Genotyping and Characterizing Plasmodium falciparum to Reveal Genetic Diversity and Multiplicity of Infection by Merozoite Surface Proteins 1 and 2 (msp-1 and msp-2) and Glutamate-Rich Protein (glurp) Genes
Abstract
1. Introduction
2. The msp-1 Gene
3. The msp-2 Gene
4. The glurp Gene
5. Genetic Measurements Used to Characterize Genetic Diversity in P. falciparum
6. Interpretation and Technical Considerations
7. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Cowman, A.F.; Healer, J.; Marapana, D.; Marsh, K. Malaria: Biology and Disease. Cell 2016, 167, 610–624. [Google Scholar] [CrossRef] [PubMed]
- WHO. Malaria; World Health Organization: Geneva, Switzerland, 2022.
- Plowe, C.V. Malaria chemoprevention and drug resistance: A review of the literature and policy implications. Malar. J. 2022, 21, 104. [Google Scholar] [CrossRef] [PubMed]
- Shibeshi, M.A.; Kifle, Z.D.; Atnafie, S.A. Antimalarial Drug Resistance and Novel Targets for Antimalarial Drug Discovery. Infect. Drug Resist. 2020, 13, 4047–4060. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- WHO. Guidelines for Malaria; World Health Organization: Geneva, Switzerland, 2021. [PubMed]
- WHO. Methods for Surveillance of Antimalarial Drug Efficacy; World Health Organization: Geneva, Switzerland, 2009.
- East African Network for Monitoring Antimalarial Treatment (EANMAT). Monitoring antimalarial drug resistance within National Malaria Control Programmes: The EANMAT experience. Trop. Med. Int. Health 2001, 6, 891–898. [Google Scholar] [CrossRef] [PubMed]
- Antony, H.A.; Parija, S.C. Antimalarial drug resistance: An overview. Trop. Parasitol. 2016, 6, 30–41. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Cowman, A.F.; Morry, M.J.; Biggs, B.A.; Cross, G.A.; Foote, S.J. Amino acid changes linked to pyrimethamine resistance in the dihydrofolate reductase-thymidylate synthase gene of Plasmodium falciparum. Proc. Natl. Acad. Sci. USA 1988, 85, 9109–9113. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Triglia, T.; Cowman, A.F. The mechanism of resistance to sulfa drugs in Plasmodium falciparum. Drug Resist. Updates 1999, 2, 15–19. [Google Scholar] [CrossRef] [PubMed]
- Fidock, D.A.; Nomura, T.; Talley, A.K.; Cooper, R.A.; Dzekunov, S.M.; Ferdig, M.T.; Ursos, L.M.; Sidhu, A.B.; Naudé, B.; Deitsch, K.W.; et al. Mutations in the P. falciparum digestive vacuole transmembrane protein PfCRT and evidence for their role in chloroquine resistance. Mol. Cell. 2000, 6, 861–871. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Duraisingh, M.T.; Cowman, A.F. Contribution of the pfmdr1 gene to antimalarial drug-resistance. Acta Trop. 2005, 94, 181–190. [Google Scholar] [CrossRef] [PubMed]
- Viriyakosol, S.; Siripoon, N.; Zhu, X.P.; Jarra, W.; Seugorn, A.; Brown, K.N.; Snounou, G. Plasmodium falciparum: Selective growth of subpopulations from field samples following in vitro culture, as detected by the polymerase chain reaction. Exp. Parasitol. 1994, 79, 517–525. [Google Scholar] [CrossRef] [PubMed]
- Farnert, A.; Snounou, G.; Rooth, I.; Bjorkman, A. Daily dynamics of Plasmodium falciparum subpopulations in asymptomatic children in a holoendemic area. Am. J. Trop. Med. Hyg. 1997, 56, 538–547. [Google Scholar] [CrossRef] [PubMed]
- Orish, V.; Afutu, L.; Ayodele, O.; Likaj, L.; Marinkovic, A.; Sanyaolu, A. A 4-Day Incubation Period of Plasmodium falciparum Infection in a Nonimmune Patient in Ghana: A Case Report. Open Forum Infect. Dis. 2019, 6, ofy169. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- WHO. Methods for Surveillance of Antimalarial Drug Efficacy: Genotyping to Identify Parasite Populations: Informal Consultation Organized by the Medicines for Malaria Venture and Cosponsored by the World Health Organization; World Health Organization: Geneva, Switzerland, 2008.
