Dietary Effect of a Plant-Based Mixture (Phyto AquaMeric) on Growth Performance, Biochemical Analysis, Intestinal Histology, Gene Expression and Environmental Parameters of Nile Tilapia (Oreochromis niloticus)
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Design
2.2. Botanical Mixture Description and Potential
2.2.1. Botanical Mixture Description
2.2.2. In Vitro Antioxidant Potential of PAM through KRL Method
2.3. Experimental Diet Preparation
2.4. Sampling
2.4.1. Growth and Feed Utilization Performance
- -
- WG (g) = final body weight (FBW) − initial body weight (IBW)
- -
- % WG = 100 (FBW − IBW)/IBW
- -
- SGR (% Day−1) = 100 × [ln FBW − ln IBW]/feeding duration (days)
- -
- FCR = dry feed intake (g)/live WG (g)
- -
- PER = WG (g)/protein intake (g)
- -
- Survival (%) = 100 × [Total final fish number/total initial fish number]
2.4.2. Biochemical Analysis
2.4.3. Intestinal Histology Analysis
2.4.4. Gene Expression Analysis
2.5. Gut Microbiota Analysis
2.6. Environmental Impact on Farming System
2.7. Data Statistical Analysis
3. Results
3.1. Antioxidant Status of PAM through a KRL Assay
3.2. Growth Performance and Feed Efficiency
3.3. Hematological Parameters
3.4. Immunological and Antioxidant Parameters
3.5. Digestive and Liver Enzymes
3.6. Intestinal Histology
3.7. Gene Expression Analysis
3.8. Gut Microbiota
3.9. Eutrophication Potential
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- FAO. The State of World Fisheries and Aquaculture 2024—Blue Transformation in Action; Rome FAO: Rome, Italy, 2024; ISBN 978-92-5-138763-4. [Google Scholar]
- Miao, W.; Wang, W. Trends of Aquaculture Production and Trade: Carp, Tilapia, and Shrimp. Asian Fish. Soc. 2020, 33S, 1–10. [Google Scholar] [CrossRef]
- FishStat. Available online: https://www.fao.org/fishery/en/statistics/software/fishstatj (accessed on 28 August 2024).
- Ali, S.E.; Jansen, M.D.; Mohan, C.V.; Delamare-Deboutteville, J.; Charo-Karisa, H. Key Risk Factors, Farming Practices and Economic Losses Associated with Tilapia Mortality in Egypt. Aquaculture 2020, 527, 735438. [Google Scholar] [CrossRef]
- Mukta, M.-A.; Khan, M.A.; Mian, M.R.U.; Juice, R.A. Is Tilapia Farming Financially Profitable and Efficient? Policy Options for Sustainable Farming. J. Bangladesh Agric. Univ. 2019, 17, 92–98. [Google Scholar] [CrossRef]
- Hoseinifar, S.H.; Dadar, M.; Van Doan, H.; Harikrishnan, R. Feed Additives Impacts on Shellfish Microbiota, Health, and Development. In Microbial Communities in Aquaculture Ecosystems; Derome, N., Ed.; Springer International Publishing: Cham, Switzerland, 2019; pp. 143–163. ISBN 978-3-030-16189-7. [Google Scholar]
- Encarnação, P. Functional Feed Additives in Aquaculture Feeds. In Aquafeed Formulation; Elsevier: Amsterdam, The Netherlands, 2016; pp. 217–237. ISBN 978-0-12-800873-7. [Google Scholar]
- Dadras, F.; Velisek, J.; Zuskova, E. An Update about Beneficial Effects of Medicinal Plants in Aquaculture: A Review. Vet. Med. 2023, 68, 449–463. [Google Scholar] [CrossRef]
- Fagnon, M.S.; Thorin, C.; Calvez, S. Meta-analysis of Dietary Supplementation Effect of Turmeric and Curcumin on Growth Performance in Fish. Rev. Aquac. 2020, 12, 2268–2283. [Google Scholar] [CrossRef]
