Comparative Analysis of Next- and Third-Generation Sequencing Platforms for Chikungunya Virus Whole-Genome Sequencing Using a Lineage-Inclusive Primer Set During the 2025 Foshan Outbreak
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection and Clinical Information
2.2. Design of a Lineage-Inclusive CHIKV Primer Set
2.3. RT-PCR Amplification and Amplicon Generation
2.4. Illumina Library Preparation and Sequencing
2.5. Oxford Nanopore Library Preparation and Sequencing
2.6. Bioinformatic Analysis of Illumina NGS and Nanopore TGS Data
2.7. Comparative Evaluation of Sequencing Platform Performance
3. Results
3.1. Clinical Characteristics of CHIKV-Positive Samples
3.2. Validation of Lineage-Inclusive Amplicon Amplification
3.3. Illumina NGS Achieves High-Depth and Uniform Coverage of the CHIKV Genome
3.4. Sequencing Performance of Oxford Nanopore TGS
3.5. NGS and TGS Demonstrate Complementary Performance Characteristics in Coverage and Accuracy
3.6. Concordance in Variant Calling and Identification of Key Mutations
3.7. Phylogenetic Analysis and Outbreak Origin
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| CHIKV | Chikungunya virus |
| NGS | Next-generation sequencing |
| TGS | Third-generation sequencing |
| ONT | Oxford Nanopore Technologies |
| WGS | Whole-genome sequencing |
| ECSA | East/Central/South African |
| SNV | Single-nucleotide variant |
| UTR | Untranslated region |
| RT-PCR | Reverse transcription polymerase chain reaction |
| Ct | Cycle threshold |
| CDS | Coding sequence |
Appendix A
| Name | Sites | Sequence |
|---|---|---|
| LEFT_1 | 8–30 | GTGAGACACACGTAGCCTACCA |
| RIGHT_1 | 1328–1353 | TGCTTTTTGAATGCCCATAGACAGC |
| LEFT_2 | 1284–1307 | AGATGAAAAACTCCTGGGGGTCA |
| RIGHT_2 | 2604–2626 | CAGTGTACACCGCCTGGAGATA |
| LEFT_3 | 2565–2590 | TTACAATCACAACATCTGCACCCAA |
| RIGHT_3 | 3885–3907 | TCCCAATACGCAGATGACTCGT |
| LEFT_4 | 3797–3818 | AAATGCTCGGGGGTGACTCAT |
| RIGHT_4 | 5116–5136 | AGTATCTCGCCGTCAACGCT |
| LEFT_5 | 5069–5091 | AGGAAGCGAGTACGGCTATGTC |
| RIGHT_5 | 6389–6412 | TGTTATCCTGATAGGGCTGGCAG |
| LEFT_6 | 6318–6341 | GGACTCAGCAGTATTCAACGTGG |
| RIGHT_6 | 7637–7659 | TCTGGGCCTGATGACCTGGATA |
| LEFT_7 | 7590–7614 | TTTTACAACAGGAGGTACCAGCCT |
| RIGHT_7 | 8910–8931 | GTGAAATGGGTGCGTGCATGA |
| LEFT_8 | 8877–8899 | GTGGGATTCACTGACGGTAGGA |
| RIGHT_8 | 10,197–10,224 | GCTGTAGTCAGGTAGATTTTTGTCCTT |
| LEFT_9 | 10,165–10,185 | CGTACGTGAAATGCTGCGGT |
| RIGHT_9 | 11,485–11,513 | CCTACATACAATGTGTCTCTTAGGGGAC |
| LEFT_10 | 10,475–10,498 | CATTGTGGGGCCAATGTCTTCAG |
| RIGHT_10 | 11,790–11,823 | ATATTAAAAACAAAATAACATCTCCTACGTCCC |
| ID | Reads | % Reads Identified (PF) | Total Data Volume (Mb) | Q20 (%) | Q30 (%) | Average Sequencing Depth |
|---|---|---|---|---|---|---|
| C250113 | 1,087,729 | 4.61 | 101.82 | 96 | 93 | 8168.0 |
| C250114 | 1,132,029 | 4.81 | 103.1 | 97 | 95 | 7814.4 |
| C250115 | 1,197,112 | 5.08 | 109.43 | 96 | 94 | 8533.1 |
| C250116 | 526,196 | 2.24 | 48.6 | 95 | 92 | 3607.2 |
| C250117 | 1,235,424 | 5.24 | 112.93 | 96 | 94 | 8825.8 |
| C250118 | 839,145 | 3.57 | 78.07 | 96 | 93 | 5983.1 |