- Conway, D.J.; Greenwood, B.M.; McBride, J.S. Longitudinal study of Plasmodium falciparum polymorphic antigens in a malaria-endemic population. Infect. Immun. 1992, 60, 1122–1127. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Engelbrecht, F.; Felger, I.; Genton, B.; Alpers, M.; Beck, H.P. Plasmodium falciparum: Malaria morbidity is associated with specific merozoite surface antigen 2 genotypes. Exp. Parasitol. 1995, 81, 90–96. [Google Scholar] [CrossRef] [PubMed]
- Ntoumi, F.; Contamin, H.; Rogier, C.; Bonnefoy, S.; Trape, J.F.; Mercereau-Puijalon, O. Age-dependent carriage of multiple Plasmodium falciparum merozoite surface antigen-2 alleles in asymptomatic malaria infections. Am. J. Trop. Med. Hyg. 1995, 52, 81–88. [Google Scholar] [CrossRef] [PubMed]
- Snounou, G. Genotyping of Plasmodium spp. Nested PCR. Methods Mol. Med. 2002, 72, 103–116. [Google Scholar] [CrossRef] [PubMed]
- Escalante, A.A.; Lal, A.A.; Ayala, F.J. Genetic polymorphism and natural selection in the malaria parasite Plasmodium falciparum. Genetics 1998, 149, 189–202. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Miller, L.H.; Roberts, T.; Shahabuddin, M.; McCutchan, T.F. Analysis of sequence diversity in the Plasmodium falciparum merozoite surface protein-1 (MSP-1). Mol. Biochem. Parasitol. 1993, 59, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Smythe, J.A.; Peterson, M.G.; Coppel, R.L.; Saul, A.J.; Kemp, D.J.; Anders, R.F. Structural diversity in the 45-kilodalton merozoite surface antigen of Plasmodium falciparum. Mol. Biochem. Parasitol. 1990, 39, 227–234. [Google Scholar] [CrossRef] [PubMed]
- Borre, M.B.; Dziegiel, M.; Høgh, B.; Petersen, E.; Rieneck, K.; Riley, E.; Meis, J.F.; Aikawa, M.; Nakamura, K.; Harada, M.; et al. Primary structure and localization of a conserved immunogenic Plasmodium falciparum glutamate rich protein (GLURP) expressed in both the pre-erythrocytic and erythrocytic stages of the vertebrate life cycle. Mol. Biochem. Parasitol. 1991, 49, 119–131. [Google Scholar] [CrossRef] [PubMed]
- Gupta, V.; Dorsey, G.; Hubbard, A.E.; Rosenthal, P.J.; Greenhouse, B. Gel versus capillary electrophoresis genotyping for categorizing treatment outcomes in two anti-malarial trials in Uganda. Malar. J. 2010, 9, 19. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Tanabe, K.; Mackay, M.; Goman, M.; Scaife, J.G. Allelic dimorphism in a surface antigen gene of the malaria parasite Plasmodium falciparum. J. Mol. Biol. 1987, 195, 273–287. [Google Scholar] [CrossRef] [PubMed]
- Takala, S.; Branch, O.; Escalante, A.A.; Kariuki, S.; Wootton, J.; Lal, A.A. Evidence for intragenic recombination in Plasmodium falciparum: Identification of a novel allele family in block 2 of merozoite surface protein 1: Asembo Bay Area Cohort Project XIV. Mol. Biochem. Parasitol. 2002, 125, 163–171. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Thomson-Luque, R.; Stabler, T.C.; Fürle, K.; Silva, J.C.; Daubenberger, C. Plasmodium falciparum merozoite surface protein 1 as asexual blood stage malaria vaccine candidate. Expert. Rev. Vaccines 2024, 23, 160–173. [Google Scholar] [CrossRef] [PubMed]
- O’Donnell, R.A.; Saul, A.; Cowman, A.F.; Crabb, B.S. Functional conservation of the malaria vaccine antigen MSP-119 across distantly related Plasmodium species. Nat. Med. 2000, 6, 91–95. [Google Scholar] [CrossRef] [PubMed]