- Farag, M.R.; Abdelnour, S.A.; Patra, A.K.; Dhama, K.; Dawood, M.A.O.; Elnesr, S.S.; Alagawany, M. Propolis: Properties and Composition, Health Benefits and Applications in Fish Nutrition. Fish Shellfish Immunol. 2021, 115, 179–188. [Google Scholar] [CrossRef]
- Mahmoud, H.K.; Al-Sagheer, A.A.; Reda, F.M.; Mahgoub, S.A.; Ayyat, M.S. Dietary Curcumin Supplement Influence on Growth, Immunity, Antioxidant Status, and Resistance to Aeromonas hydrophila in Oreochromis niloticus. Aquaculture 2017, 475, 16–23. [Google Scholar] [CrossRef]
- Jäger, R.; Lowery, R.P.; Calvanese, A.V.; Joy, J.M.; Purpura, M.; Wilson, J.M. Comparative Absorption of Curcumin Formulations. Nutr. J. 2014, 13, 11. [Google Scholar] [CrossRef]
- Rohman, A.; Widodo, H.; Lukitaningsih, E.; Rafi, M.; Nurrulhidayah, A.F.; Windarsih, A. Review on in Vitro Antioxidant Activities of Curcuma Species Commonly Used as Herbal Components in Indonesia. Food Res. 2019, 4, 286–293. [Google Scholar] [CrossRef]
- Amer, S.A.; El-Araby, D.A.; Tartor, H.; Farahat, M.; Goda, N.I.A.; Farag, M.F.M.; Fahmy, E.M.; Hassan, A.M.; Abo El-Maati, M.F.; Osman, A. Long-Term Feeding with Curcumin Affects the Growth, Antioxidant Capacity, Immune Status, Tissue Histoarchitecture, Immune Expression of Proinflammatory Cytokines, and Apoptosis Indicators in Nile Tilapia, Oreochromis niloticus. Antioxidants 2022, 11, 937. [Google Scholar] [CrossRef]
- Eissa, E.-S.H.; Alaidaroos, B.A.; Jastaniah, S.D.; Munir, M.B.; Shafi, M.E.; Abd El-Aziz, Y.M.; Bazina, W.K.; Ibrahim, S.B.; Eissa, M.E.H.; Paolucci, M.; et al. Dietary Effects of Nano Curcumin on Growth Performances, Body Composition, Blood Parameters and Histopathological Alternation in Red Tilapia (Oreochromis sp.) Challenged with Aspergillus flavus. Fishes 2023, 8, 208. [Google Scholar] [CrossRef]
- Santos, L.M.; Fonseca, M.S.; Sokolonski, A.R.; Deegan, K.R.; Araújo, R.P.; Umsza-Guez, M.A.; Barbosa, J.D.; Portela, R.D.; Machado, B.A. Propolis: Types, Composition, Biological Activities, and Veterinary Product Patent Prospecting. J. Sci. Food Agric. 2020, 100, 1369–1382. [Google Scholar] [CrossRef] [PubMed]
- Anjum, S.I.; Ullah, A.; Khan, K.A.; Attaullah, M.; Khan, H.; Ali, H.; Bashir, M.A.; Tahir, M.; Ansari, M.J.; Ghramh, H.A.; et al. Composition and Functional Properties of Propolis (Bee Glue): A Review. Saudi J. Biol. Sci. 2019, 26, 1695–1703. [Google Scholar] [CrossRef] [PubMed]
- De La Cruz-Cervantes, J.A.; Benavides-González, F.; Sánchez-Martínez, J.G.; Vázquez-Sauceda, M.D.L.L.; Ruiz-Uribe, A.J. Propolis in Aquaculture: A Review of Its Potential. Rev. Fish. Sci. Aquac. 2018, 26, 337–349. [Google Scholar] [CrossRef]
- Dawood, M.A.O.; El Basuini, M.F.; Yilmaz, S.; Abdel-Latif, H.M.R.; Alagawany, M.; Kari, Z.A.; Abdul Razab, M.K.A.; Hamid, N.K.A.; Moonmanee, T.; Van Doan, H. Exploring the Roles of Dietary Herbal Essential Oils in Aquaculture: A Review. Animals 2022, 12, 823. [Google Scholar] [CrossRef]
- Hassan, T.; Ajani, E.K.; Osho, F.E.; Munguti, J.; Adekanmbi, A.O.; Awoyemi, E.I. In-Vitro Antibacterial Potentials of Essential Oil from Citrus Limon against Selected Pathogenic Bacteria Isolated from Cultured Nile Tilapia (Oreochromis niloticus). Asian J. Fish. Aquat. 2023, 24, 10–20. [Google Scholar] [CrossRef]
