Next Article in Journal
Transforming China’s Fisheries: A 40-Year Journey toward Sustainable Management (1980–2019)
Previous Article in Journal
Apparent Digestibility Coefficients of Nutrients and Energy from Animal-Origin Proteins for Macrobrachium rosenbergii Juveniles
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fishes
Volume 9
Issue 9
10.3390/fishes9090342
fishes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Investigating Polystyrene Nano-Plastic Effects on Largemouth Bass (Micropterus salmoides) Focusing on mRNA Expression: Endoplasmic Reticulum Stress and Lipid Metabolism Dynamics

by
Kaipeng Zhang
†,
Jing Chen
†,
Yamin Wang
,
Mingshi Chen
,
Xiaoxue Bao
,
Xiaotong Chen
,
Shan Xie
,
Zhenye Lin
and
Yingying Yu
*
Guangdong Provincial Key Laboratory of Animal Molecular Design and Precise Breeding, School of Life Science and Engineering, Foshan University, Foshan 528225, China
*
Author to whom correspondence should be addressed.
†
These two authors contributed equally to this work.
Fishes 2024, 9(9), 342; https://doi.org/10.3390/fishes9090342
Submission received: 29 July 2024 / Revised: 24 August 2024 / Accepted: 28 August 2024 / Published: 30 August 2024
Browse Figures
Versions Notes

Abstract

Nano-plastics (NPs) have emerged as a pervasive global contaminant, posing significant threats to carnivorous fish, in recent years. The accumulation of polystyrene nano-plastics (PS-NPs) can cause endoplasmic reticulum (ER) stress. However, the concurrent impacts of PS-NPs on lipid metabolism and ER stress in largemouth bass have not been sufficiently investigated. To study this gap, we established a largemouth bass model exposed to PS-NPs in a culture environment. The exposure experiment focused on 100 μg/L PS-NPs (100 nm). Transcriptomics analysis revealed a significant enrichment of differentially expressed genes involved in a lipid metabolism pathway and ER process. The levels of biochemical parameters associated with lipid metabolism, including high-density lipoprotein cholesterol, total cholesterol, triglyceride, and low-density lipoprotein cholesterol, demonstrated that exposure to PS-NPs for nineteen days had an impact on lipid metabolism. Additionally, the expression levels of genes associated with fatty acid biosynthesis and ER stress exhibited a significant increase following exposure to PS-NPs for nineteen days, whereas these changes were not significant after a seven-day exposure period. The ER stress induced by PS-NPs exhibited a positive correlation with lipid metabolism disorder and the magnitude of damage caused by prolonged exposure to PS-NPs in largemouth bass. The present study provides novel insights into the health threats encountered by largemouth bass when exposed to NPs.
Keywords:
polystyrene nano-plastics; largemouth bass; lipid metabolism; endoplasmic reticulum (ER) stress
Key Contribution: Polystyrene nano-plastics (PS-NPs) disrupted lipid metabolism and endoplasmic reticulum (ER) stress in largemouth bass. The extent of damage caused by PS-NPs was amplified with prolonged exposure duration.

Graphical Abstract

1. Introduction

Revered for their exceptional ductility and cost-effectiveness, plastics have found extensive applications across various domains [1,2]. Due to the wide range of plastic applications, its slow biodegradation rate [3], and inadequate recycling practices [4], plastic continues to accumulate in various environments [5], such as soil, rivers, and oceans [6]. The plastic undergoes biodegradation and mechanical degradation, resulting in the formation of microplastics (<5 mm) [7,8], which subsequently degrade into smaller NPs (<1 μm) [9]. The concentration of NPs in Swedish lakes and rivers has reached 563 μg/L, and polystyrene is emerging as one of the predominant constituents [10]. NPs could be present in fish through the food chain and then transfer to the human body and accumulate [11]. NPs are readily ingested by aquatic animals and accumulate in their bodies. The NPs with a size of 70 nm can accumulate in zebrafish livers, leading to the induction of inflammation, oxidative stress, and the perturbation of lipid metabolism [12]. Chen et al. observed significant damage to the gills, livers, and intestines of largemouth bass caused by NPs of 100 nm [13]. The NPs accumulate in the liver tissues of goldfish [14]. The hepatic levels of antioxidant enzymes, including superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GPx), exhibited a significant increase following a fourteen-day exposure to the NPs and reversible lipid peroxidation [15]. Li et al.’s study showed that NPs can aggravate apoptosis by inducing ER stress pathways [16].
The NPs preferentially accumulate in the liver, making it their target organ [17,18]. The study has pointed out that vast lipid droplets appeared in the liver tissue of zebrafish after seven days of exposure to NPs [12]. NPs can inhibit lipolysis, which leads to liver lipid deposition by inhibiting the AMPK-PPARα signaling pathway in large croaker [19]. The triglyceride (TG) content in the livers and pancreases of juvenile grass carp significantly increases after exposure to NPs [20]. According to the report, the livers exposed to NPs may show swelling of the hepatocyte nucleus [21].
NPs can cause not only lipid metabolism disorder but also ER stress. Cholesterol and lipids are synthesized in the ER, which is essential for synthesis and the proper folding of proteins [22]. Certain liver diseases associated with lipid metabolism can disrupt protein folding in the ER, such as non-alcoholic fatty liver disease [23]. ER stress is a temporary process to repair ER homeostasis. When misfolded and unfolded proteins accumulate, the body will activate the ER stress process to restore ER homeostasis, which is often associated with metabolic disorders, apoptosis, inflammation, and insulin resistance [24,25]. However, the relationship between ER stress and lipid metabolism disorder induced by NPs remains unclear.
Largemouth bass, a prominent species in global aquaculture, possesses substantial commercial value owing to its rapid growth rate, delectable flavor profile, and the absence of intermuscular bones. However, in culture, abnormal lipid deposition greatly affects growth performance and liver health. Given the potential impact of NPs on lipid metabolism, investigating their influence on the physiological metabolism of largemouth bass within cultured environments is imperative.
NPs have been detected in carnivorous freshwater fish, including largemouth bass [26], and previous studies have confirmed that largemouth bass can suffer severe damage from NPs at concentrations of up to 100 μg/L in water [13]. Therefore, the objective of this study was to investigate the impact of 100 μg/L PS-NPs on hepatic lipid metabolism and ER stress in largemouth bass.

2. Materials and Methods

All experiments conducted in this study received approval from the Foshan University Animal Ethics Committee (Approval number: 2020056) and were executed in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals of China.

2.1. PS-NP Preparation and Characterization

The monodisperse green fluorescent PS-NPs (excitation: 488 nm, emission: 518 nm) were bought from Da’E Scientific Co., Ltd. (Tianjin, China). The PS-NPs were stored in deionized water (10 mg/mL, 18,198 × 109 particles/mL). The PS-NPs showed a spherical shape and homogeneous size distribution in a study, and their particle size was 100 nm [27,28]. The particle size distribution and zeta potential of the PS suspension were verified using Zetasizer Nano ZS (Malvern Instruments Ltd., Worcestershire, UK) (Table S1).

2.2. Experimental Procedure

Largemouth bass were procured from Foshan Sanshui Baijin Aquatic Seedling Co., Ltd. (Foshan, China). Largemouth bass were cultured for two weeks under a commercial diet and experimental conditions to acclimatize to the environment. A total of 150 healthy fish with similar sizes (initial weight: 14.56 ± 0.09 g) were stochastically distributed into six circulating water buckets with a volume of 70L per bucket in triplicate (25 fish per bucket). Following acclimatization, commercial feed was administered twice daily (8:00 and 17:00) for nineteen days. A preliminary experiment was conducted prior to the main experiment, in which the largemouth bass were fed with aquaculture water containing 100 μg/L PS-NPs. Previous studies have shown that PS-NPs can be detected in the liver of largemouth bass after seven days of incubation in water containing 100 μg/L PS-NPs [13]. Consequently, samples were collected on the seventh day and the nineteenth day, respectively. The study was divided into two groups: a control group (without PS-NPs) and a PS-NP group (100 μg/L). Daily, two-thirds of the water in each bucket was replaced with PS-NP-contaminated water. Throughout the experimental period, water temperature, pH, dissolved oxygen, and NH4-N were kept at 24 ± 1 °C, 7.5–8.5, >7.0 mg/L, and NH4-N (<0.3 mg/L), respectively. Aeration was provided to buckets throughout the day [13].