- Boyle, M.J.; Richards, J.S.; Gilson, P.R.; Chai, W.; Beeson, J.G. Interactions with heparin-like molecules during erythrocyte invasion by Plasmodium falciparum merozoites. Blood 2010, 115, 4559–4568. [Google Scholar] [CrossRef] [PubMed]
- Combe, A.; Giovannini, D.; Carvalho, T.G.; Spath, S.; Boisson, B.; Loussert, C.; Thiberge, S.; Lacroix, C.; Gueirard, P.; Ménard, R. Clonal conditional mutagenesis in malaria parasites. Cell Host Microbe 2009, 5, 386–396. [Google Scholar] [CrossRef] [PubMed]
- Snewin, V.A.; Herrera, M.; Sanchez, G.; Scherf, A.; Langsley, G.; Herrera, S. Polymorphism of the alleles of the merozoite surface antigens MSA1 and MSA2 in Plasmodium falciparum wild isolates from Colombia. Mol. Biochem. Parasitol. 1991, 49, 265–275. [Google Scholar] [CrossRef] [PubMed]
- File, T.; Chekol, T.; Solomon, G.; Dinka, H.; Golassa, L. Detection of high frequency of MAD20 allelic variants of Plasmodium falciparum merozoite surface protein 1 gene from Adama and its surroundings, Oromia, Ethiopia. Malar. J. 2021, 20, 385. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Dijkman, P.M.; Marzluf, T.; Zhang, Y.; Chang, S.S.; Helm, D.; Lanzer, M.; Bujard, H.; Kudryashev, M. Structure of the merozoite surface protein 1 from Plasmodium falciparum. Sci. Adv. 2021, 7, eabg0465. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Balam, S.; Olugbile, S.; Servis, C.; Diakité, M.; D’Alessandro, A.; Frank, G.; Moret, R.; Nebie, I.; Tanner, M.; Felger, I.; et al. Plasmodium falciparum merozoite surface protein 2: Epitope mapping and fine specificity of human antibody response against non-polymorphic domains. Malar. J. 2014, 13, 510. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Metzger, W.G.; Okenu, D.M.; Cavanagh, D.R.; Robinson, J.V.; Bojang, K.A.; Weiss, H.A.; McBride, J.S.; Greenwood, B.M.; Conway, D.J. Serum IgG3 to the Plasmodium falciparum merozoite surface protein 2 is strongly associated with a reduced prospective risk of malaria. Parasite Immunol. 2003, 25, 307–312. [Google Scholar] [CrossRef] [PubMed]
- Høgh, B.; Thompson, R.; Zakiuddin, I.S.; Boudin, C.; Borre, M. Glutamate rich Plasmodium falciparum antigen (GLURP). Parasitologia 1993, 35, 47–50. [Google Scholar] [PubMed]
- Paul, G.; Deshmukh, A.; Kaur, I.; Rathore, S.; Dabral, S.; Panda, A.; Singh, S.K.; Mohmmed, A.; Theisen, M.; Malhotra, P. A novel Pfs38 protein complex on the surface of Plasmodium falciparum blood-stage merozoites. Malar. J. 2017, 16, 79. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Dodoo, D.; Theisen, M.; Kurtzhals, J.A.; Akanmori, B.D.; Koram, K.A.; Jepsen, S.; Nkrumah, F.K.; Theander, T.G.; Hviid, L. Naturally acquired antibodies to the glutamate-rich protein are associated with protection against Plasmodium falciparum malaria. J. Infect. Dis. 2000, 181, 1202–1205. [Google Scholar] [CrossRef] [PubMed]
- Adu, B.; Cherif, M.K.; Bosomprah, S.; Diarra, A.; Arthur, F.K.; Dickson, E.K.; Corradin, G.; Cavanagh, D.R.; Theisen, M.; Sirima, S.B.; et al. Antibody levels against GLURP R2, MSP1 block 2 hybrid and AS202.11 and the risk of malaria in children living in hyperendemic (Burkina Faso) and hypo-endemic (Ghana) areas. Malar. J. 2016, 15, 123. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Kumar, D.; Dhiman, S.; Rabha, B.; Goswami, D.; Deka, M.; Singh, L.; Baruah, I.; Veer, V. Genetic polymorphism and amino acid sequence variation in Plasmodium falciparum GLURP R2 repeat region in Assam, India, at an interval of five years. Malar. J. 2014, 13, 450. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Cattamanchi, A.; Kyabayinze, D.; Hubbard, A.; Rosenthal, P.J.; Dorsey, G. Distinguishing recrudescence from reinfection in a longitudinal antimalarial drug efficacy study: Comparison of results based on genotyping of msp-1, msp-2, and glurp. Am. J. Trop. Med. Hyg. 2003, 68, 133–139. [Google Scholar] [CrossRef] [PubMed]