- EFSA Panel on Additives and Products or Substances used in Animal Feed (FEEDAP); Bampidis, V.; Azimonti, G.; de Lourdes Bastos, M.; Christensen, H.; Kos Durjava, M.; Kouba, M.; López-Alonso, M.; López Puente, S.; Marcon, F.; et al. Safety and Efficacy of Turmeric Extract, Turmeric Oil, Turmeric Oleoresin and Turmeric Tincture from Curcuma longa L. Rhizome When Used as Sensory Additives in Feed for All Animal Species. EFSA J. 2020, 18, e06146. [Google Scholar] [CrossRef]
- Teodósio, R.; Engrola, S.; Colen, R.; Masagounder, K.; Aragão, C. Optimizing Diets to Decrease Environmental Impact of Nile Tilapia (Oreochromis niloticus) Production. Aquacult. Nutr. 2020, 26, 422–431. [Google Scholar] [CrossRef]
- Corino, C.; Prost, M.; Pizzi, B.; Rossi, R. Dietary Plant Extracts Improve the Antioxidant Reserves in Weaned Piglets. Antioxidants 2021, 10, 702. [Google Scholar] [CrossRef]
- Dawood, M.A.O.; Koshio, S. Vitamin C Supplementation to Optimize Growth, Health and Stress Resistance in Aquatic Animals. Rev. Aquac. 2018, 10, 334–350. [Google Scholar] [CrossRef]
- Makled, S.O.; Hamdan, A.M.; El-Sayed, A.-F.M. Growth Promotion and Immune Stimulation in Nile Tilapia, Oreochromis niloticus, Fingerlings Following Dietary Administration of a Novel Marine Probiotic, Psychrobacter maritimus S. Probiotics Antimicrob. Proteins 2020, 12, 365–374. [Google Scholar] [CrossRef] [PubMed]
- Makled, S.O.; Hamdan, A.M.; El-Sayed, A.M. Effects of Dietary Supplementation of a Marine Thermotolerant Bacterium, Bacillus paralicheniformis SO-1, on Growth Performance and Immune Responses of Nile Tilapia, Oreochromis niloticus. Aquacult. Nutr. 2019, 25, 817–827. [Google Scholar] [CrossRef]
- Abdel-Tawwab, M.; Abdel-Rahman, A.M.; Ismael, N.E.M. Evaluation of Commercial Live Bakers’ Yeast, Saccharomyces cerevisiae as a Growth and Immunity Promoter for Fry Nile Tilapia, Oreochromis niloticus (L.) Challenged in Situ with Aeromonas hydrophila. Aquaculture 2008, 280, 185–189. [Google Scholar] [CrossRef]
- Rawling, M.D.; Merrifield, D.L.; Davies, S.J. Preliminary Assessment of Dietary Supplementation of Sangrovit® on Red Tilapia (Oreochromis niloticus) Growth Performance and Health. Aquaculture 2009, 294, 118–122. [Google Scholar] [CrossRef]
- Yano, T.; Hatayama, Y.; Matsuyama, H.; Nakao, M. Titration of the Alternative Complement Pathway Activity of Representative Cultured Fishes. Nippon Suisan Gakkaishi 1988, 54, 1049–1054. [Google Scholar] [CrossRef]
- Prieto, A.I.; Pichardo, S.; Jos, Á.; Moreno, I.; Cameán, A.M. Time-Dependent Oxidative Stress Responses after Acute Exposure to Toxic Cyanobacterial Cells Containing Microcystins in Tilapia Fish (Oreochromis niloticus) under Laboratory Conditions. Aquat. Toxicol. 2007, 84, 337–345. [Google Scholar] [CrossRef]
- Sun, Y.-Z.; Yang, H.-L.; Ma, R.-L.; Zhang, C.-X.; Lin, W.-Y. Effect of Dietary Administration of Psychrobacter sp. on the Growth, Feed Utilization, Digestive Enzymes and Immune Responses of Grouper Epinephelus coioides: Psychrobacter sp. May Be a Novel Probiont. Aquac. Nutr. 2011, 17, e733–e740. [Google Scholar] [CrossRef]