| C250119 | 1,143,369 | 4.86 | 105.02 | 96 | 94 | 8165.5 |
| C250121 | 1,490,474 | 6.33 | 135.25 | 96 | 94 | 10678.9 |
| C250122 | 953,481 | 4.03 | 89.67 | 96 | 94 | 7097.4 |
| C250123 | 919,858 | 3.90 | 86.44 | 96 | 94 | 6758.4 |
| C250124 | 829,318 | 3.51 | 77.86 | 96 | 94 | 6130.0 |
| C250125 | 866,515 | 3.68 | 81.41 | 95 | 93 | 6345.3 |
| C250126 | 901,988 | 3.82 | 84.61 | 96 | 94 | 6700.1 |
| C250127 | 522,734 | 2.24 | 48.63 | 95 | 93 | 3301.1 |
| C250128 | 903,634 | 3.84 | 84.89 | 96 | 93 | 6512.1 |
| C250130 | 484,677 | 2.06 | 44.1 | 96 | 93 | 3346.0 |
| C250131 | 782,767 | 3.32 | 73.59 | 96 | 93 | 5674.2 |
| C250133 | 773,226 | 3.29 | 72.73 | 96 | 94 | 5630.7 |
| C250134 | 796,468 | 3.39 | 74.59 | 95 | 93 | 5745.3 |
| C250135 | 736,375 | 3.12 | 69.35 | 95 | 93 | 5418.2 |
| C250136 | 705,394 | 3.15 | 66.0 | 95 | 93 | 4994.1 |
| C250137 | 947,998 | 4.03 | 89.27 | 96 | 93 | 7041.6 |
| C250138 | 1,015,585 | 4.31 | 95.36 | 96 | 94 | 7607.9 |
| C250140 | 1,092,526 | 4.66 | 100.53 | 96 | 94 | 7627.7 |
References
- Wan, S.; Zhang, X.; Cong, X.; Liu, Y.; Huang, S.; Zhou, M.; Sun, C.; Peng, X.; Zhang, H.; Yu, Y.; et al. Viral Load Dynamics of Chikungunya Virus in Human Specimens—Foshan City, Guangdong Province, China, 2025. China CDC Wkly. 2025, 7, 1067–1072. [Google Scholar] [CrossRef] [Scilit]
- Weaver, S.C.; Chen, R.; Diallo, M. Chikungunya Virus: Role of Vectors in Emergence from Enzootic Cycles. Annu. Rev. Entomol. 2020, 65, 313–332. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- de Souza, W.M.; Lecuit, M.; Weaver, S.C. Chikungunya virus and other emerging arthritogenic alphaviruses. Nat. Rev. Microbiol. 2025, 23, 585–601. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Freppel, W.; Silva, L.A.; Stapleford, K.A.; Herrero, L.J. Pathogenicity and virulence of chikungunya virus. Virulence 2024, 15, 2396484. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Y.; Jiang, S.; Zhang, M.; Li, Y.; He, J.; Yang, Z.; Huang, X.; Guan, Q.; Li, Z.; Xie, J.; et al. An Outbreak of Chikungunya Fever in China—Foshan City, Guangdong Province, China, July 2025. China CDC Wkly. 2025, 7, 1064–1065. [Google Scholar]
- Bartholomeeusen, K.; Daniel, M.; LaBeaud, D.A.; Gasque, P.; Peeling, R.W.; Stephenson, K.E.; Ng, L.F.P.; Ariën, K.K. Chikungunya fever. Nat. Rev. Dis. Primers 2023, 9, 17. [Google Scholar] [CrossRef] [Scilit]
- Zhou, X.; Xie, X.; Wang, W.; Gao, H.; Wang, K.; Liu, X.; Chen, X.; Jiang, Y.; Yu, H.; Xing, D.; et al. First whole-genome chikungunya virus sequence detected in mosquitoes during the 2025 Foshan outbreak: Evidence of field vector infection and transmission potential in China. Infect. Dis. Poverty 2025, 14, 108. [Google Scholar] [CrossRef] [Scilit]
- Wu, D.; Wu, J.; Zhang, Q.; Zhong, H.; Ke, C.; Deng, X.; Guan, D.; Li, H.; Zhang, Y.; Zhou, H.; et al. Chikungunya outbreak in Guangdong Province, China, 2010. Emerg. Infect. Dis. 2012, 18, 493–495. [Google Scholar] [CrossRef] [Scilit]
