Field Evaluation of a Loop-Mediated Isothermal Amplification (LAMP) Platform for the Detection of Schistosoma japonicum Infection in Oncomelania hupensis Snails
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethical Statement
2.2. Snail Sampling Procedure
2.3. Microscopy Testing and DNA Extraction
2.4. PCR Assay
2.5. DNA Sequencing
2.6. LAMP Assay
- The 2× reaction mixture: pH 8.8 Tris buffer (40 mM), KCl (20 M), MgSO4 (16 mM), (NH4)2SO4 (20 mM), Tween 20 (0.2%), betaine (1.6 M), dNTPs (2.8 mM each).
- Calcein working solution (2 × composition): Calcein (50 μM), MnCl2 (1 mM).
- Sj28S gene primers [17], (5′-3′, Sangon; HPLC purification): F3 (GCTTTGTCCTTCGGGCATTA), B3 (GGTTTCGTAACGCCCAATGA), FIP (ACGCAACTGCCAACGTGACATACTGGTCGGCTTGTTACTAGC), BIP (TGGTAGACGATCCACCTGACCCCTCGCGCACATGTTAAACTC)
2.6.1. Testing Samples with Life Cycle Stages of S. japonicum
2.6.2. Pooled Snail Samples
2.7. Validation
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- McManus, D.P.; Dunne, D.W.; Sacko, M.; Utzinger, J.; Vennervald, B.J.; Zhou, X.N. Schistosomiasis. Nat. Rev. Dis. Primers 2018, 4, 13. [Google Scholar] [CrossRef]
- Assaré, R.K.; Tra, M.B.I.; Ouattara, M.; Hürlimann, E.; Coulibaly, J.T.; N’Goran, E.K.; Utzinger, J. Sensitivity of the point-of-care circulating cathodic antigen urine cassette test for diagnosis of Schistosoma mansoni in low-endemicity settings in Côte d’Ivoire. Am. J. Trop. Med. Hyg. 2018. [Google Scholar] [CrossRef]
- Hadidjaja, P. Clinical study of Indonesian schistosomiasis at Lindu lake area, Central Sulawesi. Southeast Asian J. Trop. Med. Public Health 1984, 15, 507–514. [Google Scholar] [PubMed]
- Zhu, G.; Fan, J.; Peterson, A.T. Schistosoma japonicum transmission risk maps at present and under climate change in mainland China. PLoS Negl. Trop. Dis. 2017, 11, e0006021. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.D.; Chen, H.G.; Guo, J.G.; Zeng, X.J.; Hong, X.L.; Xiong, J.J.; Wu, X.H.; Wang, X.H.; Wang, L.Y.; Xia, G.; et al. A strategy to control transmission of Schistosoma japonicum in China. N. Engl. J. Med. 2009, 360, 121–128. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.D.; Guo, J.G.; Wu, X.H.; Chen, H.G.; Wang, T.P.; Zhu, S.P.; Zhang, Z.H.; Steinmann, P.; Yang, G.J.; Wang, S.P.; et al. China’s new strategy to block Schistosoma japonicum transmission: Experiences and impact beyond schistosomiasis. Trop. Med. Int. Health 2009, 14, 1475–1483. [Google Scholar] [CrossRef] [PubMed]
- Sun, L.P.; Wang, W.; Hong, Q.B.; Li, S.Z.; Liang, Y.S.; Yang, H.T.; Zhou, X.N. Approaches being used in the national schistosomiasis elimination programme in China: A review. Infect. Dis. Poverty 2017, 6, 55. [Google Scholar] [CrossRef]
- Spear, R.C.; Seto, E.Y.; Carlton, E.J.; Liang, S.; Remais, J.V.; Zhong, B.; Qiu, D. The challenge of effective surveillance in moving from low transmission to elimination of schistosomiasis in China. Int. J. Parasitol. 2011, 41, 1243–1247. [Google Scholar] [CrossRef]