- Borges, A.; Scotti, L.V.; Siqueira, D.R.; Jurinitz, D.F.; Wassermann, G.F. Hematologic and Serum Biochemical Values for Jundiá (Rhamdia quelen). Fish Physiol. Biochem. 2004, 30, 21–25. [Google Scholar] [CrossRef]
- Elsabagh, M.; Mohamed, R.; Moustafa, E.M.; Hamza, A.; Farrag, F.; Decamp, O.; Dawood, M.A.O.; Eltholth, M. Assessing the Impact of Bacillus Strains Mixture Probiotic on Water Quality, Growth Performance, Blood Profile and Intestinal Morphology of Nile Tilapia, Oreochromis niloticus. Aquacult. Nutr. 2018, 24, 1613–1622. [Google Scholar] [CrossRef]
- Yusefi, M.; Mohammadiazarm, H.; Salati, A.P. Effects of Dietary Sodium Diformate on Growth Performance, Immunological and Biochemical Blood Indices, Antioxidant Capacity, and Thermal Stress Tolerance of Juvenile Common Carp (Cprinus carpio). Aquac. Rep. 2022, 22, 100963. [Google Scholar] [CrossRef]
- Yacout, D.M.M.; Soliman, N.F.; Yacout, M.M. Comparative Life Cycle Assessment (LCA) of Tilapia in Two Production Systems: Semi-Intensive and Intensive. Int. J. Life Cycle Assess. 2016, 21, 806–819. [Google Scholar] [CrossRef]
- Beccali, M.; Cellura, M.; Iudicello, M.; Mistretta, M. Resource Consumption and Environmental Impacts of the Agrofood Sector: Life Cycle Assessment of Italian Citrus-Based Products. Environ. Manag. 2009, 43, 707–724. [Google Scholar] [CrossRef] [PubMed]
- Rossi, R.; Pastorelli, G.; Corino, C. Application of KRL Test to Assess Total Antioxidant Activity in Pigs: Sensitivity to Dietary Antioxidants. Res. Vet. Sci. 2013, 94, 372–377. [Google Scholar] [CrossRef] [PubMed]
- Pehlivan, F.E. Vitamin C: An Antioxidant Agent. In Vitamin C; Hamza, A.H., Ed.; InTech: London, UK, 2017; ISBN 978-953-51-3421-3. [Google Scholar]
- Hoa, T.T.T.; Fagnon, M.S.; Duyen, T.T.M.; Viet, L.Q.; Chabrillat, T.; Kerros, S. Dietary Effect of Botanical Blend (Phyto AquaNityTM) on Growth, Immunity and Survival of Pacific White Shrimps Challenged against WSSV. Aquac. Rep. 2024, 34, 101914. [Google Scholar] [CrossRef]
- Da Silva, E.G.; Finamor, I.A.; Bressan, C.A.; Schoenau, W.; Vencato, M.D.S.; Pavanato, M.A.; Cargnelutti, J.F.; Da Costa, S.T.; Antoniazzi, A.Q.; Baldisserotto, B. Dietary Supplementation with R-(+)-Limonene Improves Growth, Metabolism, Stress, and Antioxidant Responses of Silver Catfish Uninfected and Infected with Aeromonas hydrophila. Animals 2023, 13, 3307. [Google Scholar] [CrossRef]
- Aanyu, M.; Betancor, M.B.; Monroig, O. Effects of Dietary Limonene and Thymol on the Growth and Nutritional Physiology of Nile Tilapia (Oreochromis niloticus). Aquaculture 2018, 488, 217–226. [Google Scholar] [CrossRef]
- Caballero, M.J.; Izquierdo, M.S.; Kjørsvik, E.; Montero, D.; Socorro, J.; Fernández, A.J.; Rosenlund, G. Morphological Aspects of Intestinal Cells from Gilthead Seabream (Sparus aurata) Fed Diets Containing Different Lipid Sources. Aquaculture 2003, 225, 325–340. [Google Scholar] [CrossRef]
- Wang, K.; Jin, X.; Chen, Y.; Song, Z.; Jiang, X.; Hu, F.; Conlon, M.; Topping, D. Polyphenol-Rich Propolis Extracts Strengthen Intestinal Barrier Function by Activating AMPK and ERK Signaling. Nutrients 2016, 8, 272. [Google Scholar] [CrossRef]