2.3. Sample Collection

The experiment involved the collection of two samples on the seventh day and the nineteenth day, and largemouth bass were fasted for 24 h, followed by anesthesia with MS-222, weighing, and sampling. Eleven largemouth bass were stochastically selected per barrel, and blood samples of largemouth bass were sampled from the tail vein using a 1 mL injection syringe. The collected blood was left to rest at 4 °C and allowed to stand for 24 h, then ultracentrifuged (10020, Sigma Laborzentrifugen Gmbh, Osterode am Harz, Germany) (4000 r/min) for ten minutes to collect serum. The serum was immediately placed at −80 °C for subsequent biochemical experiments. The hepatic samples from seven fish in each barrel were collected and placed in 1.5 mL RNase-free tubes and immediately submerged in liquid nitrogen before being frozen at −80 °C. Three of these samples were designated for liver transcriptome analysis, while the remaining four were allocated for qPCR analysis. Additionally, three fish per barrel were stochastically selected for hepatic histological analysis.

2.4. Histopathological Analysis

Liver samples from 3 randomly selected largemouth bass were placed in 10% paraformaldehyde tissue fixative solution at room temperature for 24 h. Tissue sample preparation including cutting, dehydration, and paraffin embedding was performed. The paraffin blocks were sectioned into slices with a thickness of 5 μm and hematoxylin and eosin (H&E) staining. Sections were observed with a microscope camera DS-Ri2 (Nikon, Japan).

2.5. Hematological Parameters Analysis

Serum was used to measure hematological parameters, including plasma high-density lipoprotein cholesterol (HDL-C), plasma total cholesterol (T-CHO), TG, and low-density lipoprotein cholesterol (LDL-C) using assay kits (Nanjing jiancheng Co., Nanjing, China) according to the instruction book given by the provider.

2.6. RNA-seq Analysis

Three frozen liver samples from each barrel (control groups on the seventh day, PS-NP groups on the seventh day, control groups on the nineteenth day, and PS-NP groups on the nineteenth day with three biological replicates) were used for transcriptomics analysis by Genedenovo Biotechnology Co., Ltd. (Guangzhou, China).

2.7. Quantitative Real-Time PCR

Total RNA was extracted from the livers of largemouth bass with an RNA preparation kit (TransGen, ER501, TransGen Biotech Co., Ltd., Beijin, China). Briefly, 50 to 100 mg of samples were added to Tranzol Up and RNA Extraction Agent, followed by homogenization. Subsequently, CB9 and WB9 were sequentially added, and centrifugation was performed according to the provided instructions in order to obtain RNA samples. The purity, integrity, and quantity of total RNA were tested with agarose gel (1.0%) electrophoresis and the OD260/280 value. Then, the cDNA was synthesized using a cDNA synthesis kit (TransGen, AE311, TransGen Biotech Co., Ltd., Beijin, China), following the instruction book by QuantStudio5. All reactions were performed in a 20 μL reaction volume. The test was performed three times with SYBP Green Master Mix (Yeasen, 11184ES03, Yeasen Biotechnology Co., Ltd., Shanghai, China) to perform the expression of selected mRNAs in an Applied Biosystems QuantStudioTM Real-Time PCR system (QuantStudio5, Thermo Fisher Scientific, Waltham, MA, USA). β-actin was used as the housekeeping gene. Primers of target genes for RT-qPCR were designed according to nucleotide sequences of largemouth bass (Table 1). The qPCR procedure was set as follows: 95 °C for 2 min, 45 cycles of 95 °C for 10 s, and 60 °C for 30 s. The expression of genes was counted and standardized using the 2−ΔΔCT methods [29].

2.8. Calculation and Statistical Analysis

Statistical analysis was conducted for all data statistically on SPSS 26.0 (IBM, Armonk, NY, USA). All data were analyzed with t-test analysis. Results with p < 0.05 indicate a statistically significant difference, data were rendered as the mean ± standard error of the mean (SEM), and bar graphs were drawn using GraphPad Prism 9.3.1 (GraphPad Software, Inc., San Diego, CA, USA). Pearson correlation analysis of the results on gene expression levels was performed using OriginPro 2021.

3. Results

3.1. Effects of PS-NP Exposure on Liver Histopathology

Hepatic histopathologic changes were observed with H&E staining under a light microscope. After seven days of exposure, the PS-NP groups (Figure 1B) exhibited hepatocellular injury, characterized by vacuolated nuclei, hemocyte infiltration, and cytoplasmic degeneration. After nineteen days of exposure, the PS-NP groups exhibited hemocyte infiltration, vacuolated nuclei, and hepatocyte hypertrophy (Figure 1D). These findings indicated that PS-NP exposure resulted in liver injury and alterations in liver morphology.

3.2. Effects of PS-NP Exposure on Lipid Metabolism

The serum levels of TG and T-CHO in the PS-NP groups exhibited a significant increase compared to the control groups (p < 0.05). Conversely, HDL-C showed a significant decrease after nineteen days of exposure (p < 0.05) (Figure 2B). However, there were no significant changes observed in plasma concentrations of TG, LDL-C, T-CHO, and HDL-C after seven days of exposure to PS-NPs compared to the control groups (p > 0.05) (Figure 2A).

3.3. Effects of PS-NP Exposure on Hepatic Whole Transcriptome

To assess the mechanisms relevant to the phenotype changes, we utilized hepatic whole-transcriptome analysis to identify variations in mRNA expression levels. PCA revealed that the hepatic mRNA profiles in largemouth bass were affected in both PS-NP groups on the seventh day and the nineteenth day. These results exhibited significant differences, indicating highly altered gene transcription after PS-NP exposure (Figure 3B,G). We counted unique genes in PS-NP groups on the seventh day and the nineteenth day, detecting 270 and 417 genes, respectively (Figure 3A,F). Subsequently, 728 genes significantly increased, and 930 genes significantly decreased after being exposed to PS-NPs for 7 days (Figure 3C,D), whereas 678 genes were highly expressed, and 967 genes significantly decreased after being exposed to PS-NPs for nineteen days (Figure 3H,I). Samples were further distinguished with a heat map (Figure 3E,J). Therefore, PS-NP exposure groups (seven and nineteen days) exhibited significantly differentially expressed genes (DEGs) compared to control groups. Gene Ontology (GO) analysis indicated enriched biological processes, molecular functions, and cellular components in both PS-NP groups. As shown in Figure 4A and Figure S1A, several main biological processes, three molecular functions, and two cellular components including an organic acid metabolic process, small molecule metabolic process, oxoacid metabolic process, carboxylic acid metabolic process, oligosacchary transferase activity, catalytic activity, oxidoreductase activity, membrane-bounded organelle, and endoplasmic reticulum (ER) process were significantly enriched by DEFs after seven days of PS-NP exposure. As indicated in Figure 4B and Figure S2A, several main processes such as the organic substance metabolic process, primary metabolic process, cellular metabolic process, and metabolism process were significantly enriched by DEGs with PS-NP exposure for nineteen days. Furthermore, KEGG pathway analysis demonstrated enriched pathways including carbohydrate metabolism, lipid metabolism, and amino acid metabolism in both PS-NP groups (Figure 5A,B). The metabolism and genetic expression changed significantly including glycerolipid metabolism, metabolism of xenobiotics with cytochrome P450, arginine and proline metabolism, ascorbate and aldarate metabolism, porphyrin metabolism, caffeine metabolism, butanoate metabolism, cysteine and methionine metabolism, and protein processing in ER after PS-NP exposure for seven days (Figure S1B). The metabolism and genetic expression changed significantly, including the P53 signaling pathway, FoxO signaling pathway, autophagy, glutathione metabolism, HIF-1 signaling pathway, longevity regulating pathway, and the ErbB signaling pathway after PS-NP exposure for nineteen days (Figure S2B).

3.4. Effects of PS-NP Exposure on the Expression Levels of ER Stress-Related Genes

PS-NPs can affect ER homeostasis. Revealing their influence on ER function was accomplished through transcriptome analysis. The expression levels of ER stress marker genes were assessed. Figure 6A,B showed alterations in the expression levels of ER stress-related genes in M. salmoides livers following PS-NP exposure for seven and nineteen days, respectively. The PS-NP exposure significantly increased the mRNA levels of grp78, eif2a, chopα, and jnk-1 on the seventh day compared to the control groups on the seventh day (p < 0.05). With prolonged exposure, compared to control groups on the nineteenth day, ER stress-related gene levels showed more significant changes. The mRNA levels of chopβ, perk, grp78, eif2a, jnk1, chopα, ire-1, and xbp-1 were increased after being exposed to PS-NPs for nineteen days.