- Yang, K.; Sun, L.P.; Liang, Y.S.; Wu, F.; Li, W.; Zhang, J.F.; Huang, Y.X.; Hang, D.R.; Liang, S.; Bergquist, R.; et al. Schistosoma japonicum risk in Jiangsu province, People’s Republic of China: Identification of a spatio-temporal risk pattern along the Yangtze River. Geospat. Health 2013, 8, 133–142. [Google Scholar] [CrossRef]
- Erlich, H.A. Polymerase chain reaction. J. Clin. Immunol. 1989, 9, 437–447. [Google Scholar] [CrossRef]
- Notomi, T.; Okayama, H.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000, 28, E63. [Google Scholar] [CrossRef] [PubMed]
- Hamburger, J.; He-Na; Xin, X.Y.; Ramzy, R.M.; Jourdane, J.; Ruppel, A. A polymerase chain reaction assay for detecting snails infected with bilharzia parasites (Schistosoma mansoni) from very early prepatency. Am. J. Trop. Med. Hyg. 1998, 59, 872–876. [Google Scholar] [CrossRef] [PubMed]
- Abbasi, I.; King, C.H.; Muchiri, E.M.; Hamburger, J. Detection of Schistosoma mansoni and Schistosoma haematobium DNA by loop-mediated isothermal amplification: Identification of infected snails from early prepatency. Am. J. Trop. Med. Hyg. 2010, 83, 427–432. [Google Scholar] [CrossRef] [PubMed]
- Notomi, T.; Mori, Y.; Tomita, N.; Kanda, H. Loop-mediated isothermal amplification (LAMP): Principle, features, and future prospects. J. Microbiol. 2015, 53, 1–5. [Google Scholar] [CrossRef] [PubMed]
- Hamburger, J.; Abbasi, I.; Kariuki, C.; Wanjala, A.; Mzungu, E.; Mungai, P.; Muchiri, E.; King, C.H. Evaluation of loop-mediated isothermal amplification suitable for molecular monitoring of schistosome-infected snails in field laboratories. Am. J. Trop. Med. Hyg. 2013, 88, 344–351. [Google Scholar] [CrossRef]
- Gandasegui, J.; Fernández-Soto, P.; Muro, A.; Simões Barbosa, C.; Lopes de Melo, F.; Loyo, R.; de Souza Gomes, E.C. A field survey using LAMP assay for detection of Schistosoma mansoni in a low-transmission area of schistosomiasis in Umbuzeiro, Brazil: Assessment in human and snail samples. PLoS Negl. Trop. Dis. 2018, 12, e0006314. [Google Scholar] [CrossRef] [PubMed]
- Kumagai, T.; Furushima-Shimogawara, R.; Ohmae, H.; Wang, T.P.; Lu, S.; Chen, R.; Wen, L.; Ohta, N. Detection of early and single infections of Schistosoma japonicum in the intermediate host snail, Oncomelania hupensis, by PCR and loop-mediated isothermal amplification (LAMP) assay. Am. J. Trop. Med. Hyg. 2010, 83, 542–548. [Google Scholar] [CrossRef]
- Tomita, N.; Mori, Y.; Kanda, H.; Notomi, T. Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nat. Protoc. 2008, 3, 877–882. [Google Scholar] [CrossRef]
- Lei, Z.L.; Zhang, L.J.; Xu, Z.M.; Dang, H.; Xu, J.; Lv, S.; Cao, C.L.; Li, S.Z.; Zhou, X.N. Endemic status of schistosomiasis in People’s Republic of China in 2014. Zhongguo Xue Xi Chong Bing Fang Zhi Za Zhi 2015, 27, 563–569. (In Chinese) [Google Scholar]
- Tong, Q.B.; Chen, R.; Zhang, Y.; Yang, G.J.; Kumagai, T.; Furushima-Shimogawara, R.; Lou, D.; Yang, K.; Wen, L.Y.; Lu, S.H.; et al. A new surveillance and response tool: Risk map of infected Oncomelania hupensis detected by loop-mediated isothermal amplification (LAMP) from pooled samples. Acta Trop. 2015, 141 Pt B, 170–177. [Google Scholar] [CrossRef]
