Differences in Virulence Factors and Antimicrobial Susceptibility of Uropathogenic Enterococcus spp. Strains in a Rural Area of Uganda and a Spanish Secondary Hospital
Abstract
1. Introduction
1.1. Biofilm Production Mechanism
1.2. Antibiotic Resistance due to Biofilm Formation
2. Materials and Methods
2.1. Inclusion Criteria and Samples Collection
2.2. Antibiotic Resistance Study
2.3. Virulence Factors
2.3.1. Phenotypic Virulence Factors
2.3.2. Genotypic Virulence Factors
2.4. Biofilm Formation
2.5. Statistical Analysis
3. Results
3.1. Incidence by Specie in Uganda and Spain
3.2. Virulence Factors
3.3. Biofilm Formation
4. Discussion
4.1. Antibiotic Resistance
4.2. Virulence Factors
4.2.1. Phenotypic Virulence Factors
4.2.2. Genotypic Virulence Factors (Biofilm Formation-Related)
4.3. Country Differences in Biofilm Formation
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Iregbu, K.; Nwajiobi-Princewill, P. Urinary tract infections in a Tertiary Hospital in Abuja, Nigeria. Afr. J. Clin. Exp. Microbiol. 2013, 14, 169–173. [Google Scholar] [CrossRef] [Scilit]
- Tandogdu, Z.; Wagenlehner, F. Global epidemiology of urinary tract infections. Curr. Opin. Infect. Dis. 2016, 29, 73–79. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yogiraj Vaijanathrao, C.; Nalini, Y.L.; Reddy, C.M. Original Research Article Antibiotic Sensitivity Pattern of Uropathogens: A Comparative Study between Symptomatic and Asymptomaic Bacteriuria in Pregnant Women. Int. J. Curr. Microbiol. App. Sci. 2015, 4, 689. [Google Scholar]
- Sánchez-García, J.M.; Sorlózano-Puerto, A.; Navarro-Marí, J.M.; Gutiérrez Fernández, J. Evolución de la resistencia a antibióticos de microorganismos causantes de infecciones del tracto urinario: Un estudio de vigilancia epidemiológica de 4 años en población hospitalaria. Rev. Clínica Espanõla 2018, 219, 116–123. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kline, K.A.; Lewis, A.L. Gram-Positive Uropathogens, Polymicrobial Urinary Tract Infection, and the Emerging Microbiota of the Urinary Tract. Microbiol. Spectr. 2016, 4, 459–502. [Google Scholar] [CrossRef] [Scilit]
- Gágyor, I.; Bleidorn, J.; Kochen, M.M.; Schmiemann, G.; Wegscheider, K.; Hummers-Pradier, E. Ibuprofen versus fosfomycin for uncomplicated urinary tract infection in women: Randomised controlled trial. BMJ 2015, 351, h6544. [Google Scholar] [CrossRef] [Scilit]
- Soto, S.M. Importance of Biofilms in Urinary Tract Infections: New Therapeutic Approaches. Adv. Biol. 2014, 2014, 543974. [Google Scholar] [CrossRef] [Scilit]
- Park, A.J.; Murphy, K.; Krieger, J.R.; Brewer, D.; Taylor, P.; Habash, M.; Khursigara, C.M. A Temporal Examination of the Planktonic and Biofilm Proteome of Whole Cell Pseudomonas aeruginosa PAO1 Using Quantitative Mass Spectrometry. Mol. Cell. Proteom. 2014, 13, 1095–1105. [Google Scholar] [CrossRef] [Scilit]
- Mielich-Süss, B.; Lopez, D. Molecular mechanisms involved in Bacillus subtilis biofilm formation. Environ. Microbiol. 2015, 17, 555–565. [Google Scholar] [CrossRef] [Scilit]