3.5. Effects of PS-NP Exposure on Expression of Lipid Metabolism-Related Gene

To investigate the potential impact of PS-NP-induced ER stress on hepatic lipid metabolism, expression levels of lipid metabolism-related genes were examined in this study (Figure 7A,B). After nineteen days of PS-NP exposure, mRNA expressions of srebf-2, srebp-1, and fasn were significantly upregulated compared to the control groups (p < 0.05). Additionally, both acaca and hmgcr genes related to fatty acid synthesis and cholesterol synthesis, respectively, were remarkably upregulated in PS-NP groups after nineteen days (p < 0.05). Similarly, acaca expression increased in the PS-NP groups after seven days compared to the control groups (p < 0.05). On the contrary, the mRNA expression of pparγ was deregulated in PS-NP groups after nineteen days compared to the control groups (p < 0.05).

3.6. Effects of PS-NP Exposure on Expression of Apoptosis-Related Genes

This study measured the expression levels of apoptosis-related genes in the liver. Relative to the control groups, PS-NP exposure significantly increased the mRNA expression of bax, caspase3, caspase8, and caspase9 after nineteen days (p < 0.05) (Figure 8B). However, there were no significant changes in mRNA expression in the PS-NP groups after seven days compared to the control groups (p > 0.05) (Figure 8A).

3.7. Correlation between Lipid Metabolism Disorder, ER Stress, and Apoptosis Induced by PS-Np Exposure

After seven days of PS-NP exposure, ire1, xbp1, and eif2α mRNA expression showed a significant positive correlation. In contrast, the expression levels of ER stress-related genes (chop α, chop β, jnk1, atf4, and atf6) exhibited a negative correlation with apoptosis-related genes (caspase3, caspase8, caspase9, and bax). Similarly, the expression levels of genes associated with lipid metabolism (srebp1, srebf2, acaca, and cpt1) showed a negative correlation with apoptosis-related genes (caspase3, caspase8, caspase9, and bax) (Figure 9A). Furthermore, the expression levels of ER stress-related genes (chopα, chopβ, jnk-1, grp78, perk, atf4, ire-1, xbp-1, atf6, and eif2α), lipid metabolism-related genes (srebp-1, acaca, cpt-1, fasn, hmgcr, ppar-γ, and srebf-2), and apoptosis-related genes (foxo, caspase-3, caspase-8, caspase-9, and bax) exhibited strong correlations when largemouth bass were exposed to aquaculture water containing NPs for nineteen days (Figure 9B).

4. Discussion

As a nano environmental pollutant, which poses more enduring and severe hazards compared to plastics, NPs can permeate cell membranes, causing substantial harm to organisms through excessive accumulation. For instance, the accumulation of PS-NPs in the digestive tract and liver of zebrafish induces oxidative stress and triggers apoptosis [37]. Similarly, NPs infiltrate the gastrointestinal, liver, and intestinal tissue of mice, leading to reduced cell proliferation and increased apoptosis [38]. The PS-NPs could activate signaling pathways such as IRE1/XBP1 and PERK-eIF2α, further aggravating apoptosis and disrupting lipid metabolism [16,39]. Therefore, investigating the impact of NPs on aquatic animals is extremely important for subsequent accurate prevention and control strategies.

4.1. PS-NP-Induced Liver Injury and Dysfunction

NPs often cause histological hepatic alterations in fish, primarily stemming from disturbances of lipid metabolism [39]. In our study, hepatocyte hypertrophy and vacuolization were observed in PS-NP groups, coinciding with increased plasma TG and T-CHO levels after PS-NP exposure for nineteen days. This is attributed to the disruption of lipid metabolism caused by liver damage, resulting in impaired liver function. The confirmation of this was further substantiated through transcriptome analysis, which revealed significant alterations in gene expression related to lipid metabolism. In this study, the lipolysis genes were inhibited, while the lipid synthesis genes were promoted, resulting in the accumulation of lipids in the liver tissue. Similarly, shrimp exposed to NPs exhibited similar results, showcasing substantial lipid droplets in their liver tissue [40]. The accumulation of NPs within the livers of fish induced hepatotoxic effects, including steatohepatitis, which can disrupt the physiological function of the liver [18,41]. In large yellow croaker, NP exposure increased TG content, down-regulated lipid catabolism-related genes (atgl, pparα, aco) expression levels, and disrupted lipid metabolism, thus causing liver histological damage [19]. The findings of the current study are in line with this observation. The previous study also identified the presence of inflammation and lipid accumulation in zebrafish liver tissue following exposure to PS-NPs for a duration of three weeks [12]. In conclusion, our study results support prior findings, affirming the vulnerability of the liver to NPs, leading to inflammation and lipid accumulation post-exposure.

4.2. PS-NPs Disrupt the Protein Synthesis Process of the ER

The hepatic transcriptomics of M. salmoides in response to NPs have not been systematically investigated, and the molecular mechanism has not been clearly elucidated. Some studies have pointed out that NPs can induce alterations in ER processes [42]. The GO analysis showed a significant difference between the control groups and the PS-NP groups. Notably, the ER-related process was one of the most enriched in the PS-NP groups. The ER, responsible for proteins, lipids, and sugar synthesis, was significantly affected by PS-NPs. This disruption resulted in the inhibition of proteins and gene expression in the ER, ultimately impacting protein homeostasis [39]. Similar results were reported for differentially expressed gene (DEG) enrichment in protein processing in the ER in Nile tilapia after fourteen days of NP exposure [39]. This may be due to the deposition of NPs in the ER, which alters the important ultrastructure in the ER, resulting in ER dysfunction and potentially causing damage to the organism [43].
In this study, the PS-NP groups on the nineteenth day exhibited a significant increase in marker genes associated with ER stress, such as chopα, chopβ, grp78, jnk-1, perk, ire1, and xbp-1, compared to control groups on the nineteenth day. This upregulation hindered protein translation and synthesis processes in the ER. Specifically, perk activation led to the phosphorylation of eif2α; at the same time, eif2α activates atf4 and affects amino acid metabolism, thereby inhibiting protein translation and synthesis. ER stress, commonly known as the unfolded protein response, is an adaptive response that regulates the function of the endoplasmic reticulum on demand. Liver ER stress can lead to lipid metabolism disorder [44]. ER stress has been shown to participate in multitudinous biological processes, including lipid metabolism and apoptosis [45]. The activation of ER stress is initiated by three upstream signaling molecules (ire1, perk, and atf6), and when they are activated, an ER-specific unfolded protein response begins [46]. Interestingly, in our study, NPs significantly up-regulated ire1 and perk mRNA expression levels after NP exposure for nineteen days, while atf6 mRNA levels showed no significant change. At the same time, the expression of grp78, xbp1, eif2α, atf4, and chop mRNA were significantly up-regulated after NP exposure, suggesting the activation of the PERK-eIF2α pathway and IRE1-XBP1 pathway. When protein folding in the ER is dysregulated, IRE1 is activated and subsequently cleaved to encode the transcription factor XBP1, inducing participation in the unfolded protein response. Kinase PERK activation also initiates an unfolded protein response (UPR), where eIF2α phosphorylation results in increased expression of ATF4 and its downstream target molecule CHOP [47]. Unlike this study, in tilapia, NPs induced the activation of the PERK-eIF2α pathway, while no statistical difference was observed in the expression levels of key genes in the other two ER stress-related pathways [39]. Conversely, the intraperitoneal injection of NPs in mice activated the IRE1-XBP1 pathway [16]. This difference may be due to differences in NP size, concentration, and exposure time or animal species. This speculative association was also partially confirmed in our study. For example, the IRE1/XBP1 pathway was not activated in largemouth bass after being exposed to PS-NPs for seven days, and apoptosis-related genes did not significantly change. This suggests a close relationship between the activation of the IRE1-XBP1 pathway and the exposure time of NPs, indicating a potential link between apoptosis caused by PS-NPs and the IRE1-XBP1 pathway.