- Xun-Ping, W.; An, Z. Study of spatial stratified sampling strategy of Oncomelania hupensis snail survey based on plant abundance. Zhongguo Xue Xi Chong Bing Fang Zhi Za Zhi 2017, 29, 420–425. (In Chinese) [Google Scholar] [PubMed]
- Lo, N.C.; Gurarie, D.; Yoon, N.; Coulibaly, J.T.; Bendavid, E.; Andrews, J.R.; King, C.H. Impact and cost-effectiveness of snail control to achieve disease control targets for schistosomiasis. Proc. Natl. Acad. Sci. USA 2018, 115, E584–E591. [Google Scholar] [CrossRef] [PubMed]
- Pontes, L.A.; Dias-Neto, E.; Rabello, A. Detection by polymerase chain reaction of Schistosoma mansoni DNA in human serum and feces. Am. J. Trop. Med. Hyg. 2002, 66, 157–162. [Google Scholar] [CrossRef] [PubMed]
- He, P.; Gordon, C.A.; Williams, G.M.; Li, Y.; Wang, Y.; Hu, J.; Gray, D.J.; Ross, A.G.; Harn, D.; McManus, D.P. Real-time PCR diagnosis of Schistosoma japonicum in low transmission areas of China. Infect. Dis. Poverty 2018, 7, 8. [Google Scholar] [CrossRef] [PubMed]
- Wilisiani, F.; Tomiyama, A.; Katoh, H.; Hartono, S.; Neriya, Y.; Nishigawa, H.; Natsuaki, T. Development of a LAMP assay with a portable device for real-time detection of begomoviruses under field conditions. J. Virol. Methods 2018. [Google Scholar] [CrossRef] [PubMed]
- Singh, R.; Singh, D.P.; Savargaonkar, D.; Singh, O.P.; Bhatt, R.M.; Valecha, N. Evaluation of SYBR green I based visual loop-mediated isothermal amplification (LAMP) assay for genus and species-specific diagnosis of malaria in P. vivax and P. falciparum endemic regions. J. Vector Borne Dis. 2017, 54, 54–60. [Google Scholar] [PubMed]
- Ali, S.A.; Kaur, G.; Boby, N.; Sabarinath, T.; Solanki, K.; Pal, D.; Chaudhuri, P. Rapid and visual detection of leptospira in urine by LigB-LAMP assay with pre-addition of dye. Mol. Cell. Probes 2017, 36, 29–35. [Google Scholar] [CrossRef]
- Yang, Y.; Zheng, S.B.; Yang, Y.; Cheng, W.T.; Pan, X.; Dai, Q.Q.; Chen, Y.; Zhu, L.; Jiang, Q.W.; Zhou, Y.B. The Three Gorges Dam: Does the flooding time determine the distribution of schistosome-transmitting snails in the middle and lower reaches of the Yangtze River, China? Int. J. Environ. Res. Public Health 2018, 15, 1304. [Google Scholar] [CrossRef]



| Province | No. of Counties Included | No. of Villages Included | No. of Snails Tested | No. of Pooled Samples | Microscopy | LAMP | PCR | |||
|---|---|---|---|---|---|---|---|---|---|---|
| Pos. * | % | Pos. * | % | Pos. * | % | |||||
| Hubei | 2 | 5 | 599 | 38 | 1 | 0.5 | 3 | 7. 9 | 3 | 7.9 |
| Hunan | 2 | 6 | 716 | 80 | 0 | 0 | 2 | 2.5 | 2 | 2.5 |
| Jiangxi | 6 | 25 | 1183 | 34 | 0 | 0 | 5 | 14.7 | 4 | 11.8 |
| Anhui | 2 | 6 | 698 | 43 | 0 | 0 | 1 | 2.3 | 1 | 2.3 |
| Yunnan | 3 | 9 | 810 | 37 | 0 | 0 | 4 | 10.8 | 4 | 10.8 |
| Total | 15 | 51 | 4006 | 232 | 1 | 0.4 | 15 | 6.5 | 14 | 6.0 |