- Hashem, Y.A.; Amin, H.M.; Essam, T.M.; Yassin, A.S.; Aziz, R.K. Biofilm formation in enterococci: Genotype-phenotype correlations and inhibition by vancomycin. Sci. Rep. 2017, 7, 5733. [Google Scholar] [CrossRef] [Scilit]
- Heikens, E.; Bonten, M.J.; Willems, R.J. Enterococcal surface protein Esp is important for biofilm formation of Enterococcus faecium E1162. J. Bacteriol. 2007, 189, 8233–8240. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ch’ng, J.H.; Chong, K.K.L.; Lam, L.N.; Wong, J.J.; Kline, K.A. Biofilm-associated infection by enterococci. Nat. Rev. Microbiol. 2019, 17, 82–94. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nallapareddy, S.R.; Singh, K.V.; Sillanpää, J.; Garsin, D.A.; Höök, M.; Erlandsen, S.L.; Murray, B.E. Endocarditis and biofilm-associated pili of Enterococcus faecalis. J. Clin. Investig. 2006, 116, 2799–2807. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bourgogne, A.; Thomson, L.C.; Murray, B.E. Bicarbonate enhances expression of the endocarditis and biofilm associated pilus locus, ebpR-ebpABC, in Enterococcus faecalis. BMC Microbiol. 2010, 10, 17. [Google Scholar] [CrossRef] [Scilit]
- Süssmuth, S.D.; Muscholl-Silberhorn, A.; Wirth, R.; Susa, M.; Marre, R.; Rozdzinski, E. Aggregation Substance Promotes Adherence, Phagocytosis, and Intracellular Survival of Enterococcus faecalis within Human Macrophages and Suppresses Respiratory Burst. Infect. Immun. 2000, 68, 4900–4906. [Google Scholar] [CrossRef] [Scilit]
- Toledo-Arana, A.; Valle, J.; Solano, C.; Arrizubieta, M.J.; Cucarella, C.; Lamata, M.; Amorena, B.; Leiva, J.; Penadés, J.R.; Lasa, I. The Enterococcal Surface Protein, Esp, Is Involved in Enterococcus faecalis Biofilm Formation. Appl. Environ. Microbiol. 2001, 67, 4538–4545. [Google Scholar] [CrossRef] [Scilit]
- Lebreton, F.; Riboulet-Bisson, E.; Serror, P.; Sanguinetti, M.; Posteraro, B.; Torelli, R.; Hartke, A.; Auffray, Y.; Giard, J.-C. Ace, Which Encodes an Adhesin in Enterococcus faecalis, Is Regulated by Ers and Is Involved in Virulence. Infect. Immun. 2009, 77, 2832–2838. [Google Scholar] [CrossRef] [Scilit]
- Singh, K.V.; Nallapareddy, S.R.; Sillanpää, J.; Murray, B.E. Importance of the Collagen Adhesin Ace in Pathogenesis and Protection against Enterococcus faecalis Experimental Endocarditis. PLoS Pathog. 2010, 6, e1000716. [Google Scholar] [CrossRef] [Scilit]
- Rozdzinski, E.; Marre, R.; Susa, M.; Wirth, R.; Muscholl-Silberhorn, A. Aggregation substance-mediated adherence of Enterococcus faecalis to immobilized extracellular matrix proteins. Microb. Pathog. 2001, 30, 211–220. [Google Scholar] [CrossRef] [Scilit]
- Thurlow, L.R.; Chittezham Thomas, V.; Narayanan, S.; Olson, S.; Fleming, S.D.; Hancock, L.E. Gelatinase Contributes to the Pathogenesis of Endocarditis Caused by Enterococcus faecalis. Infect. Immun. 2010, 78, 4936–4943. [Google Scholar] [CrossRef] [Scilit]