4.3. PS-NPs Disrupt Lipid Metabolism

In this study, the Kyoto Encyclopedia of Genes and Genome (KEGG) enrichment analysis indicated that the DEGs enriched intensively in the nutrient metabolism process, emphasizing a close relationship between nutrient metabolism levels and PS-NP exposure. The perception of nutrient excess can disrupt mitochondrial homeostasis and thereby trigger steatosis [48]. This conclusion was further verified by the alterations in the expression levels of genes related to lipid synthesis and lipolysis. The dysregulation of genes involved in lipid metabolism (including srebp-1, acaca, fasn, hmgcr, and srebf-2), which encode crucial enzymes in fatty acid synthesis, resulted in increased expression of apoptosis-related genes (such as foxo, caspase-3, caspase-8, caspase-9, and bax). These findings suggested that PS-NPs possess the potential to disrupt hepatic fatty acid metabolism in largemouth bass, potentially by upregulating genes associated with lipogensis and inhibiting genes associated with lipolysis. Similar results were obtained in pacific whiteleg shrimp, where the expression levels of fas and srebp were highest in PS-NP exposure at a concentration of 100 μg/L [40]. In the Nile tilapia PS-NP exposure experiment with 80 nm PS-NPs for fourteen days, significant changes in gene expression levels related to lipid metabolism (hmgcr, ldlrb, and cyp7a1) were observed [49]. The induction of lipid metabolism disorder by PS-NPs in our study required a longer duration (nineteen days), potentially attributed to the larger size of the NPs (100 nm) compared to the 80 nm PS-NPs and the lower exposure concentration (100 μg/L) relative to 1 mg/L in the Nile tilapia experiment.
Liver damage can disrupt lipid metabolism. The T-CHO, TG, HDL-C, and LDL-C in the serum are strongly correlated with body fat levels [50]. The results of this experiment demonstrate this, as the TG and T-CHO content significantly increased, while the HDL-C content significantly decreased in the serum of largemouth bass after PS-NP exposure for nineteen days compared to control groups on the nineteenth day. High-density lipoprotein (HDL) typically transports cholesterol from the blood to the liver, reducing blood cholesterol levels, while low-density lipoprotein (LDL) transports cholesterol from the liver into the blood, elevating blood cholesterol levels. Our result clearly indicates that the amount of cholesterol transported from the liver to the blood has increased. Similar results were reported in large yellow croaker [19]. Furthermore, in the PS-NP exposure experiment of Pacific whiteleg shrimp, the concentration of T-CHO and TG increased with the increase in the concentration of PS-NPs [40]. The damages of PS-NP exposure on liver lipid metabolism were more serious with the increase of exposure time in this study.
In addition to its implication in lipid metabolism and the development of non-alcoholic fatty liver disease, srebp-1 is intricately associated with ER stress [51]. De novo lipid synthesis is regulated by SREBP1 and SREBF2 in the ER. ER stress, a phenomenon implicated in multitudinous biological processes, including lipid metabolism and apoptosis [45], significantly influences lipid synthesis in hepatocytes. The ER serves as the primary site for lipid synthesis in hepatocytes, and disruptions in its function can result in disorders of lipid metabolism [44]. In particular, the IRE1-XBP1 signaling pathway regulates the secretion of LDL and lipid production [52]. The loss of XBP1 in the liver leads to a decrease in the amount of de novo lipid and a decrease in plasma TG and T-CHO concentrations [53]. Our findings align with this pattern, reinforcing the pivotal role of IRE1-XBP1 in lipid homeostasis.
This experiment confirms the above conclusions; with PS-NP exposure for nineteen days, largemouth bass exhibited activated ER stress, thus disrupting the expression of genes associated with lipid metabolism (srebp-1, acaca, fasn, hmgcr, ppar-γ, and srebf). This disturbance resulted in a disorder in liver metabolism.

4.4. Interactions among Lipid Metabolism Disorder, ER Stress, and Apoptosis Induced by PS-Np Exposure

The ER plays a crucial role in protein folding, glycolipid synthesis, and transport. When affected by external adverse factors, excessive accumulation of misfolded or unfolded proteins in the ER could trigger ER stress. Consequently, the activation of the UPR ensues, thereby governing the metabolic processes of glucose and lipids in hepatocytes [54]. In our study, the expression levels of ER stress-related genes did not show a strong correlation with the expression levels of lipid metabolism-related genes after largemouth bass were exposed to aquaculture water containing PS-NPs for seven days. However, the expression levels of ER stress-related genes and lipid metabolism-related genes were negatively correlated with the expression levels of apoptosis-related genes. This indicates that largemouth bass maintain normal ER function and lipid metabolism, preserving body homeostasis against adverse external environments after PS-NP exposure for seven days. However, after nineteen days of PS-NP exposure, ER stress and lipid metabolism failed to resist. Disturbed lipid metabolism led to unstable synthesis and decomposition of fatty acids, resulting in lipid droplets produced by free fatty acids and the ER structure destroyed, leading to ER stress [55]. Hence, a strong positive correlation was observed between ER stress, lipid metabolism, and apoptosis. Additionally, when the body balance is broken, activated IRE1 can inhibit the M2 polarization of macrophages in adipose tissue, resulting in lipid metabolism disorders, inflammation, and apoptosis [56].

5. Conclusions

Above, we investigated the impact of exposure to PS-NPs for seven and nineteen days on liver histology, biochemical parameters associated with lipid metabolism, and gene expression associated with ER stress and lipid metabolism in largemouth bass. Our results confirmed that the disruption of lipid metabolism by PS-NPs is linked to the induction of the ER stress response, and the disturbance increased with exposure time. Our study contributes to the broader understanding of the molecular mechanism underlying liver toxicity induced by PS-NPs in largemouth bass and provides a new perspective for the aquatic study of PS-NPs. These results highlight the importance of prioritizing attention to NP pollution in water and emphasize the need to mitigate the harmful effects of NPs on the survival of carnivorous fish. Efforts should be directed towards reducing the impact of NPs on aquatic ecosystems to safeguard the well-being of these organisms.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/fishes9090342/s1, Figure S1: GO and KEGG analysis of differential expression genes (DEGs) for the liver of largemouth bass after seven days of exposure to PS-NPs; Figure S2: GO and KEGG analysis of differential expression genes (DEGs) for the liver of largemouth bass after nineteen days of exposure to PS-NPs.; Table S1: Physical characteristics of PS nano-plastic.

Author Contributions

Conceptualization, M.C.; methodology, K.Z. and M.C.; validation, J.C. and Y.W.; formal analysis, J.C., S.X. and Y.W.; investigation, X.B.; resources, M.C.; data curation, X.C. and Z.L.; writing—original draft preparation, K.Z.; supervision, Y.Y.; project administration, Y.Y.; funding acquisition, Y.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China, grant number 32202911, the Guangdong Provincial Key Laboratory of Animal Molecular Design and Precise Breeding, grant number 2019B030301010, the Guangdong Basic and Applied Basic Research Foundation, grant number 2019A1515110068, and the Key-Area Research and Development Program of Guangdong Province, grant number 2019B110209005.

Institutional Review Board Statement

All experiments conducted in this study received approval from the Foshan University Animal Ethics Committee (Approval number: 2020056) and were executed in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals of China.

Informed Consent Statement

The study did not involve humans.