- Nishikawa, S.; Kamiya, M.; Aoyama, H.; Yoshimura, K.; Miyata, R.; Kumazawa, S.; Tsuda, T. Co-Administration of Curcumin and Artepillin C Induces Development of Brown-Like Adipocytes in Association with Local Norepinephrine Production by Alternatively Activated Macrophages in Mice. J. Nutr. Sci. Vitaminol. 2019, 65, 328–334. [Google Scholar] [CrossRef]
- De Albuquerque, N.C.P.; Tadini, M.C.; Aguillera Forte, A.L.S.; Ballestero, G.; Teixeira, T.V.; Marquele De Oliveira, F.; Fagnon, M.S.; Jouaud, M.; Chantemargue, B.; Trouillas, P.; et al. Citrus, Milk Thistle, and Propolis Extracts Improved the Intestinal Permeability of Curcuminoids from Turmeric Extract—An In Silico and In Vitro Permeability Caco-2 Cells Approach. ACS Food Sci. Technol. 2023, 3, 113–122. [Google Scholar] [CrossRef]
- Margaret, A.; Euglance, G.M.; Racheal, N. Diets Supplemented with Limonene and Thymol Modify Intestinal Histomorphology of Nile Tilapia Oreochromis niloticus. Sci. Afr. 2021, 12, e00750. [Google Scholar] [CrossRef]
- Adeoye, A.A.; Jaramillo-Torres, A.; Fox, S.W.; Merrifield, D.L.; Davies, S.J. Supplementation of Formulated Diets for Tilapia (Oreochromis niloticus) with Selected Exogenous Enzymes: Overall Performance and Effects on Intestinal Histology and Microbiota. Anim. Feed Sci. Technol. 2016, 215, 133–143. [Google Scholar] [CrossRef]
- Midhun, S.J.; Arun, D.; Edatt, L.; Sruthi, M.V.; Thushara, V.V.; Oommen, O.V.; Sameer Kumar, V.B.; Divya, L. Modulation of Digestive Enzymes, GH, IGF-1 and IGF-2 Genes in the Teleost, Tilapia (Oreochromis mossambicus) by Dietary Curcumin. Aquacult. Int. 2016, 24, 1277–1286. [Google Scholar] [CrossRef]
- Jiang, T.-T.; Feng, L.; Liu, Y.; Jiang, W.-D.; Jiang, J.; Li, S.-H.; Tang, L.; Kuang, S.-Y.; Zhou, X.-Q. Effects of Exogenous Xylanase Supplementation in Plant Protein-Enriched Diets on Growth Performance, Intestinal Enzyme Activities and Microflora of Juvenile Jian Carp (Cyprinus carpio var. Jian). Aquacult. Nutr. 2014, 20, 632–645. [Google Scholar] [CrossRef]
- Mohammady, E.Y.; Soaudy, M.R.; Mohamed, A.E.; EL-Erian, M.M.A.; Farag, A.; Badr, A.M.M.; Bassuony, N.I.; Ragaza, J.A.; El-Haroun, E.R.; Hassaan, M.S. Can Dietary Phytogenic Mixture Improve Performance for Growth, Digestive Enzyme Activity, Blood Parameters, and Antioxidant and Related Gene Expressions of Nile Tilapia, Oreochromis niloticus? Anim. Feed Sci. Technol. 2022, 290, 115369. [Google Scholar] [CrossRef]
- Shabana, M.S.; Karthika, M.; Ramasubramanian, V. Effect of Dietary Citrus Sinensis Peel Extract on Growth Performance, Digestive Enzyme Activity, Muscle Biochemical Composition, and Metabolic Enzyme Status of the Freshwater Fish, Catla catla. JoBAZ 2019, 80, 51. [Google Scholar] [CrossRef]
- Ganguly, S.; Prasad, A. Microflora in Fish Digestive Tract Plays Significant Role in Digestion and Metabolism. Rev. Fish Biol. Fish. 2012, 22, 11–16. [Google Scholar] [CrossRef]
- Girard, C.; Fayolle, K.; Kerros, S.; Leriche, F. Flow Cytometric Assessment of the Antimicrobial Properties of an Essential Oil Mixture against Escherichia coli. J. Anim. Feed Sci. 2019, 28, 187–198. [Google Scholar] [CrossRef]
- Han, Y.; Chen, W.; Sun, Z. Antimicrobial Activity and Mechanism of Limonene against Staphylococcus aureus. J. Food Saf. 2021, 41, e12918. [Google Scholar] [CrossRef]