- Chittezham Thomas, V.; Thurlow, L.R.; Boyle, D.; Hancock, L.E. Regulation of Autolysis-Dependent Extracellular DNA Release by Enterococcus faecalis Extracellular Proteases Influences Biofilm Development. J. Bacteriol. 2008, 190, 5690–5698. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hoban, D.J.; Lascols, C.; Nicolle, L.E.; Badal, R.; Bouchillon, S.; Hackel, M.; Hawser, S. Antimicrobial susceptibility of Enterobacteriaceae, including molecular characterization of extended-spectrum beta-lactamase–producing species, in urinary tract isolates from hospitalized patients in North America and Europe: Results from the SMART study 2009–2010. Diagn. Microbiol. Infect. Dis. 2012, 74, 62–67. [Google Scholar] [PubMed]
- Pierre, R.; Neri, S.; Contreras, M.; Vázquez, R.; Ramírez, L.C.; Riveros, J.P.; Rondón, L.; Casasnovas, A.B.; Rodríguez-Herrera, A.; Navalón, M.; et al. Guía de práctica clínica Ibero-Latinoamericana sobre la esofagitis cáustica en Pediatría: Aspectos terapéuticos (2ª. Parte). Rev. Chil. Pediatría 2020, 91, 289–299. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stępień-Pyśniak, D.; Hauschild, T.; Kosikowska, U.; Dec, M.; Urban-Chmiel, R. Biofilm formation capacity and presence of virulence factors among commensal Enterococcus spp. from wild birds. Sci. Rep. 2019, 9, 11204–11207. [Google Scholar] [CrossRef] [Scilit]
- Mannu, L.; Paba, A.; Daga, E.; Comunian, R.; Zanetti, S.; Duprè, I.; Sechi, L. Comparison of the incidence of virulence determinants and antibiotic resistance between Enterococcus faecium strains of dairy, animal and clinical origin. Int. J. Food Microbiol. 2003, 88, 291–304. [Google Scholar] [CrossRef] [Scilit]
- Eaton, T.J.; Gasson, M.J. Molecular Screening of Enterococcus Virulence Determinants and Potential for Genetic Exchange between Food and Medical Isolates. Appl. Environ. Microbiol. 2001, 67, 1628–1635. [Google Scholar] [CrossRef] [Scilit]
- Shankar, V.; Baghdayan, A.S.; Huycke, M.M.; Lindahl, G.; Gilmore, M.S. Infection-Derived Enterococcus faecalis Strains Are Enriched in esp, a Gene Encoding a Novel Surface Protein. Infect. Immun. 1999, 67, 193–200. [Google Scholar] [CrossRef] [Scilit]
- Stepanović, S.; Vuković, D.; Hola, V.; Bonaventura, G.D.; Djukić, S.; Ćirković, I.; Ruzicka, F. Quantification of biofilm in microtiter plates: Overview of testing conditions and practical recommendations for assessment of biofilm production by Staphylococci. Accid. Anal. Prev. 2007, 115, 891–899. [Google Scholar] [CrossRef] [Scilit]
- Shridhar, S.; Dhanashree, B. Antibiotic Susceptibility Pattern and Biofilm Formation in Clinical Isolates of Enterococcus spp. Interdiscip. Perspect. Infect. Dis. 2019, 2019, 7854968. [Google Scholar] [CrossRef] [Scilit]
- Di Rosa, R.; Creti, R.; Venditti, M.; D’Amelio, R.; Arciola, C.R.; Montanaro, L.; Baldassarri, L. Relationship between biofilm formation, the enterococcal surface protein (Esp) and gelatinase in clinical isolates of Enterococcus faecalis and Enterococcus faecium. FEMS Microbiol. Lett. 2006, 256, 145–150. [Google Scholar] [CrossRef] [Scilit]
- Almohamad, S.; Somarajan, S.R.; Singh, K.V.; Nallapareddy, S.R.; Murray, B.E. Influence of isolate origin and presence of various genes on biofilm formation by Enterococcus faecium. FEMS Microbiol. Lett. 2014, 353, 151–156. [Google Scholar] [CrossRef] [Scilit]
- Saffari, F.; Dalfardi, M.S.; Mansouri, S.; Ahmadrajabi, R. Survey for Correlation between Biofilm Formation and Virulence Determinants in a Collection of Pathogenic and Fecal Enterococcus faecalis Isolates. Infect. Chemother. 2017, 49, 176–183. [Google Scholar] [CrossRef] [Scilit]