Data Availability Statement

The data underlying this article will be shared on reasonable request to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. da Costa, J.P.; Santos, P.S.M.; Duarte, A.C.; Rocha-Santos, T. (Nano)plastics in the environment—Sources, fates and effects. Sci. Total Environ. 2016, 566–567, 15–26. [Google Scholar] [CrossRef] [PubMed]
  2. Tuuri, E.M.; Leterme, S.C. How plastic debris and associated chemicals impact the marine food web: A review. Environ. Pollut. 2023, 321, 121156. [Google Scholar] [CrossRef] [PubMed]
  3. Liao, J.; Chen, Q. Biodegradable plastics in the air and soil environment: Low degradation rate and high microplastics formation. J. Hazard. Mater. 2021, 418, 126329. [Google Scholar] [CrossRef] [PubMed]
  4. Suzuki, G.; Uchida, N.; Tuyen, L.H.; Tanaka, K.; Matsukami, H.; Kunisue, T.; Takahashi, S.; Viet, P.H.; Kuramochi, H.; Osako, M. Mechanical recycling of plastic waste as a point source of microplastic pollution. Environ. Pollut. 2022, 303, 119114. [Google Scholar] [CrossRef] [PubMed]
  5. MacLeod, M.; Arp, H.P.H.; Tekman, M.B.; Jahnke, A. The global threat from plastic pollution. Science 2021, 373, 61–65. [Google Scholar] [CrossRef] [PubMed]
  6. Abel, S.M.; Wu, F.; Primpke, S.; Gerdts, G.; Brandt, A. Journey to the deep: Plastic pollution in the hadal of deep-sea trenches. Environ. Pollut. 2023, 333, 122078. [Google Scholar] [CrossRef]
  7. Thompson, R.C.; Olsen, Y.; Mitchell, R.P.; Davis, A.; Rowland, S.J.; John, A.W.; McGonigle, D.; Russell, A.E. Lost at sea: Where is all the plastic? Science 2004, 304, 838. [Google Scholar] [CrossRef] [PubMed]
  8. Shen, M.; Zhang, Y.; Zhu, Y.; Song, B.; Zeng, G.; Hu, D.; Wen, X.; Ren, X. Recent advances in toxicological research of nanoplastics in the environment: A review. Environ. Pollut. 2019, 252 Pt A, 511–521. [Google Scholar] [CrossRef] [PubMed]
  9. Dawson, A.L.; Kawaguchi, S.; King, C.K.; Townsend, K.A.; King, R.; Huston, W.M.; Nash, S.M.B. Turning microplastics into nanoplastics through digestive fragmentation by Antarctic krill. Nat. Commun. 2018, 9, 1001. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  10. Materic, D.; Peacock, M.; Dean, J.; Futter, M.; Maximov, T.; Moldan, F.; Röckmann, T.; Holzinger, R. Presence of nanoplastics in rural and remote surface waters. Environ. Res. Lett. 2021, 17, 054036. [Google Scholar] [CrossRef]
  11. Zhang, Q.; He, Y.; Cheng, R.; Li, Q.; Qian, Z.; Lin, X. Recent advances in toxicological research and potential health impact of microplastics and nanoplastics in vivo. Environ. Sci. Pollut. Res. Int. 2022, 29, 40415–40448. [Google Scholar] [CrossRef] [PubMed]
  12. Lu, Y.; Zhang, Y.; Deng, Y.; Jiang, W.; Zhao, Y.; Geng, J.; Ding, L.; Ren, H. Uptake and Accumulation of Polystyrene Microplastics in Zebrafish (Danio rerio) and Toxic Effects in Liver. Environ. Sci. Technol. 2016, 50, 4054–4060. [Google Scholar] [CrossRef]
  13. Chen, M.; Yue, Y.; Bao, X.; Feng, X.; Ou, Z.; Qiu, Y.; Yang, K.; Yang, Y.; Yu, Y.; Yu, H. Effects of polystyrene nanoplastics on oxidative stress, histopathology and intestinal microbiota in largemouth bass (Micropterus salmoides). Aquac. Rep. 2022, 27, 101423. [Google Scholar] [CrossRef]
  14. Brandts, I.; Cánovas, M.; Tvarijonaviciute, A.; Llorca, M.; Vega, A.; Farré, M.; Pastor, J.; Roher, N.; Teles, M. Nanoplastics are bioaccumulated in fish liver and muscle and cause DNA damage after a chronic exposure. Environ. Res. 2022, 212 Pt A, 113433. [Google Scholar] [CrossRef] [PubMed]
  15. Li, L.; Gu, H.; Chang, X.; Huang, W.; Sokolova, I.M.; Wei, S.; Sun, L.; Li, S.; Wang, X.; Hu, M.; et al. Oxidative stress induced by nanoplastics in the liver of juvenile large yellow croaker Larimichthys crocea. Mar. Pollut. Bull. 2021, 170, 112661. [Google Scholar] [CrossRef] [PubMed]
  16. Li, Z.; Xu, T.; Peng, L.; Tang, X.; Chi, Q.; Li, M.; Li, S. Polystyrene nanoplastics aggravates lipopolysaccharide-induced apoptosis in mouse kidney cells by regulating IRE1/XBP1 endoplasmic reticulum stress pathway via oxidative stress. J. Cell. Physiol. 2023, 238, 151–164. [Google Scholar] [CrossRef] [PubMed]
  17. Vagner, M.; Boudry, G.; Courcot, L.; Vincent, D.; Dehaut, A.; Duflos, G.; Huvet, A.; Tallec, K.; Infante, J.L.Z. Experimental evidence that polystyrene nanoplastics cross the intestinal barrier of European seabass. Environ. Int. 2022, 166, 107340. [Google Scholar] [CrossRef] [PubMed]
  18. Cheng, H.; Duan, Z.; Wu, Y.; Wang, Y.; Zhang, H.; Shi, Y.; Zhang, H.; Wei, Y. Immunotoxicity responses to polystyrene nanoplastics and their related mechanisms in the liver of zebrafish (Danio rerio) larvae. Environ. Int. 2022, 161, 107128. [Google Scholar] [CrossRef] [PubMed]
  19. Lai, W.; Xu, D.; Li, J.; Wang, Z.; Ding, Y.; Wang, X.; Li, X.; Xu, N.; Mai, K.; Ai, Q. Dietary polystyrene nanoplastics exposure alters liver lipid metabolism and muscle nutritional quality in carnivorous marine fish large yellow croaker (Larimichthys crocea). J. Hazard. Mater. 2021, 419, 126454. [Google Scholar] [CrossRef] [PubMed]
  20. Liu, S.; Yan, L.; Zhang, Y.; Junaid, M.; Wang, J. Polystyrene nanoplastics exacerbated the ecotoxicological and potential carcinogenic effects of tetracycline in juvenile grass carp (Ctenopharyngodon idella). Sci. Total Environ. 2022, 803, 150027. [Google Scholar] [CrossRef] [PubMed]
  21. Liao, H.; Liu, S.; Junaid, M.; Gao, D.; Ai, W.; Chen, G.; Wang, J. Di-(2-ethylhexyl) phthalate exacerbated the toxicity of polystyrene nanoplastics through histological damage and intestinal microbiota dysbiosis in freshwater Micropterus salmoides. Water Res. 2022, 219, 118608. [Google Scholar] [CrossRef] [PubMed]
  22. Coleman, O.I.; Haller, D. ER Stress and the UPR in Shaping Intestinal Tissue Homeostasis and Immunity. Front. Immunol. 2019, 10, 2825. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  23. Malhi, H.; Kaufman, R.J. Endoplasmic reticulum stress in liver disease. J. Hepatol. 2011, 54, 795–809. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  24. Lemmer, I.L.; Willemsen, N.; Hilal, N.; Bartelt, A. A guide to understanding endoplasmic reticulum stress in metabolic disorders. Mol. Metab. 2021, 47, 101169. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  25. Zhao, L.; Liang, J.; Chen, F.; Tang, X.; Liao, L.; Liu, Q.; Luo, J.; Du, Z.; Li, Z.; Luo, J.; et al. High carbohydrate diet induced endoplasmic reticulum stress and oxidative stress, promoted inflammation and apoptosis, impaired intestinal barrier of juvenile largemouth bass (Micropterus salmoides). Fish Shellfish Immunol. 2021, 119, 308–317. [Google Scholar] [CrossRef] [PubMed]
  26. Park, T.-J.; Lee, S.-H.; Lee, M.-S.; Lee, J.-K.; Lee, S.-H.; Zoh, K.-D. Occurrence of microplastics in the Han River and riverine fish in South Korea. Sci. Total Environ. 2020, 708, 134535. [Google Scholar] [CrossRef]
  27. Ding, J.; Zhang, S.; Razanajatovo, R.M.; Zou, H.; Zhu, W. Accumulation, tissue distribution, and biochemical effects of polystyrene microplastics in the freshwater fish red tilapia (Oreochromis niloticus). Environ. Pollut. 2018, 238, 1–9. [Google Scholar] [CrossRef]
  28. Chen, Y.J.; Liu, Y.J.; Yang, H.J.; Yuan, Y.; Liu, F.J.; Tian, L.X.; Liang, G.Y.; Yuan, R.M. Effect of dietary oxidized fish oil on growth performance, body composition, antioxidant defence mechanism and liver histology of juvenile largemouth bass Micropterus salmoides. Aquac. Nutr. 2012, 18, 321–331. [Google Scholar] [CrossRef]
  29. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  30. Zhao, L.; Liang, J.; Liu, H.; Gong, C.; Huang, X.; Hu, Y.; Liu, Q.; He, Z.; Zhang, X.; Yang, S.; et al. Yinchenhao Decoction ameliorates the high-carbohydrate diet induced suppression of immune response in largemouth bass (Micropterus salmoides). Fish Shellfish Immunol. 2022, 125, 141–151. [Google Scholar] [CrossRef]
  31. Zhao, X.; Li, L.; Li, C.; Liu, E.; Zhu, H.; Ling, Q. Heat stress-induced endoplasmic reticulum stress promotes liver apoptosis in largemouth bass (Micropterus salmoides). Aquaculture 2022, 546, 737401. [Google Scholar] [CrossRef]
  32. Liang, H.; Xu, P.; Xu, G.; Zhang, L.; Huang, D.; Ren, M.; Zhang, L. Histidine Deficiency Inhibits Intestinal Antioxidant Capacity and Induces Intestinal Endoplasmic-Reticulum Stress, Inflammatory Response, Apoptosis, and Necroptosis in Largemouth Bass (Micropterus salmoides). Antioxidants 2022, 11, 2399. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  33. Yu, H.; Zhang, L.; Chen, P.; Liang, X.; Cao, A.; Han, J.; Wu, X.; Zheng, Y.; Qin, Y.; Xue, M. Dietary Bile Acids Enhance Growth, and Alleviate Hepatic Fibrosis Induced by a High Starch Diet via AKT/FOXO1 and cAMP/AMPK/SREBP1 Pathway in Micropterus salmoides. Front. Physiol. 2019, 10, 1430. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  34. Yu, H.H.; Liang, X.F.; Chen, P.; Wu, X.F.; Zheng, Y.H.; Luo, L.; Qin, Y.C.; Long, X.C.; Xue, M. Dietary supplementation of Grobiotic®-A increases short-term inflammatory responses and improves long-term growth performance and liver health in largemouth bass (Micropterus salmoides). Aquaculture 2019, 500, 327–337. [Google Scholar] [CrossRef]
  35. Xie, S.; Yin, P.; Tian, L.; Liu, Y.; Niu, J. Lipid metabolism and plasma metabolomics of juvenile largemouth bass Micropterus salmoides were affected by dietary oxidized fish oil. Aquaculture 2020, 522, 735158. [Google Scholar] [CrossRef]
  36. Yu, L.L.; Yu, H.H.; Liang, X.F.; Li, N.; Wang, X.; Li, F.H.; Wu, X.F.; Zheng, Y.H.; Xue, M.; Liang, X.F. Dietary butylated hydroxytoluene improves lipid metabolism, antioxidant and anti-apoptotic response of largemouth bass (Micropterus salmoides). Fish Shellfish Immunol. 2018, 72, 220–229. [Google Scholar] [CrossRef] [PubMed]
  37. Hu, Q.; Wang, H.; He, C.; Jin, Y.; Fu, Z. Polystyrene nanoparticles trigger the activation of p38 MAPK and apoptosis via inducing oxidative stress in zebrafish and macrophage cells. Environ. Pollut. 2021, 269, 116075. [Google Scholar] [CrossRef] [PubMed]