| Province | No. of Counties Included | No. of Villages Included | No. of Snails Tested | No. of Pooled Samples | Microscopy | LAMP | PCR | |||
|---|---|---|---|---|---|---|---|---|---|---|
| Pos. * | % | Pos. * | % | Pos. * | % | |||||
| Shanghai | 2 | 2 | 200 | 4 | 0 | 0 | 0 | 0 | 0 | 0 |
| Zhejiang | 2 | 2 | 500 | 10 | 0 | 0 | 0 | 0 | 0 | 0 |
| Guangxi | 2 | 2 | 300 | 6 | 0 | 0 | 0 | 0 | 0 | 0 |
| Total | 6 | 6 | 1000 | 20 | 0 | 0 | 0 | 0 | 0 | 0 |
| Province | Laboratory | Score 2013 | Score 2014 | Score 2015 |
|---|---|---|---|---|
| Hunan | IPD | 100 | 100 | 100 |
| Hanshou | - | 100 | 100 | |
| Yuanjiang | - | 100 | 100 | |
| Yueyang | - | 100 | 100 | |
| Hubei | CDC | 100 | 100 | 100 |
| Gongan | - | 100 | 100 | |
| Hanchuan | - | 100 | 100 | |
| Jiangling | - | 100 | 100 | |
| Anhui | IPD | 100 | 100 | 100 |
| Wuhu | - | 100 | 100 | |
| Anqin | - | 100 | 100 | |
| Guichi | - | 100 | 100 | |
| Jiangxi | IPD | 100 | 100 | 100 |
| Poyang | - | 60 | 100 | |
| Duchang | - | 60 | 100 | |
| Jiangsu | IPD | 100 | 100 | 100 |
| Qixia | - | 100 | 100 | |
| Sichuan | CDC | 100 | 100 | 100 |
| Renshou | - | 100 | 100 | |
| Guanghan | - | 100 | 100 | |
| Yunnan | CDC | 100 | 100 | 100 |
| Dali | - | 80 | 90 | |
| Eryuan | - | 100 | 100 | |
| Shanghai | CDC | 100 | 100 | 100 |
| Guangdong | CDC | 100 | 100 | 100 |
| Fujian | CDC | 100 | 100 | 100 |
| Zhejiang | IPD | 100 | 100 | 100 |
| Guangxi | CDC | 80 | 100 | 100 |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Qin, Z.-Q.; Xu, J.; Feng, T.; Lv, S.; Qian, Y.-J.; Zhang, L.-J.; Li, Y.-L.; Lv, C.; Bergquist, R.; Li, S.-Z.; et al. Field Evaluation of a Loop-Mediated Isothermal Amplification (LAMP) Platform for the Detection of Schistosoma japonicum Infection in Oncomelania hupensis Snails. Trop. Med. Infect. Dis. 2018, 3, 124. https://doi.org/10.3390/tropicalmed3040124
Qin Z-Q, Xu J, Feng T, Lv S, Qian Y-J, Zhang L-J, Li Y-L, Lv C, Bergquist R, Li S-Z, et al. Field Evaluation of a Loop-Mediated Isothermal Amplification (LAMP) Platform for the Detection of Schistosoma japonicum Infection in Oncomelania hupensis Snails. Tropical Medicine and Infectious Disease. 2018; 3(4):124. https://doi.org/10.3390/tropicalmed3040124
Chicago/Turabian StyleQin, Zhi-Qiang, Jing Xu, Ting Feng, Shan Lv, Ying-Jun Qian, Li-Juan Zhang, Yin-Long Li, Chao Lv, Robert Bergquist, Shi-Zhu Li, and et al. 2018. "Field Evaluation of a Loop-Mediated Isothermal Amplification (LAMP) Platform for the Detection of Schistosoma japonicum Infection in Oncomelania hupensis Snails" Tropical Medicine and Infectious Disease 3, no. 4: 124. https://doi.org/10.3390/tropicalmed3040124
APA StyleQin, Z.-Q., Xu, J., Feng, T., Lv, S., Qian, Y.-J., Zhang, L.-J., Li, Y.-L., Lv, C., Bergquist, R., Li, S.-Z., & Zhou, X.-N. (2018). Field Evaluation of a Loop-Mediated Isothermal Amplification (LAMP) Platform for the Detection of Schistosoma japonicum Infection in Oncomelania hupensis Snails. Tropical Medicine and Infectious Disease, 3(4), 124. https://doi.org/10.3390/tropicalmed3040124