- Pan, J.; Fang, C.; Yan, J.; Yan, H.; Zhan, B.; Sun, Y.; Liu, Y.; Mao, H.; Cao, G.; Lv, L.; et al. Chikungunya Fever Outbreak, Zhejiang Province, China, 2017. Emerg. Infect. Dis. 2019, 25, 1589–1591. [Google Scholar] [CrossRef] [Scilit]
- Liu, L.-B.; Li, M.; Gao, N.; Shen, J.-Y.; Sheng, Z.-Y.; Fan, D.-Y.; Zhou, H.-N.; Yin, X.-X.; Mao, J.-R.; Jiang, J.-Y.; et al. Epidemiological and clinical characteristics of the chikungunya outbreak in Ruili City, Yunnan Province, China. J. Med. Virol. 2022, 94, 499–506. [Google Scholar] [CrossRef] [Scilit]
- Frumence, E.; Piorkowski, G.; Traversier, N.; Amaral, R.; Vincent, M.; Mercier, A.; Ayhan, N.; Souply, L.; Pezzi, L.; Lier, C.; et al. Genomic insights into the re-emergence of chikungunya virus on Réunion Island, France, 2024 to 2025. Eur. Commun. Dis. Bull. 2025, 30, 2500344. [Google Scholar] [CrossRef] [Scilit]
- Khongwichit, S.; Chansaenroj, J.; Chirathaworn, C.; Poovorawan, Y. Chikungunya virus infection: Molecular biology, clinical characteristics, and epidemiology in Asian countries. J. Biomed. Sci. 2021, 28, 84. [Google Scholar] [CrossRef] [Scilit]
- Wu, D.; Zhang, Y.; Zhouhui, Q.; Kou, J.; Liang, W.; Zhang, H.; Monagin, C.; Zhang, Q.; Li, W.; Zhong, H.; et al. Chikungunya virus with E1-A226V mutation causing two outbreaks in 2010, Guangdong, China. Virol. J. 2013, 10, 174. [Google Scholar] [CrossRef] [Scilit]
- Hassan, S.; Bahar, R.; Johan, M.F.; Mohamed Hashim, E.K.; Abdullah, W.Z.; Esa, E.; Abdul Hamid, F.S.; Zulkafli, Z. Next-Generation Sequencing (NGS) and Third-Generation Sequencing (TGS) for the Diagnosis of Thalassemia. Diagnostics 2023, 13, 373. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Deurenberg, R.H.; Bathoorn, E.; Chlebowicz, M.A.; Couto, N.; Ferdous, M.; García-Cobos, S.; Kooistra-Smid, A.M.D.; Raangs, E.C.; Rosema, S.; Veloo, A.C.M.; et al. Application of next generation sequencing in clinical microbiology and infection prevention. J. Biotechnol. 2017, 243, 16–24. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Scarano, C.; Veneruso, I.; De Simone, R.R.; Di Bonito, G.; Secondino, A.; D’Argenio, V. The Third-Generation Sequencing Challenge: Novel Insights for the Omic Sciences. Biomolecules 2024, 14, 568. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Adikari, T.N.; Riaz, N.; Sigera, C.; Leung, P.; Valencia, B.M.; Barton, K.; Smith, M.A.; Bull, R.A.; Li, H.; Luciani, F.; et al. Single molecule, near full-length genome sequencing of dengue virus. Sci. Rep. 2020, 10, 18196. [Google Scholar] [CrossRef] [Scilit]
- Fischer, C.; de Lamballerie, X.; Drexler, J.F. Enhanced Molecular Surveillance of Chikungunya Virus. mSphere 2019, 4, e00295-19. [Google Scholar] [CrossRef] [Scilit]
- Liu, H.; Li, J.; Lin, Y.; Bo, X.; Song, H.; Li, K.; Li, P.; Ni, M. Assessment of two-pool multiplex long-amplicon nanopore sequencing of SARS-CoV-2. J. Med. Virol. 2022, 94, 327–334. [Google Scholar] [CrossRef] [Scilit]
- Howison, M.; Coetzer, M.; Kantor, R. Measurement error and variant-calling in deep Illumina sequencing of HIV. Bioinformatics 2019, 35, 2029–2035. [Google Scholar] [CrossRef] [Scilit]