  38. Liu, J.; Liu, Q.; Han, J.; Feng, J.; Guo, T.; Li, Z.; Min, F.; Jin, R.; Peng, X. N-Acetylcysteine Inhibits Patulin-Induced Apoptosis by Affecting ROS-Mediated Oxidative Damage Pathway. Toxins 2021, 13, 595. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  39. Wang, W.; Mao, X.; Zhang, R.; Zhou, X.X.; Liu, Y.; Zhou, H.; Jia, J.; Yan, B. Nanoplastic Exposure at Environmental Concentrations Disrupts Hepatic Lipid Metabolism through Oxidative Stress Induction and Endoplasmic Reticulum Homeostasis Perturbation. Environ. Sci. Technol. 2023, 57, 14127–14137. [Google Scholar] [CrossRef] [PubMed]
  40. Li, Y.; Ye, Y.; Rihan, N.; Zhu, B.; Jiang, Q.; Liu, X.; Zhao, Y.; Che, X. Polystyrene nanoplastics induce lipid metabolism disorder and alter fatty acid composition in the hepatopancreas of Pacific whiteleg shrimp (Litopenaeus vannamei). Sci. Total Environ. 2024, 906, 167616. [Google Scholar] [CrossRef]
  41. Mallik, A.; Xavier, K.A.M.; Naidu, B.C.; Nayak, B.B. Ecotoxicological and physiological risks of microplastics on fish and their possible mitigation measures. Sci. Total Environ. 2021, 779, 146433. [Google Scholar] [CrossRef] [PubMed]
  42. Zhu, Z.; Liao, R.; Shi, Y.; Li, J.; Cao, J.; Liao, B.; Wu, J.; Li, G. Polystyrene nanoplastics induce apoptosis of human kidney proximal tubular epithelial cells via oxidative stress and MAPK signaling pathways. Environ. Sci. Pollut. Res. Int. 2023, 30, 110579–110589. [Google Scholar] [CrossRef] [PubMed]
  43. Ragusa, A.; Matta, M.; Cristiano, L.; Matassa, R.; Battaglione, E.; Svelato, A.; Luca, C.D.; Avino, S.D.; Gulotta, A.; Rongioletti, M.C.A.; et al. Deeply in Plasticenta: Presence of Microplastics in the Intracellular Compartment of Human Placentas. Int. J. Environ. Res. Public Health 2022, 19, 11593. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  44. Cnop, M.; Foufelle, F.; Velloso, L.A. Endoplasmic reticulum stress, obesity and diabetes. Trends Mol. Med. 2012, 18, 59–68. [Google Scholar] [CrossRef] [PubMed]
  45. Xu, W.; Wang, C.; Hua, J. X-box binding protein 1 (XBP1) function in diseases. Cell Biol. Int. 2021, 45, 731–739. [Google Scholar] [CrossRef] [PubMed]
  46. Tabas, I.; Ron, D. Integrating the mechanisms of apoptosis induced by endoplasmic reticulum stress. Nat. Cell Biol. 2011, 13, 184–190. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  47. Marciniak, S.J.; Ron, D. Endoplasmic reticulum stress signaling in disease. Physiol. Rev. 2006, 86, 1133–1149. [Google Scholar] [CrossRef] [PubMed]
  48. Kemper, C.; Sack, M.N. Linking nutrient sensing, mitochondrial function, and PRR immune cell signaling in liver disease. Trends Immunol. 2022, 43, 886–900. [Google Scholar] [CrossRef] [PubMed]
  49. Wu, D.; Lu, X.; Dong, L.-X.; Tian, J.; Deng, J.; Wei, L.; Wen, H.; Zhong, S.; Jiang, M. Nano polystyrene microplastics could accumulate in Nile tilapia (Oreochromis niloticus): Negatively impacts on the liver and intestinal health through water exposure. J. Environ. Sci. 2024, 137, 604–614. [Google Scholar] [CrossRef]
  50. Gu, X.; Fu, H.; Sun, S.; Qiao, H.; Zhang, W.; Jiang, S.; Xiong, Y.; Jin, S.; Gong, Y.; Wu, Y. Dietary cholesterol-induced transcriptome differences in the intestine, hepatopancreas, and muscle of Oriental River prawn Macrobrachium nipponense. Comp. Biochem. Physiol. Part D Genom. Proteom. 2017, 23, 39–48. [Google Scholar] [CrossRef] [PubMed]
  51. Shimano, H.; Sato, R. SREBP-regulated lipid metabolism: Convergent physiology—Divergent pathophysiology. Nat. Rev. Endocrinol. 2017, 13, 710–730. [Google Scholar] [CrossRef] [PubMed]
  52. Wang, S.; Chen, Z.; Lam, V.; Han, J.; Hassler, J.; Finck, B.N.; Davidson, N.O.; Kaufman, R.J. IRE1α-XBP1s induces PDI expression to increase MTP activity for hepatic VLDL assembly and lipid homeostasis. Cell Metab. 2012, 16, 473–486. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  53. Lee, A.H.; Scapa, E.F.; Cohen, D.E.; Glimcher, L.H. Regulation of hepatic lipogenesis by the transcription factor XBP1. Science 2008, 320, 1492–1496. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  54. Zheng, W.; Sun, Q.; Li, L.; Cheng, Y.; Chen, Y.; Lv, M.; Xiang, X. Role of endoplasmic reticulum stress in hepatic glucose and lipid metabolism and therapeutic strategies for metabolic liver disease. Int. Immunopharmacol. 2022, 113 Pt B, 109458. [Google Scholar] [CrossRef] [PubMed]
  55. Celik, C.; Lee, S.Y.T.; Yap, W.S.; Thibault, G. Endoplasmic reticulum stress and lipids in health and diseases. Prog. Lipid Res. 2023, 89, 101198. [Google Scholar] [CrossRef] [PubMed]
  56. Shan, B.; Wang, X.; Wu, Y.; Xu, C.; Xia, Z.; Dai, J.; Shao, M.; Zhao, F.; He, S.; Yang, L.; et al. The metabolic ER stress sensor IRE1α suppresses alternative activation of macrophages and impairs energy expenditure in obesity. Nat. Immunol. 2017, 18, 519–529. [Google Scholar] [CrossRef] [PubMed]
Fishes 09 00342 g001
Figure 1. The histopathological alterations in the livers of largemouth bass were observed after exposure to PS-NPs for a duration of seven days and nineteen days. (A) Control groups on the seventh day; (B) PS-NP groups on the seventh day; (C) control groups on the nineteenth day. (D) PS-NP groups on the nineteenth day. Bar = 100 μm, magnification × 200.
Figure 1. The histopathological alterations in the livers of largemouth bass were observed after exposure to PS-NPs for a duration of seven days and nineteen days. (A) Control groups on the seventh day; (B) PS-NP groups on the seventh day; (C) control groups on the nineteenth day. (D) PS-NP groups on the nineteenth day. Bar = 100 μm, magnification × 200.
Fishes 09 00342 g001
Fishes 09 00342 g002
Figure 2. Plasma parameters of largemouth bass after exposure to PS-NPs for seven days and nineteen days. (A) Plasma triglyceride (TG), plasma total cholesterol (T-CHO), plasms low-density lipoprotein cholesterol (LDL-C), and plasma high-density lipoprotein cholesterol (HDL-C) of largemouth bass after seven days of exposure to PS-NPs. (B) Plasma TG, plasma T-CHO, plasma LDL-C, and plasma HDL-C of largemouth bass after nineteen days of exposure to PS-NPs. All data were expressed as mean ± SE, n = 9 (3 fish/replicates). Asterisks (*) indicate a significant difference between the groups of largemouth bass exposed to the PS-NPs and the groups of largemouth bass not exposed to the PS-NPs (p < 0.05). Two asterisks (**) indicate the extremely significant difference between the groups of largemouth bass exposed to the PS-NPs and the groups of largemouth bass not exposed to the PS-NPs (p < 0.01).
Figure 2. Plasma parameters of largemouth bass after exposure to PS-NPs for seven days and nineteen days. (A) Plasma triglyceride (TG), plasma total cholesterol (T-CHO), plasms low-density lipoprotein cholesterol (LDL-C), and plasma high-density lipoprotein cholesterol (HDL-C) of largemouth bass after seven days of exposure to PS-NPs. (B) Plasma TG, plasma T-CHO, plasma LDL-C, and plasma HDL-C of largemouth bass after nineteen days of exposure to PS-NPs. All data were expressed as mean ± SE, n = 9 (3 fish/replicates). Asterisks (*) indicate a significant difference between the groups of largemouth bass exposed to the PS-NPs and the groups of largemouth bass not exposed to the PS-NPs (p < 0.05). Two asterisks (**) indicate the extremely significant difference between the groups of largemouth bass exposed to the PS-NPs and the groups of largemouth bass not exposed to the PS-NPs (p < 0.01).
Fishes 09 00342 g002
Fishes 09 00342 g003
Figure 3. Transcriptome analysis of the hepatic tissue in largemouth bass after exposure to PS-NPs for seven days and nineteen days. The Venn diagrams showing the number of differential expression genes (DEGs) between the control and PS-NP groups on the seventh day (A) and the nineteenth day (F). The principal component analysis (PCA) shows the global mRNA profiles of the livers in the control groups and PS-NP groups on the seventh day (B) and the nineteenth day (G) differ. The orange dots and blue dots represent the control groups and PS-NP groups, respectively (n = 3). The statistical analysis of DEGs between the control groups and PS-NP groups on the seventh day (C) and the nineteenth day (H). Volcano plot of differentially expressed mRNAs between the control groups and PS-NP groups on the seventh day (D) and the nineteenth day (I). The red dots were significantly increased, and the orange dots were significantly decreased. Transcriptome analysis of the livers of largemouth bass after nineteen days of exposure to PS-NPs. The heatmap presenting differentially expressed mRNAs between the control groups and PS-NP groups on the seventh day (E) and the nineteenth day (J). The color key (from green to red) of the Z-score value (−1−2) indicated low to high expression levels.
Figure 3. Transcriptome analysis of the hepatic tissue in largemouth bass after exposure to PS-NPs for seven days and nineteen days. The Venn diagrams showing the number of differential expression genes (DEGs) between the control and PS-NP groups on the seventh day (A) and the nineteenth day (F). The principal component analysis (PCA) shows the global mRNA profiles of the livers in the control groups and PS-NP groups on the seventh day (B) and the nineteenth day (G) differ. The orange dots and blue dots represent the control groups and PS-NP groups, respectively (n = 3). The statistical analysis of DEGs between the control groups and PS-NP groups on the seventh day (C) and the nineteenth day (H). Volcano plot of differentially expressed mRNAs between the control groups and PS-NP groups on the seventh day (D) and the nineteenth day (I). The red dots were significantly increased, and the orange dots were significantly decreased. Transcriptome analysis of the livers of largemouth bass after nineteen days of exposure to PS-NPs. The heatmap presenting differentially expressed mRNAs between the control groups and PS-NP groups on the seventh day (E) and the nineteenth day (J). The color key (from green to red) of the Z-score value (−1−2) indicated low to high expression levels.
Fishes 09 00342 g003
Fishes 09 00342 g004
Figure 4. GO analysis of differential expression genes (DEGs) of the livers of largemouth bass after seven days and nineteen days of exposure to PS-NPs. (A) GO summary graph showing the summary of the top 20 enriched GO items with different colors representing different GO categories between the control groups and PS-NP groups on the seventh day. (B) GO summary graph showing the summary of the top 20 enriched GO items with different colors representing different GO categories between the control groups and PS-NP groups on the nineteenth day.