- Messerli, C.; Hofmann, N.E.; Beck, H.P.; Felger, I. Critical Evaluation of Molecular Monitoring in Malaria Drug Efficacy Trials and Pitfalls of Length-Polymorphic Markers. Antimicrob. Agents Chemother. 2016, 61, e01500-16. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Jones, S.; Kay, K.; Hodel, E.M.; Chy, S.; Mbituyumuremyi, A.; Uwimana, A.; Menard, D.; Felger, I.; Hastings, I. Improving Methods for Analyzing Antimalarial Drug Efficacy Trials: Molecular Correction Based on Length-Polymorphic Markers msp-1, msp-2, and glurp. Antimicrob. Agents Chemother. 2019, 63, e00590-19. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Nkhoma, S.C.; Nair, S.; Al-Saai, S.; Ashley, E.; McGready, R.; Phyo, A.P.; Nosten, F.; Anderson, T.J. Population genetic correlates of declining transmission in a human pathogen. Mol. Ecol. 2013, 22, 273–285. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Mohd Abd Razak, M.R.; Sastu, U.R.; Norahmad, N.A.; Abdul-Karim, A.; Muhammad, A.; Muniandy, P.K.; Jelip, J.; Rundi, C.; Imwong, M.; Mudin, R.N.; et al. Genetic Diversity of Plasmodium falciparum Populations in Malaria Declining Areas of Sabah, East Malaysia. PLoS ONE 2016, 11, e0152415. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Anderson, T.J.; Haubold, B.; Williams, J.T.; Estrada-Franco, J.G.; Richardson, L.; Mollinedo, R.; Bockarie, M.; Mokili, J.; Mharakurwa, S.; French, N.; et al. Microsatellite markers reveal a spectrum of population structures in the malaria parasite Plasmodium falciparum. Mol. Biol. Evol. 2000, 17, 1467–1482. [Google Scholar] [CrossRef] [PubMed]
- Mita, T.; Jombart, T. Patterns and dynamics of genetic diversity in Plasmodium falciparum: What past human migrations tell us about malaria. Parasitol. Int. 2015, 64, 238–243. [Google Scholar] [CrossRef] [PubMed]
- Joshi, H.; Valecha, N.; Verma, A.; Kaul, A.; Mallick, P.K.; Shalini, S.; Prajapati, S.K.; Sharma, S.K.; Dev, V.; Biswas, S.; et al. Genetic structure of Plasmodium falciparum field isolates in eastern and north-eastern India. Malar. J. 2007, 6, 60. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Patel, P.; Bharti, P.K.; Bansal, D.; Raman, R.K.; Mohapatra, P.K.; Sehgal, R.; Mahanta, J.; Sultan, A.A.; Singh, N. Genetic diversity and antibody responses against Plasmodium falciparum vaccine candidate genes from Chhattisgarh, Central India: Implication for vaccine development. PLoS ONE 2017, 12, e0182674. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Atroosh, W.M.; Al-Mekhlafi, H.M.; Mahdy, M.A.; Saif-Ali, R.; Al-Mekhlafi, A.M.; Surin, J. Genetic diversity of Plasmodium falciparum isolates from Pahang, Malaysia based on MSP-1 and MSP-2 genes. Parasit. Vectors 2011, 4, 233. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Metoh, T.N.; Chen, J.H.; Fon-Gah, P.; Zhou, X.; Moyou-Somo, R.; Zhou, X.N. Genetic diversity of Plasmodium falciparum and genetic profile in children affected by uncomplicated malaria in Cameroon. Malar. J. 2020, 19, 115. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Anthony, T.G.; Conway, D.J.; Cox-Singh, J.; Matusop, A.; Ratnam, S.; Shamsul, S.; Singh, B. Fragmented population structure of Plasmodium falciparum in a region of declining endemicity. J. Infect. Dis. 2005, 191, 1558–1564. [Google Scholar] [CrossRef] [PubMed]