- Torres, C.; Cercenado, E. Lectura interpretada del antibiograma de cocos gram positivos [Interpretive reading of the antibiogram in gram positive cocci]. Enferm. Infecc. Microbiol. Clin. 2010, 28, 541–553. [Google Scholar] [CrossRef] [Scilit]
- Odongo, C.O.; Anywar, D.A.; Luryamamoi, K.; Odongo, P. Antibiograms from community-acquired uropathogens in Gulu, northern Uganda-a cross-sectional study. BMC Infect. Dis. 2013, 13, 193. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kafil, H.S.; Asgharzadeh, M. Vancomycin-Resistant Enteroccus faecium and Enterococcus faecalis Isolated from Education Hospital of Iran. Maedica 2014, 9, 323–327. [Google Scholar]
- Badhan, R.; Singh, D.; Badhan, L.; Kaur, A. Evaluation of bacteriological profile and antibiotic sensitivity patterns in children with urinary tract infection: A prospective study from a tertiary care center. Indian J. Urol. IJU J. Urol. Soc. India 2016, 32, 50–56. [Google Scholar]
- Zwane, T.; Shuping, L.; Perovic, O. Etiology and Antimicrobial Susceptibility of Pathogens Associated with Urinary Tract Infections among Women Attending Antenatal Care in Four South African Tertiary-Level Facilities, 2015–2019. Antibiotics 2021, 10, 669. [Google Scholar] [CrossRef] [Scilit]
- Palanca Giménez, M.; Gutiérrez Fernández, J.; Sorlózano Puerto, A.; Piédrola Angulo, G. Linezolide e infección del tracto urinario. Rev. Clínica Espanõla 2004, 204, 120–121. [Google Scholar] [CrossRef] [Scilit]
- Onda, H.; Wagenlehner, F.M.E.; Lehn, N.; Naber, K.G. In vitro activity of linezolid against Gram-positive uropathogens of hospitalized patients with complicated urinary tract infections. Int. J. Antimicrob. Agents 2001, 18, 263. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Silva, J.; Rodríguez, Y.; Araya, J.; Gahona, J.; Valenzuela, N.; Guerrero, K.; Baez, J.; Baquero, F.; Del Campo, R. Detección de genes de virulencia en cepas de Enterococcus faecalis susceptibles y resistentes a aminoglucósidos. Rev. Chil. Pediatría 2013, 30, 17–22. [Google Scholar] [CrossRef] [Scilit]
- Correa, F.E.L.; Zanella, R.C.; Cassiolato, A.P.; Paiva, A.D.; Okura, M.H.; Conceição, N.; Oliveira, A.G. Penicillin-resistant, ampicillin-susceptible Enterococcus faecalis isolates are uncommon in non-clinical sources. Environ. Microbiol. Rep. 2022, 14, 230–238. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bernardi, S.; Anderson, A.; Macchiarelli, G.; Hellwig, E.; Cieplik, F.; Vach, K.; Al-Ahmad, A. Subinhibitory Antibiotic Concentrations Enhance Biofilm Formation of Clinical Enterococcus faecalis Isolates. Antibiotics 2021, 10, 874. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kafil, H.S.; Mobarez, A.M.; Moghadam, M.F.; Hashemi Zs Yousefi, M. Gentamicin induces efaA expression and biofilm formation in Enterococcus faecalis. Microb. Pathog. 2016, 92, 30–35. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cercenado, E. Enterococcus: Resistencias fenotípicas y genotípicas y epidemiología en España. Enferm. Infecc. Y Microbiol. Clínica 2011, 29 (Suppl. 5), 59–65. [Google Scholar] [CrossRef] [Scilit]