Figure 4. GO analysis of differential expression genes (DEGs) of the livers of largemouth bass after seven days and nineteen days of exposure to PS-NPs. (A) GO summary graph showing the summary of the top 20 enriched GO items with different colors representing different GO categories between the control groups and PS-NP groups on the seventh day. (B) GO summary graph showing the summary of the top 20 enriched GO items with different colors representing different GO categories between the control groups and PS-NP groups on the nineteenth day.
Fishes 09 00342 g004
Fishes 09 00342 g005aFishes 09 00342 g005b
Figure 5. KEGG analysis of differential expression genes (DEGs) of the livers of largemouth bass after seven days and nineteen days of exposure to PS-NPs. (A) The KEGG analysis of DEGs based on classification by pathways between the control groups and PS-NP groups on the seventh day. (B) The KEGG analysis of DEGs based on classification by pathways between the control groups and PS-NP groups on the nineteenth day. Each column represents a pathway, and the height of the column represents the number of genes that pathway contains. Legends indicate the pathway represented by different column colors.
Figure 5. KEGG analysis of differential expression genes (DEGs) of the livers of largemouth bass after seven days and nineteen days of exposure to PS-NPs. (A) The KEGG analysis of DEGs based on classification by pathways between the control groups and PS-NP groups on the seventh day. (B) The KEGG analysis of DEGs based on classification by pathways between the control groups and PS-NP groups on the nineteenth day. Each column represents a pathway, and the height of the column represents the number of genes that pathway contains. Legends indicate the pathway represented by different column colors.
Fishes 09 00342 g005aFishes 09 00342 g005b
Fishes 09 00342 g006
Figure 6. Effects of PS-NPs on expression of endoplasmic reticulum (ER) stress genes (chopα, chopβ, jnk-1, grp78, perk, atf4, ire-1, xbp-1, atf6, and eif2α). The levels of gene expression in the livers of largemouth bass on the seventh day (A) and the nineteenth day (B) of exposure to PS-NPs. All data were expressed as mean ± SE, n = 9 (3 fish/replicate). Asterisks (*) indicate a significant difference between the group of largemouth bass exposed to the PS-NPs and the groups of largemouth bass not exposed to the PS-NPs (p < 0.05). Two asterisks (**) indicate an extremely significant difference between the group of largemouth bass exposed to the PS-NPs and the groups of largemouth bass not exposed to the PS-NPs (p < 0.01).
Figure 6. Effects of PS-NPs on expression of endoplasmic reticulum (ER) stress genes (chopα, chopβ, jnk-1, grp78, perk, atf4, ire-1, xbp-1, atf6, and eif2α). The levels of gene expression in the livers of largemouth bass on the seventh day (A) and the nineteenth day (B) of exposure to PS-NPs. All data were expressed as mean ± SE, n = 9 (3 fish/replicate). Asterisks (*) indicate a significant difference between the group of largemouth bass exposed to the PS-NPs and the groups of largemouth bass not exposed to the PS-NPs (p < 0.05). Two asterisks (**) indicate an extremely significant difference between the group of largemouth bass exposed to the PS-NPs and the groups of largemouth bass not exposed to the PS-NPs (p < 0.01).
Fishes 09 00342 g006
Fishes 09 00342 g007
Figure 7. Effects of PS-NPs on expression of lipid metabolism genes (srebp-1, acaca, cpt-1, fasn, hmgcr, ppar-γ, and srebf-2). The levels of gene expression in the livers of largemouth bass on the seventh day (A) and the nineteenth day (B) of exposure to PS-NPs. All data were expressed as mean ± SE, n = 9 (3 fish/replicates). Asterisks (*) indicate a significant difference between the group of largemouth bass exposed to the PS-NPs and the groups of largemouth bass not exposed to the PS-NPs (p < 0.05). Two asterisks (**) indicate an extremely significant difference between the group of largemouth bass exposed to the PS-NPs and the groups of largemouth bass not exposed to the PS-NPs (p < 0.01).
Figure 7. Effects of PS-NPs on expression of lipid metabolism genes (srebp-1, acaca, cpt-1, fasn, hmgcr, ppar-γ, and srebf-2). The levels of gene expression in the livers of largemouth bass on the seventh day (A) and the nineteenth day (B) of exposure to PS-NPs. All data were expressed as mean ± SE, n = 9 (3 fish/replicates). Asterisks (*) indicate a significant difference between the group of largemouth bass exposed to the PS-NPs and the groups of largemouth bass not exposed to the PS-NPs (p < 0.05). Two asterisks (**) indicate an extremely significant difference between the group of largemouth bass exposed to the PS-NPs and the groups of largemouth bass not exposed to the PS-NPs (p < 0.01).
Fishes 09 00342 g007
Fishes 09 00342 g008
Figure 8. Effects of PS-NPs on expression of apoptosis genes (foxo, caspase-3, caspase-8, caspase-9, and bax). The levels of gene expression in the livers of largemouth bass on the seventh day (A) and the nineteenth day (B) of exposure to PS-NPs. All data were expressed as mean ± SE, n = 9 (3 fish/replicate). Asterisks (*) indicate a significant difference between the group of largemouth bass exposed to the PS-NPs and the groups of largemouth bass not exposed to the PS-NPs (p < 0.05). Two asterisks (**) indicate an extremely significant difference between the group of largemouth bass exposed to the PS-NPs and the groups of largemouth bass not exposed to the PS-NPs (p < 0.01).
Figure 8. Effects of PS-NPs on expression of apoptosis genes (foxo, caspase-3, caspase-8, caspase-9, and bax). The levels of gene expression in the livers of largemouth bass on the seventh day (A) and the nineteenth day (B) of exposure to PS-NPs. All data were expressed as mean ± SE, n = 9 (3 fish/replicate). Asterisks (*) indicate a significant difference between the group of largemouth bass exposed to the PS-NPs and the groups of largemouth bass not exposed to the PS-NPs (p < 0.05). Two asterisks (**) indicate an extremely significant difference between the group of largemouth bass exposed to the PS-NPs and the groups of largemouth bass not exposed to the PS-NPs (p < 0.01).
Fishes 09 00342 g008
Fishes 09 00342 g009
Figure 9. The correlation plot of gene expression in the livers of largemouth bass after exposure to PS-NPs. (A) The correlation plot of gene expression in the livers of largemouth bass after seven days of exposure to PS-NPs. (B) The correlation plot of gene expression in the livers of largemouth bass after nineteen days of exposure to PS-NPs. The color key (from blue to red) of score value (−1−1) indicated low to high degree of correlation.
Figure 9. The correlation plot of gene expression in the livers of largemouth bass after exposure to PS-NPs. (A) The correlation plot of gene expression in the livers of largemouth bass after seven days of exposure to PS-NPs. (B) The correlation plot of gene expression in the livers of largemouth bass after nineteen days of exposure to PS-NPs. The color key (from blue to red) of score value (−1−1) indicated low to high degree of correlation.
Fishes 09 00342 g009
Table 1. Quantitative real-time PCR primer sequences.
Table 1. Quantitative real-time PCR primer sequences.
PathwayGene 1Primer SequenceProductsSources
β-actin FATCGCCGCACTGGTTGTTGAC336[29]
β-actin RCCTGTTGGCTTTGGGGTTC
ER stresschopα FGATGAGCAGCCTAAGCCACG153[30]
chopα RAACAGGTCAGCCAAGAAGTCG
chopβ FGTATCTTCATTACCAGTCCACCAG156/
chopβ RAGGCGTTTCTTTGCTTTCC
Jnk-1 FTGCACTACCTGAGCCACTTG505[31]
Jnk-1 RTGTGCTTCCTGGCTGATGTT
grp78 FATCTGGGTGGTGGCACTTTT91[31]
grp78 RCCCAGATGAGTGTCACCGTT
perk FCCACCGCAGAGCAGATGTAA117[31]
perk RTGCTGGAGTCATCCTACCGA
atf4 FGCGGACATTTGTGTTGCACT101[31]
atf4 RCTGTCCTGCCAGGTGATGAA
ire-1 FCTGCCAGATCCGCATACACT96[31]
ire-1 RGGTGTCCACTCTTGAAGGCA
xbp-1 FACACCCTCGACACGAAAGA213[32]
xbp-1 RAGAATGCCCAGTAGCAAATC
atf6 FGACGCCCCGCATAAGAGTAA107[31]
atf6 RGCAGACTTGAGGAGAGCTGG
eif2α FCCTCGTTTGTCCGTCTGTATC92[30]
eif2α RGCTGACTCTGTCGGCCTTG
Lipid metabolismsrebp-1 FAGTCTGAGCTACAGCGACAAGG127[33]
srebp-1 RTCATCACCAACAGGAGGTCACA
acaca FCTAACTGCCATCCCATGTGC113/
acaca RCGGATAATGGCTCGCACAAA
cpt-1 FCATGGAAAGCCAGCCTTTAG128[34]
cpt-1 RGAGCACCAGACACGCTAACA
fasn FATCCCTCTTTGCCACTGTTG121[34]
fasn RGAGGTGATGTTGCTCGCATA
srebf-2 FTTGACCACCCTCTGCCTAAG178/
srebf-2 RCCCTTGTTCAGCCAGTTTCC
hmgcr FGGTGGAGTGCTTAGTAATCGG125[35]
hmgcr RACGCAGGGAAGAAAGTCAT
ppar-γ FCCTGTGAGGGCTGTAAGGGTTT118[36]
ppar-γ RTTGTTGCGGGACTTCTTGTGA
Apoptosisfoxo1 FCTATGAATGGCCGCTTGCTCA164[35]
foxo1 RTCGTCCATATCCGTTGGTGTTG
caspase-3 FGCTTCATTCGTCTGTGTTC98[36]
caspase-3 RCGAAAAAGTGATGTGAGGTA
caspase-8 FGAGACAGACAGCAGACAACCA195[36]
caspase-8 RTTCCATTTCAGCAAACACATC
caspase-9 FCTGGAATGCCTTCAGGAGACGGG125[36]
caspase-9 RGGGAGGGGCAAGACAACAGGGTG
Bax FAAATGTGGGAGCCAGACATC112[34]
Bax RAGGCTCCTGGTCTCCTTCTC
1 chop, C/EBP homologous protein; jnk, c-Jun-N-terminal kinase; grp78, Glucose-Regulated Protein 78; perk, protein kinase (PKR)-like ER kinase; atf4, activating transcription factor 4; xbp-1, X-box binding protein 1; atf6, activating transcription factor 6; eif2α, eukaryotic initiation factor 2 subunit alpha; srebp-1, Sterol regulatory element binding protein-1; acaca, acetyl-CoA carboxylase alpha; cpt-1, carnitine palmitoyltransferase 1; fasn, fatty acid synthase; srebf-2, sterol regulatory element-binding factor-2; hmgcr, 3-hydroxy-3-methylglutaryl-coenzyme A reductase; ppar-γ, peroxisome proliferator activating receptor γ; foxo1, forkhead box O1, caspase, cysteine-aspartic protease; bax, bcl-2 associated X.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, K.; Chen, J.; Wang, Y.; Chen, M.; Bao, X.; Chen, X.; Xie, S.; Lin, Z.; Yu, Y. Investigating Polystyrene Nano-Plastic Effects on Largemouth Bass (Micropterus salmoides) Focusing on mRNA Expression: Endoplasmic Reticulum Stress and Lipid Metabolism Dynamics. Fishes 2024, 9, 342. https://doi.org/10.3390/fishes9090342

