Investigating Polystyrene Nano-Plastic Effects on Largemouth Bass (Micropterus salmoides) Focusing on mRNA Expression: Endoplasmic Reticulum Stress and Lipid Metabolism Dynamics
Abstract
1. Introduction
2. Materials and Methods
2.1. PS-NP Preparation and Characterization
2.2. Experimental Procedure
2.3. Sample Collection
2.4. Histopathological Analysis
2.5. Hematological Parameters Analysis
2.6. RNA-seq Analysis
2.7. Quantitative Real-Time PCR
2.8. Calculation and Statistical Analysis
3. Results
3.1. Effects of PS-NP Exposure on Liver Histopathology
3.2. Effects of PS-NP Exposure on Lipid Metabolism
3.3. Effects of PS-NP Exposure on Hepatic Whole Transcriptome
3.4. Effects of PS-NP Exposure on the Expression Levels of ER Stress-Related Genes
3.5. Effects of PS-NP Exposure on Expression of Lipid Metabolism-Related Gene
3.6. Effects of PS-NP Exposure on Expression of Apoptosis-Related Genes
3.7. Correlation between Lipid Metabolism Disorder, ER Stress, and Apoptosis Induced by PS-Np Exposure
4. Discussion
4.1. PS-NP-Induced Liver Injury and Dysfunction
4.2. PS-NPs Disrupt the Protein Synthesis Process of the ER
4.3. PS-NPs Disrupt Lipid Metabolism
4.4. Interactions among Lipid Metabolism Disorder, ER Stress, and Apoptosis Induced by PS-Np Exposure
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- da Costa, J.P.; Santos, P.S.M.; Duarte, A.C.; Rocha-Santos, T. (Nano)plastics in the environment—Sources, fates and effects. Sci. Total Environ. 2016, 566–567, 15–26. [Google Scholar] [CrossRef] [PubMed]
- Tuuri, E.M.; Leterme, S.C. How plastic debris and associated chemicals impact the marine food web: A review. Environ. Pollut. 2023, 321, 121156. [Google Scholar] [CrossRef] [PubMed]
- Liao, J.; Chen, Q. Biodegradable plastics in the air and soil environment: Low degradation rate and high microplastics formation. J. Hazard. Mater. 2021, 418, 126329. [Google Scholar] [CrossRef] [PubMed]
- Suzuki, G.; Uchida, N.; Tuyen, L.H.; Tanaka, K.; Matsukami, H.; Kunisue, T.; Takahashi, S.; Viet, P.H.; Kuramochi, H.; Osako, M. Mechanical recycling of plastic waste as a point source of microplastic pollution. Environ. Pollut. 2022, 303, 119114. [Google Scholar] [CrossRef] [PubMed]
- MacLeod, M.; Arp, H.P.H.; Tekman, M.B.; Jahnke, A. The global threat from plastic pollution. Science 2021, 373, 61–65. [Google Scholar] [CrossRef] [PubMed]
- Abel, S.M.; Wu, F.; Primpke, S.; Gerdts, G.; Brandt, A. Journey to the deep: Plastic pollution in the hadal of deep-sea trenches. Environ. Pollut. 2023, 333, 122078. [Google Scholar] [CrossRef]
- Thompson, R.C.; Olsen, Y.; Mitchell, R.P.; Davis, A.; Rowland, S.J.; John, A.W.; McGonigle, D.; Russell, A.E. Lost at sea: Where is all the plastic? Science 2004, 304, 838. [Google Scholar] [CrossRef] [PubMed]
- Shen, M.; Zhang, Y.; Zhu, Y.; Song, B.; Zeng, G.; Hu, D.; Wen, X.; Ren, X. Recent advances in toxicological research of nanoplastics in the environment: A review. Environ. Pollut. 2019, 252 Pt A, 511–521. [Google Scholar] [CrossRef] [PubMed]
- Dawson, A.L.; Kawaguchi, S.; King, C.K.; Townsend, K.A.; King, R.; Huston, W.M.; Nash, S.M.B. Turning microplastics into nanoplastics through digestive fragmentation by Antarctic krill. Nat. Commun. 2018, 9, 1001. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Materic, D.; Peacock, M.; Dean, J.; Futter, M.; Maximov, T.; Moldan, F.; Röckmann, T.; Holzinger, R. Presence of nanoplastics in rural and remote surface waters. Environ. Res. Lett. 2021, 17, 054036. [Google Scholar] [CrossRef]