- Han, Y.; Sun, Z.; Chen, W. Antimicrobial Susceptibility and Antibacterial Mechanism of Limonene against Listeria Monocytogenes. Molecules 2019, 25, 33. [Google Scholar] [CrossRef]
- Ngugi, C.C.; Oyoo-Okoth, E.; Muchiri, M. Effects of Dietary Levels of Essential Oil (EO) Extract from Bitter Lemon (Citrus limon) Fruit Peels on Growth, Biochemical, Haemato-immunological Parameters and Disease Resistance in Juvenile Labeo victorianus Fingerlings Challenged with Aeromonas hydrophila. Aquac. Res. 2017, 48, 2253–2265. [Google Scholar] [CrossRef]
- Yousefi, M.; Hoseini, S.M.; Abdel Rahman, A.N.; Vatnikov, Y.A.; Kulikov, E.V.; Kharlitskaya, E.V.; Seleznev, S.B. Effects of Dietary Limonene Supplementation on Growth Performance and Immunological Parameters of Common Carp, Cyprinus carpio, Challenged by Aeromonas hydrophila. Animals 2023, 13, 3197. [Google Scholar] [CrossRef] [PubMed]
- Khorshidi, Z.; Sarvi Moghanlou, K.; Imani, A.; Behrouzi, S. The Interactive Effect of Dietary Curcumin and Silver Nanoparticles on Gut Microbiota of Common Carp (Cyprinus carpio). Iran J. Sci. Technol. Trans. Sci. 2018, 42, 379–387. [Google Scholar] [CrossRef]
- Yonar, M.E.; Mişe Yonar, S.; İspir, Ü.; Ural, M.Ş. Effects of Curcumin on Haematological Values, Immunity, Antioxidant Status and Resistance of Rainbow Trout (Oncorhynchus mykiss) against Aeromonas salmonicida subsp. achromogenes. Fish Shellfish Immunol. 2019, 89, 83–90. [Google Scholar] [CrossRef]
- Mohamed, A.A.-R.; El-Houseiny, W.; EL-Murr, A.E.; Ebraheim, L.L.M.; Ahmed, A.I.; El-Hakim, Y.M.A. Effect of Hexavalent Chromium Exposure on the Liver and Kidney Tissues Related to the Expression of CYP450 and GST Genes of Oreochromis niloticus Fish: Role of Curcumin Supplemented Diet. Ecotoxicol. Environ. Saf. 2020, 188, 109890. [Google Scholar] [CrossRef]
- Cuzzocrea, S.; Reiter, R.J. Pharmacological Action of Melatonin in Shock, Inflammation and Ischemia/Reperfusion Injury. Eur. J. Pharmacol. 2001, 426, 1–10. [Google Scholar] [CrossRef]
- Yang, J.; Hong, J.; Fu, Z.; Ma, Z. Effects of Dietary Curcumin on Growth and Digestive Physiology of Seriola dumerili. Front. Mar. Sci. 2022, 9, 862379. [Google Scholar] [CrossRef]
- Yu, H.; Deng, W.; Zhang, D.; Gao, Y.; Yang, Z.; Shi, X.; Sun, J.; Zhou, J.; Ji, H. Antioxidant Defenses of Onychostoma macrolepis in Response to Thermal Stress: Insight from MRNA Expression and Activity of Superoxide Dismutase and Catalase. Fish Shellfish Immunol. 2017, 66, 50–61. [Google Scholar] [CrossRef]
- Abdel-Ghany, H.M.; El-Sisy, D.M.; Salem, M.E.-S. A Comparative Study of Effects of Curcumin and Its Nanoparticles on the Growth, Immunity and Heat Stress Resistance of Nile Tilapia (Oreochromis niloticus). Sci. Rep. 2023, 13, 2523. [Google Scholar] [CrossRef]
- Omasaki, S.K.; Janssen, K.; Besson, M.; Komen, H. Economic Values of Growth Rate, Feed Intake, Feed Conversion Ratio, Mortality and Uniformity for Nile Tilapia. Aquaculture 2017, 481, 124–132. [Google Scholar] [CrossRef]


| Ingredient | Control | PAM |
|---|---|---|
| Fishmeal (54% crude protein) | 30.00 | 30.00 |
| PBM 1 (54% crude protein) | 75.00 | 75.00 |
| SBM 2 (54.6% crude protein) | 425.00 | 425.00 |
| Wheat bran | 287.00 | 287.00 |
| Rice bran | 115.00 | 115.00 |