- Santos, R.; Lee, H.; Williams, A.; Baffour-Kyei, A.; Lee, S.-H.; Troakes, C.; Al-Chalabi, A.; Breen, G.; Iacoangeli, A. Investigating the Performance of Oxford Nanopore Long-Read Sequencing with Respect to Illumina Microarrays and Short-Read Sequencing. Int. J. Mol. Sci. 2025, 26, 4492. [Google Scholar] [CrossRef] [Scilit]
- Li, J.; Wang, H.; Mao, L.; Yu, H.; Yu, X.; Sun, Z.; Qian, X.; Cheng, S.; Chen, S.; Chen, J.; et al. Rapid genomic characterization of SARS-CoV-2 viruses from clinical specimens using nanopore sequencing. Sci. Rep. 2020, 10, 17492. [Google Scholar] [CrossRef] [Scilit]
- Arévalo, M.T.; Karavis, M.A.; Katoski, S.E.; Harris, J.V.; Hill, J.M.; Deshpande, S.V.; Roth, P.A.; Liem, A.T.; Bernhards, R.C. A Rapid, Whole Genome Sequencing Assay for Detection and Characterization of Novel Coronavirus (SARS-CoV-2) Clinical Specimens Using Nanopore Sequencing. Front. Microbiol. 2022, 13, 910955. [Google Scholar] [CrossRef] [Scilit]
- Liu, Q.; Shen, H.; Gu, L.; Yuan, H.; Zhu, W. Chikungunya virus in Europe: A retrospective epidemiology study from 2007 to 2023. PLoS Negl. Trop. Dis. 2025, 19, e0012904. [Google Scholar] [CrossRef] [Scilit]
- Umair, M.; Yasir, M.; Jamal, Z.; Hakim, R.; Saeed, S.Y.; Salman, M.; Iqbal, A.; Khan, M.Q.; Khanzada, F.; Javed, Y. Whole-Genome sequencing of Chikungunya Virus (CHIKV) from Pakistan: Detection of the East/Central/South African (ECSA) genotype during the 2024 outbreak in Mansehra. PLoS ONE 2025, 20, e0329856. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kalyanasundram, J.; Zawawi, Z.M.; Kamel, K.A.; Aroidoss, E.T.; Ellan, K.; Anasir, M.I.; Azizan, M.A.; Zulkifli, M.M.S.; Zain, R.M. Emergence of ECSA-IOL E1-K211E/E2-V264A Lineage of Chikungunya virus during Malaysian 2021 outbreak. BMC Infect. Dis. 2024, 24, 1199. [Google Scholar] [CrossRef] [Scilit]
- Fournier, L.; Durand, G.A.; Cochet, A.; Brottet, E.; Fiet, C.; Mano, Q.; Krug, C.; Verdurme, L.; Blanchot, T.; Fournier, R.; et al. Multiple early local transmissions of chikungunya virus, Mainland France, from May 2025. Eur. Commun. Dis. Bull. 2025, 30, 2500545. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Taieb, F.; Baidaliuk, A.; Durand, A.; Prot BSc, M.; Jidar, K.; Hochedez, P.; Consigny, P.H.; Itani, O.; Simon-Loriere, E. Phylogenetic analysis of chikungunya virus in travellers returning from La Reunion Island. J. Travel Med. 2025, 32, taaf079. [Google Scholar] [CrossRef] [Scilit]





| ID | Gender | Age | Ct | Date of Symptom Onset | Date of Sample Collection |
|---|---|---|---|---|---|
| C250113 | Male | 72 | 20 | 12 July 2025 | 12 July 2025 |
| C250114 | Female | 37 | 24 | 11 July 2025 | 13 July 2025 |
| C250115 | Male | 66 | 22 | 12 July 2025 | 13 July 2025 |
| C250116 | Male | 19 | 27 | 12 July 2025 | 13 July 2025 |
| C250117 | Male | 32 | 24 | 11 July 2025 | 13 July 2025 |
| C250118 | Female | 66 | 27 | 7 July 2025 | 13 July 2025 |
| C250119 | Female | 9 | 26 | 12 July 2025 | 13 July 2025 |
| C250121 | Male | 79 | 23 | 12 July 2025 | 13 July 2025 |
| C250122 | Male | 62 | 22 | 13 July 2025 | 13 July 2025 |
| C250123 | Male | 68 | 22 | 12 July 2025 | 13 July 2025 |