- Ran, S.; Jiang, W.; Zhu, C.; Liang, J. Exploration of the mechanisms of biofilm formation by Enterococcus faecalis in glucose starvation environments. Aust. Dent. J. 2015, 60, 143–153. [Google Scholar] [CrossRef] [Scilit]
- Zheng, J.-X.; Bai, B.; Lin, Z.-W.; Pu, Z.-Y.; Yao, W.-M.; Chen, Z.; Li, D.-Y.; Deng, X.-B.; Deng, Q.-W.; Yu, Z.-J. Characterization of biofilm formation by Enterococcus faecalis isolates derived from urinary tract infections in China. J. Med. Microbiol. 2018, 67, 60–67. [Google Scholar] [CrossRef] [Scilit]
- Zheng, J.-X.; Wu, Y.; Lin, Z.-W.; Pu, Z.-Y.; Yao, W.-M.; Chen, Z.; Li, D.-Y.; Deng, Q.-W.; Qu, D.; Yu, Z.-J. Characteristics of and Virulence Factors Associated with Biofilm Formation in Clinical Enterococcus faecalis Isolates in China. Front. Microbiol. 2017, 8, 2338. [Google Scholar] [CrossRef] [Scilit]
- Wang, L.; Dong, M.; Zheng, J.; Song, Q.; Yin, W.; Li, J.; Niu, W. Relationship of Biofilm Formation and gelE Gene Expression in Enterococcus faecalis Recovered from Root Canals in Patients Requiring Endodontic Retreatment. J. Endod. 2011, 37, 631–636. [Google Scholar] [CrossRef] [Scilit]
- Lu, Z.; Meng, L.; Liu, Z.; Ren, G.; Sun, A.; Liu, X. Expression of quorum-sensing related genes during Enterococcus faecalis biofilm formation. Zhonghua Kou Qiang Yi Xue Za Zhi 2013, 48, 485–489. [Google Scholar]
- Qin, X.; Singh, K.V.; Weinstock, G.M.; Murray, B.E. Characterization of fsr, a Regulator Controlling Expression of Gelatinase and Serine Protease in Enterococcus faecalis OG1RF. J. Bacteriol. 2001, 183, 3372–3382. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Ping, Y.; Xiong, Y.; Zhou, R.; Xu, F.; Wang, J.; Li, J. Genotype, biofilm formation ability and specific gene transcripts characteristics of endodontic Enterococcus faecalis under glucose deprivation condition. Arch. Oral Biol. 2020, 118, 104877. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sharifi, Y.; Hasani, A.; Ghotaslou, R.; Naghili, B.; Aghazadeh, M.; Milani, M.; Bazmany, A. Virulence and antimicrobial resistance in enterococci isolated from urinary tract infections. Adv. Pharm. Bull. 2013, 3, 197–201. [Google Scholar] [PubMed]
- Arciola, C.R.; Baldassarri, L.; Campoccia, D.; Creti, R.; Pirini, V.; Huebner, J.; Montanaro, L. Strong biofilm production, antibiotic multi-resistance and high gelE expression in epidemic clones of Enterococcus faecalis from orthopaedic implant infections. Biomaterials 2007, 29, 580–586. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Soares, R.O.; Fedi, A.C.; Reiter, K.C.; Caierão, J.; d’Azevedo, P.A. Correlation between biofilm formation and gelE, esp, and agg genes in Enterococcus spp. clinical isolates. Virulence 2014, 5, 634–637. [Google Scholar] [CrossRef] [Scilit]
- Ben Slama, K.; Saenz, Y.; Klibi, N.; Masmoudi, A.; Zanetti, S.; Sechi, L.A.; Boudabous, A.; Torres, C. Detection of virulence factors in high-level gentamicin-resistant Enterococcus faecalis and Enterococcus faecium isolates from a Tunisian hospital. Can. J. Microbiol. 2007, 53, 372–379. [Google Scholar]