| Corn | 51.15 | 50.65 |
| Soybean oil | 6.00 | 6.00 |
| Monocalcium phosphate | 4.00 | 4.00 |
| Sodium bicarbonate | 1.00 | 1.00 |
| Calcium carbonate | 1.00 | 1.00 |
| Vitamin and mineral premix 3 | 2.00 | 2.00 |
| Vitamin C | 0.50 | 0.50 |
| Methionine | 0.50 | 0.50 |
| Lysine | 0.50 | 0.50 |
| Anti-toxin (Unic Plus) | 1.00 | 1.00 |
| Emulsifier | 0.25 | 0.25 |
| Phytase enzyme | 0.10 | 0.10 |
| Phyto AquaMeric (PAM) | 0.00 | 0.50 |
| Total | 1000 | 1000 |
| Proximate composition (% as fed) | ||
| Moisture | 7.80 | 7.58 |
| Crude protein | 30.50 | 30.10 |
| Crude lipid | 5.60 | 6.10 |
| Ash | 8.40 | 8.2 |
| Crude fiber | 4.00 | 4.55 |
| NFE 4 | 43.70 | 43.47 |
| Gross energy (MJ kg−1) 5 | 17.10 | 17.17 |
| Gene | Forward Sequence (5′->3′) | Accession No. |
|---|---|---|
| IL-12 | F (5′->3′): GGGTGCGAGTCAGCTATGAG R (5′->3′): GGTTGTGGATTGGTTGCGTC | XM_003437924.4 |
| IL-1β | F (5′->3′): GACACTGCTTCTGAACTACAAGT R (5′->3′): TCAGCACTGGCTCTGAAGTG | XM_019365844.2 |
| TNF-α | F (5′->3′): GCAGCTGAATGAACCTCTCAC R (5′->3′): GTTCTCAGTCTGTCCCCAGC | XM_019365844.2 |
| TGF-β | F (5′->3′): GTCCTGCAAGTGCAGCTAGA R (5′->3′): CATGCCTGTGTGAAACGACTG | XM_005463992.4 |
| IFN-γ | F (5′->3′): GGGTGGTGTTTTGGAGTCGT R (5′->3′): CATCTGTGCCTGGTAGCGAG | XM_013266976.3 |
| IL-4 | F (5′->3′): CAGCGAGAGAGAACTCGTGC R (5′->3′): GGTTTCCTTCTCCGTCGTGT | NM_214123.1 |
| IGM-2 | F: (5′->3′): CCACTTCAACTGCACCCACT | XM_005463992.4 |
| R (5′->3′): TGGTCCACGAGAAAGTCACC | ||
| β-actin | F: TCAGGGTGTGATGGTGGGTATG | EU887951.1 |
| R: CTCAGCTCGTTGTAGAAGGTGT |
| Parameters | Control | PAM |
|---|---|---|
| Initial weight (g fish−1) | 74.86 ± 2.19 a | 73.84 ± 1.27 a |
| Final weight (g fish−1) | 186.10 ± 3.96 a | 186.32 ± 3.12 a |
| Weight gain (g fish−1) | 111.24 ± 3.27 a | 112.48 ± 3.19 a |
| SGR (% day−1) | 1.15 ± 0.02 a | 1.16 ± 0.03 a |
| Feed intake (g) | 161.76 ± 3.51 a | 146.78 ± 3.94 b |
| FCR | 1.46 ± 0.03 a | 1.31 ± 0.06 b |
| PER | 2.25 ± 0.05 a | 2.48 ± 0.03 b |
| Parameters | Control | PAM |
|---|---|---|
| RBC count (106 mL−1) | 2.27 ± 0.08 a | 2.63 ± 0.16 b |
| WBC count (103 mL−1) | 177.52 ± 10.00 a | 195.37 ± 7.79 a |
| Hb (g dL−1) | 11.50 ± 0.62 a | 12.87 ± 0.49 b |
| MCH (pg·cell −1) | 50.63 ± 1.01 a | 48.90 ± 1.49 a |
| MCV (µm3) | 146.60 ± 5.73 a | 143.60 ± 1.82 a |
| Parameters | Control | PAM |
|---|---|---|
| PA (µM mL−1) | 1.22 ± 0.04 a | 1.65 ± 0.05 b |
| PO (mU mL−1) | 98.63 ± 2.13 a | 108.0 ± 2.98 b |
| ACH50 (ng mL−1) | 44.16 ± 2.62 a | 53.90 ± 0.27 b |
| LSZ (ng mL−1) | 82.57 ± 0.55 a | 92.01 ± 3.04 b |
| SOD (mU mL−1) | 29.93 ± 2.06 a | 39.17 ± 3.54 b |
| MDA (mU mL−1) | 23.41 ± 2.51 a | 15.02 ± 2.33 b |
| GPx (mU mL−1) | 3.47 ± 0.12 a | 3.67 ± 0.14 a |
| Parameters | Control | PAM |
|---|---|---|
| LDH (U L−1) | 135.48 ± 4.52 a | 126.21 ± 2.18 b |
| AST (U L−1) | 16.67 ± 2.08 a | 12.67 ± 2.08 b |
| ALT (U L−1) | 10.67 ± 1.15 a | 8.67 ± 1.52 a |
| Parameter | Control | PAM |
|---|---|---|
| Anterior gut | ||
| Length of intestinal folds (µm) | 133.17 ± 9.75 a | 212.58 ± 3.74 b |
| Width of intestinal folds (µm) | 74.26 ± 5.18 a | 67.11 ± 7.67 b |
| Interfold space (µm) | 80.40 ± 1.36 a | 48.32 ± 2.35 b |
| Goblet cells number mm−2 | 51.99 ± 3.50 a | 80.04 ± 1.72 b |
