; Bouh, S.M.; Farah, I.H.; Ali, H.M.; et al. Population genetics analysis during the elimination process of Plasmodium falciparum in Djibouti. Malar. J. 2013, 12, 201. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  58. Chenet, S.M.; Taylor, J.E.; Blair, S.; Zuluaga, L.; Escalante, A.A. Longitudinal analysis of Plasmodium falciparum genetic variation in Turbo, Colombia: Implications for malaria control and elimination. Malar. J. 2015, 14, 363. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  59. Alam, M.T.; de Souza, D.K.; Vinayak, S.; Griffing, S.M.; Poe, A.C.; Duah, N.O.; Ghansah, A.; Asamoa, K.; Slutsker, L.; Wilson, M.D.; et al. Selective sweeps and genetic lineages of Plasmodium falciparum drug-resistant alleles in Ghana. J. Infect. Dis. 2011, 203, 220–227. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  60. Mueller, I.; Schoepflin, S.; Smith, T.A.; Benton, K.L.; Bretscher, M.T.; Lin, E.; Kiniboro, B.; Zimmerman, P.A.; Speed, T.P.; Siba, P.; et al. Force of infection is key to understanding the epidemiology of Plasmodium falciparum malaria in Papua New Guinean children. Proc. Natl. Acad. Sci. USA 2012, 109, 10030–10035. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  61. Felger, I.; Maire, M.; Bretscher, M.T.; Falk, N.; Tiaden, A.; Sama, W.; Beck, H.P.; Owusu-Agyei, S.; Smith, T.A. The dynamics of natural Plasmodium falciparum infections. PLoS ONE 2012, 7, e45542. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  62. Snounou, G.; Beck, H.P. The use of PCR genotyping in the assessment of recrudescence or reinfection after antimalarial drug treatment. Parasitol. Today 1998, 14, 462–467. [Google Scholar] [CrossRef] [PubMed]
  63. Snounou, G.; Zhu, X.; Siripoon, N.; Jarra, W.; Thaithong, S.; Brown, K.N.; Viriyakosol, S. Biased distribution of msp1 and msp2 allelic variants in Plasmodium falciparum populations in Thailand. Trans. R. Soc. Trop. Med. Hyg. 1999, 93, 369–374, Erratum in Trans. R. Soc. Trop. Med. Hyg. 2000, 94, 65. [Google Scholar] [CrossRef] [PubMed]
  64. Falk, N.; Maire, N.; Sama, W.; Owusu-Agyei, S.; Smith, T.; Beck, H.P.; Felger, I. Comparison of PCR-RFLP and Gene scan-based genotyping for analyzing infection dynamics of Plasmodium falciparum. Am. J. Trop. Med. Hyg. 2006, 74, 944–950. [Google Scholar] [CrossRef] [PubMed]
  65. Felger, I.; Beck, H.P. Genotyping of Plasmodium falciparum. PCR-RFLP analysis. Methods Mol. Med. 2002, 72, 117–129. [Google Scholar] [CrossRef] [PubMed]
  66. Gosi, P.; Lanteri, C.A.; Tyner, S.D.; Se, Y.; Lon, C.; Spring, M.; Char, M.; Sea, D.; Sriwichai, S.; Surasri, S.; et al. Evaluation of parasite subpopulations and genetic diversity of the msp1, msp2 and glurp genes during and following artesunate monotherapy treatment of Plasmodium falciparum malaria in Western Cambodia. Malar. J. 2013, 12, 403. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
Figure 1. Diagrammatic representation of msp-1 gene of P. falciparum.
Figure 1. Diagrammatic representation of msp-1 gene of P. falciparum.
Tropicalmed 09 00284 g001
Figure 2. Diagrammatic representation of msp-2 gene of P. falciparum.
Figure 2. Diagrammatic representation of msp-2 gene of P. falciparum.
Tropicalmed 09 00284 g002
Figure 3. Diagrammatic representation of glurp gene of P. falciparum.
Figure 3. Diagrammatic representation of glurp gene of P. falciparum.
Tropicalmed 09 00284 g003
Table 1. Three genetic markers most commonly used to characterize genetic diversity of P. falciparum.
Table 1. Three genetic markers most commonly used to characterize genetic diversity of P. falciparum.
GeneExpressionChromosomeMolecular MassVariable RegionAllelic Family
msp-1Merozoite9190–200 kDaBlock 2K1, MAD20, RO33
msp-2Merozoite230 kDaBlock 3FC27, 3D7
glurpSporozoite, gametocyte10145 kDaRII repeat region
Table 2. Family-specific primers [20] used to amplify msp-1, msp-2, and glurp genetic markers.
Table 2. Family-specific primers [20] used to amplify msp-1, msp-2, and glurp genetic markers.
Genetic MarkerPrimer NameSequence (5′ → 3′)
msp-1 primaryM1-OFCTAGAAGCTTTAGAAGATGCAGTATTG
M1-ORCTTAAATAGTATTCTAATTCAAGTGGATCA
MAD20M1-MFAAATGAAGGAACAAGTGGAACAGCTGTTAC
M1-MRATCTGAAGGATTTGTACGTCTTGAATTACC
K1M1-KFAAATGAAGAAGAAATTACTACAAAAGGTGC
M1-KRGCTTGCATCAGCTGGAGGGCTTGCACCAGA
RO33M1-RFTAAAGGATGGAGCAAATACTCAAGTTGTTG
M1-RRCATCTGAAGGATTTGCAGCACCTGGAGATC
msp-2 primaryM2-OFATGAAGGTAATTAAAACATTGTCTATTATA
M2-ORCTTTGTTACCATCGGTACATTCTT
3D7M2-ICFAGAAGTATGGCAGAAAGTAAK * CCTY ** CTACT
M2-ICRGATTGTAATTCGGGGGATTCAGTTTGTTCG
FC27M2-FCFAATACTAAGAGTGTAGGTGCAR *** ATGCTCCA
M2-FCRTTTTATTTGGTGCATTGCCAGAACTTGAAC
Glurp primaryG-OFTGAATTTGAAGATGTTCACACTGAAC
G-ORGTGGAATTGCTTTTTCTTCAACACTAA
RIIG-NFTGTTCACACTGAACAATTAGATTTAGATCA
G-ORGTGGAATTGCTTTTTCTTCAACACTAA
* K: G or T; ** Y: C or T; *** R: A or G.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Alruwaili, M.; Elderdery, A.Y.; Ejaz, H.; Farhana, A.; Atif, M.; Almutary, H.; Mills, J. Genotyping and Characterizing Plasmodium falciparum to Reveal Genetic Diversity and Multiplicity of Infection by Merozoite Surface Proteins 1 and 2 (msp-1 and msp-2) and Glutamate-Rich Protein (glurp) Genes. Trop. Med. Infect. Dis. 2024, 9, 284. https://doi.org/10.3390/tropicalmed9110284