- Mobegi, V.A.; Loua, K.M.; Ahouidi, A.D.; Satoguina, J.; Nwakanma, D.C.; Amambua-Ngwa, A.; Conway, D.J. Population genetic structure of Plasmodium falciparum across a region of diverse endemicity in West Africa. Malar. J. 2012, 11, 223. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Pumpaibool, T.; Arnathau, C.; Durand, P.; Kanchanakhan, N.; Siripoon, N.; Suegorn, A.; Sitthi-Amorn, C.; Renaud, F.; Harnyuttanakorn, P. Genetic diversity and population structure of Plasmodium falciparum in Thailand, a low transmission country. Malar. J. 2009, 8, 155. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Iwagami, M.; Rivera, P.T.; Villacorte, E.A.; Escueta, A.D.; Hatabu, T.; Kawazu, S.; Hayakawa, T.; Tanabe, K.; Kano, S. Genetic diversity and population structure of Plasmodium falciparum in the Philippines. Malar. J. 2009, 8, 96. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Khaireh, B.A.; Assefa, A.; Guessod, H.H.; Basco, L.K.; Khaireh, M.A.; Pascual, A.; Briolant, S.; Bouh, S.M.; Farah, I.H.; Ali, H.M.; et al. Population genetics analysis during the elimination process of Plasmodium falciparum in Djibouti. Malar. J. 2013, 12, 201. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Chenet, S.M.; Taylor, J.E.; Blair, S.; Zuluaga, L.; Escalante, A.A. Longitudinal analysis of Plasmodium falciparum genetic variation in Turbo, Colombia: Implications for malaria control and elimination. Malar. J. 2015, 14, 363. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Alam, M.T.; de Souza, D.K.; Vinayak, S.; Griffing, S.M.; Poe, A.C.; Duah, N.O.; Ghansah, A.; Asamoa, K.; Slutsker, L.; Wilson, M.D.; et al. Selective sweeps and genetic lineages of Plasmodium falciparum drug-resistant alleles in Ghana. J. Infect. Dis. 2011, 203, 220–227. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Mueller, I.; Schoepflin, S.; Smith, T.A.; Benton, K.L.; Bretscher, M.T.; Lin, E.; Kiniboro, B.; Zimmerman, P.A.; Speed, T.P.; Siba, P.; et al. Force of infection is key to understanding the epidemiology of Plasmodium falciparum malaria in Papua New Guinean children. Proc. Natl. Acad. Sci. USA 2012, 109, 10030–10035. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Felger, I.; Maire, M.; Bretscher, M.T.; Falk, N.; Tiaden, A.; Sama, W.; Beck, H.P.; Owusu-Agyei, S.; Smith, T.A. The dynamics of natural Plasmodium falciparum infections. PLoS ONE 2012, 7, e45542. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Snounou, G.; Beck, H.P. The use of PCR genotyping in the assessment of recrudescence or reinfection after antimalarial drug treatment. Parasitol. Today 1998, 14, 462–467. [Google Scholar] [CrossRef] [PubMed]
- Snounou, G.; Zhu, X.; Siripoon, N.; Jarra, W.; Thaithong, S.; Brown, K.N.; Viriyakosol, S. Biased distribution of msp1 and msp2 allelic variants in Plasmodium falciparum populations in Thailand. Trans. R. Soc. Trop. Med. Hyg. 1999, 93, 369–374, Erratum in Trans. R. Soc. Trop. Med. Hyg. 2000, 94, 65. [Google Scholar] [CrossRef] [PubMed]
- Falk, N.; Maire, N.; Sama, W.; Owusu-Agyei, S.; Smith, T.; Beck, H.P.; Felger, I. Comparison of PCR-RFLP and Gene scan-based genotyping for analyzing infection dynamics of Plasmodium falciparum. Am. J. Trop. Med. Hyg. 2006, 74, 944–950. [Google Scholar] [CrossRef] [PubMed]