| C250124 | Female | 84 | 23 | 12 July 2025 | 13 July 2025 |
| C250125 | Female | 55 | 24 | 12 July 2025 | 13 July 2025 |
| C250126 | Male | 42 | 24 | 12 July 2025 | 13 July 2025 |
| C250127 | Male | 48 | 29 | 11 July 2025 | 13 July 2025 |
| C250128 | Female | 21 | 28 | 12 July 2025 | 13 July 2025 |
| C250130 | Female | 48 | 27 | 12 July 2025 | 13 July 2025 |
| C250131 | Female | 77 | 25 | 11 July 2025 | 13 July 2025 |
| C250133 | Female | 59 | 28 | 12 July 2025 | 13 July 2025 |
| C250134 | Male | 10 | 27 | 13 July 2025 | 13 July 2025 |
| C250135 | Female | 8 | 26 | 13 July 2025 | 13 July 2025 |
| C250136 | Male | 43 | 28 | 12 July 2025 | 13 July 2025 |
| C250137 | Male | 8 | 27 | 12 July 2025 | 13 July 2025 |
| C250138 | Female | 20 | 27 | 12 July 2025 | 13 July 2025 |
| C250140 | Male | 13 | 28 | 12 July 2025 | 13 July 2025 |
| ID/Sites | 420 | 688 | 1557 | 2860 | 2904 | 2959 | 3481 | 3879 | 3897 | 5312 | 7446 | 9099 | 9449 | 9874 | 10,488 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| C250113 | - | - | - | - | - | - | - | C/T | - | - | - | - | - | - | - |
| - | - | - | - | - | - | - | C/T | - | - | - | - | - | - | - | |
| C250114 | - | - | - | - | - | - | - | C/T | - | - | - | - | - | C/T | - |
| - | - | - | - | - | - | - | C/T | - | - | - | - | - | C/T | - | |
| C250115 | - | - | - | - | - | - | - | C/T | - | - | - | - | - | C/T | - |
| - | - | - | - | - | - | - | C/T | - | - | - | - | - | C/T | - | |
| C250116 | - | - | - | - | - | - | - | C/T | C/T | - | - | - | - | - | - |
| - | - | - | - | - | - | - | C/T | C/T | - | - | - | - | - | - | |
| C250117 | - | - | - | - | - | - | T/C | C/T | - | T/C | - | - | - | - | - |
| - | - | - | - | - | - | T/C | C/T | - | C/T | - | - | - | - | - | |
| C250118 | - | - | - | - | - | - | - | C/T | - | - | - | - | - | - | - |
| - | - | - | - | - | - | - | C/T | - | - | - | - | - | - | - | |
| C250119 | - | - | - | - | - | - | - | C/T | - | - | - | - | - | C/T | - |
| - | - | - | - | - | - | - | C/T | - | - | - | - | - | C/T | - | |
| C250121 | - | - | - | - | - | - | - | C/T | - | - | - | - | - | - | - |
| - | - | - | - | - | - | - | C/T | - | - | - | - | - | - | - | |
| C250122 | - | - | - | - | - | - | - | C/T | - | - | - | - | - | C/T | - |
| - | - | - | - | - | - | - | C/T | - | - | - | - | - | C/T | - | |
| C250123 | - | - | - | - | - | - | - | C/T | - | - | - | - | - | - | - |
| - | - | - | - | - | - | - | C/T | - | - | - | - | - | - | - | |
| C250124 | A/C | - | - | G/A | - | - | - | C/T | - | - | - | - | - | C/T | - |
| - | - | - | G/A | - | - | - | C/T | - | - | - | - | - | C/T | - | |
| C250125 | - | - | - | - | - | - | - | C/T | - | - | - | - | - | - | - |
| - | - | - | - | - | - | - | C/T | - | - | - | - | - | - | - | |
| C250126 | - | - | - | - | - | - | - | C/T | - | - | - | - | - | - | - |
| - | - | - | - | - | - | - | C/T | - | - | - | - | - | - | - | |
| C250127 | - | - | - | - | - | - | - | C/T | - | - | - | - | - | C/T | - |
| - | - | - | - | - | - | - | C/T | - | - | - | - | - | C/T | - | |