- Abriouel, H.; Ben Omar, N.; Molinos, A.C.; López, R.L.; Grande, M.J.; Martínez-Viedma, P.; Ortega, E.; Cañamero, M.M.; Galvez, A. Comparative analysis of genetic diversity and incidence of virulence factors and antibiotic resistance among enterococcal populations from raw fruit and vegetable foods, water and soil, and clinical samples. Int. J. Food Microbiol. 2008, 123, 38–49. [Google Scholar] [CrossRef] [Scilit]
- Iweriebor, B.; Gaqavu, S.; Obi, L.C.; Nwodo, U.U.; Okoh, A.I. Antibiotic Susceptibilities of Enterococcus Species Isolated from Hospital and Domestic Wastewater Effluents in Alice, Eastern Cape Province of South Africa. Int. J. Environ. Res. Public Health 2015, 12, 4231. [Google Scholar] [CrossRef] [Scilit]
- Sedgley, C.M.; Molander, A.; Flannagan, S.E.; Nagel, A.C.; Appelbe, O.K.; Clewell, D.B.; Dahlén, G. Virulence, phenotype and genotype characteristics of endodontic Enterococcus spp. Oral Microbiol. Immunol. 2005, 20, 10–19. [Google Scholar] [CrossRef] [Scilit]
- Jin, Y.; Guo, Y.; Zhan, Q.; Shang, Y.; Qu, D.; Yu, F. Subinhibitory Concentrations of Mupirocin Stimulate Staphylococcus aureus Biofilm Formation by Upregulating cidA. Antimicrob. Agents Chemother. 2020, 64, e01912-19. [Google Scholar] [CrossRef] [Scilit]
- Mlynek, K.D.; Callahan, M.T.; Shimkevitch, A.V.; Farmer, J.T.; Endres, J.L.; Marchand, M.; Bayles, K.W.; Horswill, A.R.; Kaplan, J.B. Effects of low-dose amoxicillin on Staphylococcus aureus USA300 Biofilms. Antimicrob. Agents Chemother. 2016, 60, 2639–2651. [Google Scholar] [CrossRef] [Scilit]


| Virulence Genes | Nucleotide Sequence (5′-3′) | Size (pb) | Reference |
|---|---|---|---|
| ace1 | AAAGTAGAATTAGATCCACAC | 320 | L. Mannu et al. [25] |
| TCTATCACATTCGGTTGCG | |||
| agg | AAGAAAAAGAAGTAGACCAAC | 1553 | Eaton et al. [26] |
| AAACGGCAAGACAAGTAAATA | |||
| cpd | TGGTGGGTTATTTTTCAATTC | Mannu et al. [25] | |
| TACGGCTCTGGCTTACTA | |||
| efaA | GACAGACCCTCACGAATA | 705 | Eaton et al. [26] |
| AGTTCATGCTGTAGTA | |||
| gelE | ACGCATTGCTTTTCCATC | 419 | Eaton et al. [26] |
| ACCCCGTATCATTGGTT | |||
| esp | TTACCAAGATGGTTCTGTAGGCAC | 913 | Shankar et al. [27] |
| CCAAGTATACTTAGCATCTTTTGG |
| Antibiotic | Species | Uganda (E. faecalis n = 18, E. faecium n = 32) | Spain (E. faecalis n = 51, E. faecium n = 4) |
|---|---|---|---|
| Ampicilin | E. faecalis | 0% (0) | 0% (0) |
| E. faecium | 31.2% (10) | 100% (4) | |
| Ciprofloxacin | E. faecalis | 22.2% (4) | 19.6% (10) |
| E. faecium | 28.1% (9) | 75% (3) | |
| Imipenem | E. faecalis | 0% (0) | 0% (0) |
| E. faecium | 31.2% (10) | 100% (4) | |
| Gentamycin | E. faecalis | 27.8% (5) | 27.4% (14) |
| E. faecium | 6.2% (2) | 25% (3) | |
| Vancomycin | E. faecalis | 5.6% (1) | 7.7% (3) |
| E. faecium | 0% (0) | 50% (2) | |
| Quinupristin/Dalfopristin | E. faecalis | 100% (18) | 100% (51) |
| E. faecium | 21.9% (7) | 50% (2) | |
| Linezolid | E. faecalis | 5.6% (1) | 0% (0) |
| E. faecium | 0% (0) | 50% (2) | |
| Nitrofurantoina | E. faecalis | 0% (0) | 3.8% (2) |
| E. faecium | 25% (8) | 100% (4) |
| Virulence Mechanism | Uganda (n = 50) | Spain (n = 55) | ||||
|---|---|---|---|---|---|---|