- Felger, I.; Beck, H.P. Genotyping of Plasmodium falciparum. PCR-RFLP analysis. Methods Mol. Med. 2002, 72, 117–129. [Google Scholar] [CrossRef] [PubMed]
- Gosi, P.; Lanteri, C.A.; Tyner, S.D.; Se, Y.; Lon, C.; Spring, M.; Char, M.; Sea, D.; Sriwichai, S.; Surasri, S.; et al. Evaluation of parasite subpopulations and genetic diversity of the msp1, msp2 and glurp genes during and following artesunate monotherapy treatment of Plasmodium falciparum malaria in Western Cambodia. Malar. J. 2013, 12, 403. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
Gene | Expression | Chromosome | Molecular Mass | Variable Region | Allelic Family |
---|---|---|---|---|---|
msp-1 | Merozoite | 9 | 190–200 kDa | Block 2 | K1, MAD20, RO33 |
msp-2 | Merozoite | 2 | 30 kDa | Block 3 | FC27, 3D7 |
glurp | Sporozoite, gametocyte | 10 | 145 kDa | RII repeat region |
Genetic Marker | Primer Name | Sequence (5′ → 3′) |
---|---|---|
msp-1 primary | M1-OF | CTAGAAGCTTTAGAAGATGCAGTATTG |
M1-OR | CTTAAATAGTATTCTAATTCAAGTGGATCA | |
MAD20 | M1-MF | AAATGAAGGAACAAGTGGAACAGCTGTTAC |
M1-MR | ATCTGAAGGATTTGTACGTCTTGAATTACC | |
K1 | M1-KF | AAATGAAGAAGAAATTACTACAAAAGGTGC |
M1-KR | GCTTGCATCAGCTGGAGGGCTTGCACCAGA | |
RO33 | M1-RF | TAAAGGATGGAGCAAATACTCAAGTTGTTG |
M1-RR | CATCTGAAGGATTTGCAGCACCTGGAGATC | |
msp-2 primary | M2-OF | ATGAAGGTAATTAAAACATTGTCTATTATA |
M2-OR | CTTTGTTACCATCGGTACATTCTT | |
3D7 | M2-ICF | AGAAGTATGGCAGAAAGTAAK * CCTY ** CTACT |
M2-ICR | GATTGTAATTCGGGGGATTCAGTTTGTTCG | |
FC27 | M2-FCF | AATACTAAGAGTGTAGGTGCAR *** ATGCTCCA |
M2-FCR | TTTTATTTGGTGCATTGCCAGAACTTGAAC | |
Glurp primary | G-OF | TGAATTTGAAGATGTTCACACTGAAC |
G-OR | GTGGAATTGCTTTTTCTTCAACACTAA | |
RII | G-NF | TGTTCACACTGAACAATTAGATTTAGATCA |
G-OR | GTGGAATTGCTTTTTCTTCAACACTAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Alruwaili, M.; Elderdery, A.Y.; Ejaz, H.; Farhana, A.; Atif, M.; Almutary, H.; Mills, J. Genotyping and Characterizing Plasmodium falciparum to Reveal Genetic Diversity and Multiplicity of Infection by Merozoite Surface Proteins 1 and 2 (msp-1 and msp-2) and Glutamate-Rich Protein (glurp) Genes. Trop. Med. Infect. Dis. 2024, 9, 284. https://doi.org/10.3390/tropicalmed9110284
Alruwaili M, Elderdery AY, Ejaz H, Farhana A, Atif M, Almutary H, Mills J. Genotyping and Characterizing Plasmodium falciparum to Reveal Genetic Diversity and Multiplicity of Infection by Merozoite Surface Proteins 1 and 2 (msp-1 and msp-2) and Glutamate-Rich Protein (glurp) Genes. Tropical Medicine and Infectious Disease. 2024; 9(11):284. https://doi.org/10.3390/tropicalmed9110284
Chicago/Turabian StyleAlruwaili, Muharib, Abozer Y. Elderdery, Hasan Ejaz, Aisha Farhana, Muhammad Atif, Hayfa Almutary, and Jeremy Mills. 2024. "Genotyping and Characterizing Plasmodium falciparum to Reveal Genetic Diversity and Multiplicity of Infection by Merozoite Surface Proteins 1 and 2 (msp-1 and msp-2) and Glutamate-Rich Protein (glurp) Genes" Tropical Medicine and Infectious Disease 9, no. 11: 284. https://doi.org/10.3390/tropicalmed9110284
APA StyleAlruwaili, M., Elderdery, A. Y., Ejaz, H., Farhana, A., Atif, M., Almutary, H., & Mills, J. (2024). Genotyping and Characterizing Plasmodium falciparum to Reveal Genetic Diversity and Multiplicity of Infection by Merozoite Surface Proteins 1 and 2 (msp-1 and msp-2) and Glutamate-Rich Protein (glurp) Genes. Tropical Medicine and Infectious Disease, 9(11), 284. https://doi.org/10.3390/tropicalmed9110284