| C250128 | - | - | - | - | - | G/A | - | C/T | - | - | - | - | - | - | - |
| - | - | - | - | - | G/A | - | C/T | - | - | - | - | - | - | - | |
| C250130 | - | - | - | - | - | G/A | - | C/T | - | - | - | - | - | - | - |
| - | - | - | - | - | G/A | - | C/T | - | - | - | - | - | - | - | |
| C250131 | - | - | - | - | - | - | - | C/T | - | - | - | - | - | C/T | - |
| - | - | - | - | - | - | - | C/T | - | - | - | - | - | C/T | - | |
| C250133 | - | - | - | - | - | - | - | C/T | - | - | - | - | - | C/T | - |
| - | - | - | - | - | - | - | C/T | - | - | - | - | - | - | - | |
| C250134 | - | - | - | - | G/A | - | - | C/T | - | - | - | - | - | - | - |
| - | - | - | - | G/A | - | - | C/T | - | - | - | A/T | - | - | - | |
| C250135 | - | - | T/C | - | - | - | - | C/T | - | - | - | - | - | - | - |
| - | - | T/C | - | - | - | - | C/T | - | - | - | - | - | - | - | |
| C250136 | - | G/A | - | - | - | - | - | C/T | - | - | - | - | C/T | - | C/T |
| - | G/A | - | - | - | - | - | C/T | - | - | - | A/T | C/T | - | C/T | |
| C250137 | - | - | - | - | - | - | - | C/T | - | - | - | - | - | - | - |
| - | - | - | - | - | - | - | C/T | - | - | - | A/T | - | - | - | |
| C250138 | - | - | - | - | - | - | - | C/T | - | - | T/C | - | - | - | - |
| - | - | - | - | - | - | - | C/T | - | - | T/C | - | - | - | - | |
| C250140 | - | - | - | - | - | - | - | C/T | - | - | - | - | - | - | - |
| - | - | - | - | - | - | - | C/T | - | - | - | - | - | - | - |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Jia, P.; Cong, X.; Zhang, C.; Liu, Z.; Peng, X.; Su, J.; Tan, Q.; Huang, S.; Sun, C.; Zhang, X.; et al. Comparative Analysis of Next- and Third-Generation Sequencing Platforms for Chikungunya Virus Whole-Genome Sequencing Using a Lineage-Inclusive Primer Set During the 2025 Foshan Outbreak. Trop. Med. Infect. Dis. 2026, 11, 44. https://doi.org/10.3390/tropicalmed11020044
Jia P, Cong X, Zhang C, Liu Z, Peng X, Su J, Tan Q, Huang S, Sun C, Zhang X, et al. Comparative Analysis of Next- and Third-Generation Sequencing Platforms for Chikungunya Virus Whole-Genome Sequencing Using a Lineage-Inclusive Primer Set During the 2025 Foshan Outbreak. Tropical Medicine and Infectious Disease. 2026; 11(2):44. https://doi.org/10.3390/tropicalmed11020044
Chicago/Turabian StyleJia, Penghui, Xiao Cong, Chang Zhang, Zhe Liu, Xiaofang Peng, Juan Su, Qiqi Tan, Shen Huang, Changyun Sun, Xin Zhang, and et al. 2026. "Comparative Analysis of Next- and Third-Generation Sequencing Platforms for Chikungunya Virus Whole-Genome Sequencing Using a Lineage-Inclusive Primer Set During the 2025 Foshan Outbreak" Tropical Medicine and Infectious Disease 11, no. 2: 44. https://doi.org/10.3390/tropicalmed11020044
APA StyleJia, P., Cong, X., Zhang, C., Liu, Z., Peng, X., Su, J., Tan, Q., Huang, S., Sun, C., Zhang, X., & Li, B. (2026). Comparative Analysis of Next- and Third-Generation Sequencing Platforms for Chikungunya Virus Whole-Genome Sequencing Using a Lineage-Inclusive Primer Set During the 2025 Foshan Outbreak. Tropical Medicine and Infectious Disease, 11(2), 44. https://doi.org/10.3390/tropicalmed11020044