AMA Style

Alruwaili M, Elderdery AY, Ejaz H, Farhana A, Atif M, Almutary H, Mills J. Genotyping and Characterizing Plasmodium falciparum to Reveal Genetic Diversity and Multiplicity of Infection by Merozoite Surface Proteins 1 and 2 (msp-1 and msp-2) and Glutamate-Rich Protein (glurp) Genes. Tropical Medicine and Infectious Disease. 2024; 9(11):284. https://doi.org/10.3390/tropicalmed9110284

Chicago/Turabian Style

Alruwaili, Muharib, Abozer Y. Elderdery, Hasan Ejaz, Aisha Farhana, Muhammad Atif, Hayfa Almutary, and Jeremy Mills. 2024. "Genotyping and Characterizing Plasmodium falciparum to Reveal Genetic Diversity and Multiplicity of Infection by Merozoite Surface Proteins 1 and 2 (msp-1 and msp-2) and Glutamate-Rich Protein (glurp) Genes" Tropical Medicine and Infectious Disease 9, no. 11: 284. https://doi.org/10.3390/tropicalmed9110284

APA Style

Alruwaili, M., Elderdery, A. Y., Ejaz, H., Farhana, A., Atif, M., Almutary, H., & Mills, J. (2024). Genotyping and Characterizing Plasmodium falciparum to Reveal Genetic Diversity and Multiplicity of Infection by Merozoite Surface Proteins 1 and 2 (msp-1 and msp-2) and Glutamate-Rich Protein (glurp) Genes. Tropical Medicine and Infectious Disease, 9(11), 284. https://doi.org/10.3390/tropicalmed9110284

Article Metrics

Back to TopTop