| Midgut | ||
| Length of intestinal folds (µm) | 155.40 ± 13.12 a | 341.30 ± 32.36 b |
| Width of intestinal folds (µm) | 55.00 ± 6.50 a | 48.23 ± 8.82 b |
| Inter fold space (µm) | 61.00 ± 5.74 a | 45.72 ± 4.22 b |
| Goblet cells number mm−2 | 77.62 ± 6.20 a | 159.19 ± 10.33 b |
| Posterior gut | ||
| Length of intestinal folds (µm) | 80.60 ± 5.76 a | 165.59 ± 15.53 b |
| Width of intestinal folds (µm) | 112.33 ± 4.18 a | 54.07 ± 4.18 b |
| Inter fold space (µm) | 125.99 ± 24.61 a | 60.84 ± 5.54 b |
| Goblet cells number mm−2 | 28.27 ± 2.31 a | 82.40 ± 5.59 b |
| Genes | Control | PAM |
|---|---|---|
| IFN-γ (pg mL−1) | 128.23 ± 1.16 a | 137.60 ± 0.69 b |
| TNF-α (copies mL−1) | 338.47 ± 1.92 a | 350.57 ± 1.34 b |
| TGF-β (pg mL−1) | 65.60 ± 1.14 a | 71.97 ± 1.60 b |
| IL-1β (copies mL−1) | 563.57 ± 1.32 a | 585.1 ± 1.51 b |
| IL-4 (copies mL−1) | 81.33 ± 1.52 a | 118.33 ± 4.04 b |
| IL-12 (copies mL−1) | 244.33 ± 1.15 a | 299.33 ± 2.51 b |
| IGM (µg mL−1) | 120.80 ± 0.55 a | 159.17 ± 1.37 b |
| Count | Control | PAM |
|---|---|---|
| Total bacterial counts | 142.66 ± 5.37 a | 201.33 ± 5.61 b |
| Beneficial bacteria | 44.33 ± 2.34 a | 151.00 ± 3.22 b |
| Pathogenic bacteria | 98.33 ± 4.42 a | 50.33 ± 3.18 b |
| Eutrophication Potential (EP in eq kg PO4)/Semi-Intensive System | ||
|---|---|---|
| Parameters | Control | PAM |
| Semi-intensive production | 6.3 | 6.3 |
| EP of each product (wheat vs. PAM) | 1.8 × 10−4 | 4 × 10−3 |
| FCR | 1.46 | 1.31 |
| EP for each production system | 9.19 | 8.24 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
El-Sayed, A.-F.M.; Fagnon, M.S.; Hamdan, A.M.; Chabrillat, T.; Araujo, C.; Bouriquet, J.; Kerros, S.; Zeid, S.M.S. Dietary Effect of a Plant-Based Mixture (Phyto AquaMeric) on Growth Performance, Biochemical Analysis, Intestinal Histology, Gene Expression and Environmental Parameters of Nile Tilapia (Oreochromis niloticus). Fishes 2024, 9, 358. https://doi.org/10.3390/fishes9090358
El-Sayed A-FM, Fagnon MS, Hamdan AM, Chabrillat T, Araujo C, Bouriquet J, Kerros S, Zeid SMS. Dietary Effect of a Plant-Based Mixture (Phyto AquaMeric) on Growth Performance, Biochemical Analysis, Intestinal Histology, Gene Expression and Environmental Parameters of Nile Tilapia (Oreochromis niloticus). Fishes. 2024; 9(9):358. https://doi.org/10.3390/fishes9090358
Chicago/Turabian StyleEl-Sayed, Abdel-Fattah M., Mahougnon Simeon Fagnon, Amira M. Hamdan, Thibaut Chabrillat, Coralie Araujo, Julie Bouriquet, Sylvain Kerros, and Salma M. S. Zeid. 2024. "Dietary Effect of a Plant-Based Mixture (Phyto AquaMeric) on Growth Performance, Biochemical Analysis, Intestinal Histology, Gene Expression and Environmental Parameters of Nile Tilapia (Oreochromis niloticus)" Fishes 9, no. 9: 358. https://doi.org/10.3390/fishes9090358
APA StyleEl-Sayed, A.-F. M., Fagnon, M. S., Hamdan, A. M., Chabrillat, T., Araujo, C., Bouriquet, J., Kerros, S., & Zeid, S. M. S. (2024). Dietary Effect of a Plant-Based Mixture (Phyto AquaMeric) on Growth Performance, Biochemical Analysis, Intestinal Histology, Gene Expression and Environmental Parameters of Nile Tilapia (Oreochromis niloticus). Fishes, 9(9), 358. https://doi.org/10.3390/fishes9090358