AMA Style

Zhang K, Chen J, Wang Y, Chen M, Bao X, Chen X, Xie S, Lin Z, Yu Y. Investigating Polystyrene Nano-Plastic Effects on Largemouth Bass (Micropterus salmoides) Focusing on mRNA Expression: Endoplasmic Reticulum Stress and Lipid Metabolism Dynamics. Fishes. 2024; 9(9):342. https://doi.org/10.3390/fishes9090342

Chicago/Turabian Style

Zhang, Kaipeng, Jing Chen, Yamin Wang, Mingshi Chen, Xiaoxue Bao, Xiaotong Chen, Shan Xie, Zhenye Lin, and Yingying Yu. 2024. "Investigating Polystyrene Nano-Plastic Effects on Largemouth Bass (Micropterus salmoides) Focusing on mRNA Expression: Endoplasmic Reticulum Stress and Lipid Metabolism Dynamics" Fishes 9, no. 9: 342. https://doi.org/10.3390/fishes9090342

APA Style

Zhang, K., Chen, J., Wang, Y., Chen, M., Bao, X., Chen, X., Xie, S., Lin, Z., & Yu, Y. (2024). Investigating Polystyrene Nano-Plastic Effects on Largemouth Bass (Micropterus salmoides) Focusing on mRNA Expression: Endoplasmic Reticulum Stress and Lipid Metabolism Dynamics. Fishes, 9(9), 342. https://doi.org/10.3390/fishes9090342

Article Metrics

Back to TopTop