| Biofilm Formation. Median (IQR) (n) | p-Value | Biofilm Formation. Median (IQR) (n) | p-Value | |||
| Phenotypics | α-Hemolysis | + | 2.36 (1.85–3.2) (25) | 0.015 | 6.39 (1,64–28,76) (11) | 0.817 |
| − | 3.55 (2.60–4.51) (25) | 5.58 (2.99–13.32) (43) | ||||
| β Hemolysis | + | 3 (1) | - | (0) | - | |
| − | 2.95 (2.02–4.39) (49) | 5.67 (2.84–14.24) (54) | ||||
| Gelatinase | + | 3.1 (2.33–3.91) (13) | 0.182 | 3.98 (2.14–5.42) (12) | 0.042 | |
| − | 2.83 (2.01–4.37) (37) | 6.79 (3.54–23.04) (42) | ||||
| hydrophobicity | + | 2.66 (2.06–3.75) (39) | 0.496 | 5.99 (3.12–14.42) (49) | 0.029 | |
| − | 3.69 (2.13–4.54) (11) | 1.64 (1.16–4.25) (5) | ||||
| Genotypics | esp | + | 1.18 (1) | 0.080 | 10.96 (5.01–29.41) (23) | 0.046 |
| − | 2.97 (2.15–4.40) (49) | 5.06 (2.53–9.57) (31) | ||||
| cpd | + | 2.97 (2.41–4.32) (20) | 0.276 | 5.99 (3.55–16.46) (51) | ≤0.001 | |
| − | 2.71 (1.89–4.23) (30) | 1.22 (1.08–1.50) (3) | ||||
| efaA | + | 3.63 (2.47–4.6) (30) | 0.004 | 5.38 (2.64–11.16) (40) | 0.317 | |
| − | 2.29 (1.80–3.10) (20) | 6.39 (4.01–31.51) (14) | ||||
| Ace1 | + | 3.24 (2.31–4.54) (38) | 0.030 | 5.56 (2.99–14.15) (36) | 0.958 | |
| − | 2.22 (1.68–2.44) (12) | 5.67 (2.51–18.69) (18) | ||||
| agg | + | 2.98 (2.31–4.54) (29) | 0.300 | 5.21 (2.72–12.1) (36) | 0.272 | |
| − | 2.50 (1.95–3.81) (21) | 6.79 (4.02–31.52) (18) | ||||
| gelE | + | 3.71 (2.43–4.44) (21) | 0.079 | 5.26 (5.02–9.99) (13) | 0.593 | |
| − | 2.44 (1.94–3.10) (29) | 6.03 (2.68–26.77) (41) | ||||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Carrasco Calzada, F.; Jairo Aguilera, J.; Moreno, J.E.; Cuadros González, J.; Roca Biosca, D.; Prieto-Pérez, L.; Pérez-Tanoira, R. Differences in Virulence Factors and Antimicrobial Susceptibility of Uropathogenic Enterococcus spp. Strains in a Rural Area of Uganda and a Spanish Secondary Hospital. Trop. Med. Infect. Dis. 2023, 8, 282. https://doi.org/10.3390/tropicalmed8050282
Carrasco Calzada F, Jairo Aguilera J, Moreno JE, Cuadros González J, Roca Biosca D, Prieto-Pérez L, Pérez-Tanoira R. Differences in Virulence Factors and Antimicrobial Susceptibility of Uropathogenic Enterococcus spp. Strains in a Rural Area of Uganda and a Spanish Secondary Hospital. Tropical Medicine and Infectious Disease. 2023; 8(5):282. https://doi.org/10.3390/tropicalmed8050282
Chicago/Turabian StyleCarrasco Calzada, Félix, John Jairo Aguilera, Jaime Esteban Moreno, Juan Cuadros González, David Roca Biosca, Laura Prieto-Pérez, and Ramón Pérez-Tanoira. 2023. "Differences in Virulence Factors and Antimicrobial Susceptibility of Uropathogenic Enterococcus spp. Strains in a Rural Area of Uganda and a Spanish Secondary Hospital" Tropical Medicine and Infectious Disease 8, no. 5: 282. https://doi.org/10.3390/tropicalmed8050282
APA StyleCarrasco Calzada, F., Jairo Aguilera, J., Moreno, J. E., Cuadros González, J., Roca Biosca, D., Prieto-Pérez, L., & Pérez-Tanoira, R. (2023). Differences in Virulence Factors and Antimicrobial Susceptibility of Uropathogenic Enterococcus spp. Strains in a Rural Area of Uganda and a Spanish Secondary Hospital. Tropical Medicine and Infectious Disease, 8(5), 282. https://doi.org/10.3390/tropicalmed8050282