- Zhang, Q.; He, Y.; Cheng, R.; Li, Q.; Qian, Z.; Lin, X. Recent advances in toxicological research and potential health impact of microplastics and nanoplastics in vivo. Environ. Sci. Pollut. Res. Int. 2022, 29, 40415–40448. [Google Scholar] [CrossRef] [PubMed]
- Lu, Y.; Zhang, Y.; Deng, Y.; Jiang, W.; Zhao, Y.; Geng, J.; Ding, L.; Ren, H. Uptake and Accumulation of Polystyrene Microplastics in Zebrafish (Danio rerio) and Toxic Effects in Liver. Environ. Sci. Technol. 2016, 50, 4054–4060. [Google Scholar] [CrossRef]
- Chen, M.; Yue, Y.; Bao, X.; Feng, X.; Ou, Z.; Qiu, Y.; Yang, K.; Yang, Y.; Yu, Y.; Yu, H. Effects of polystyrene nanoplastics on oxidative stress, histopathology and intestinal microbiota in largemouth bass (Micropterus salmoides). Aquac. Rep. 2022, 27, 101423. [Google Scholar] [CrossRef]
- Brandts, I.; Cánovas, M.; Tvarijonaviciute, A.; Llorca, M.; Vega, A.; Farré, M.; Pastor, J.; Roher, N.; Teles, M. Nanoplastics are bioaccumulated in fish liver and muscle and cause DNA damage after a chronic exposure. Environ. Res. 2022, 212 Pt A, 113433. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Gu, H.; Chang, X.; Huang, W.; Sokolova, I.M.; Wei, S.; Sun, L.; Li, S.; Wang, X.; Hu, M.; et al. Oxidative stress induced by nanoplastics in the liver of juvenile large yellow croaker Larimichthys crocea. Mar. Pollut. Bull. 2021, 170, 112661. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Xu, T.; Peng, L.; Tang, X.; Chi, Q.; Li, M.; Li, S. Polystyrene nanoplastics aggravates lipopolysaccharide-induced apoptosis in mouse kidney cells by regulating IRE1/XBP1 endoplasmic reticulum stress pathway via oxidative stress. J. Cell. Physiol. 2023, 238, 151–164. [Google Scholar] [CrossRef] [PubMed]
- Vagner, M.; Boudry, G.; Courcot, L.; Vincent, D.; Dehaut, A.; Duflos, G.; Huvet, A.; Tallec, K.; Infante, J.L.Z. Experimental evidence that polystyrene nanoplastics cross the intestinal barrier of European seabass. Environ. Int. 2022, 166, 107340. [Google Scholar] [CrossRef] [PubMed]
- Cheng, H.; Duan, Z.; Wu, Y.; Wang, Y.; Zhang, H.; Shi, Y.; Zhang, H.; Wei, Y. Immunotoxicity responses to polystyrene nanoplastics and their related mechanisms in the liver of zebrafish (Danio rerio) larvae. Environ. Int. 2022, 161, 107128. [Google Scholar] [CrossRef] [PubMed]
- Lai, W.; Xu, D.; Li, J.; Wang, Z.; Ding, Y.; Wang, X.; Li, X.; Xu, N.; Mai, K.; Ai, Q. Dietary polystyrene nanoplastics exposure alters liver lipid metabolism and muscle nutritional quality in carnivorous marine fish large yellow croaker (Larimichthys crocea). J. Hazard. Mater. 2021, 419, 126454. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Yan, L.; Zhang, Y.; Junaid, M.; Wang, J. Polystyrene nanoplastics exacerbated the ecotoxicological and potential carcinogenic effects of tetracycline in juvenile grass carp (Ctenopharyngodon idella). Sci. Total Environ. 2022, 803, 150027. [Google Scholar] [CrossRef] [PubMed]
- Liao, H.; Liu, S.; Junaid, M.; Gao, D.; Ai, W.; Chen, G.; Wang, J. Di-(2-ethylhexyl) phthalate exacerbated the toxicity of polystyrene nanoplastics through histological damage and intestinal microbiota dysbiosis in freshwater Micropterus salmoides. Water Res. 2022, 219, 118608. [Google Scholar] [CrossRef] [PubMed]
- Coleman, O.I.; Haller, D. ER Stress and the UPR in Shaping Intestinal Tissue Homeostasis and Immunity. Front. Immunol. 2019, 10, 2825. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Malhi, H.; Kaufman, R.J. Endoplasmic reticulum stress in liver disease. J. Hepatol. 2011, 54, 795–809. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Lemmer, I.L.; Willemsen, N.; Hilal, N.; Bartelt, A. A guide to understanding endoplasmic reticulum stress in metabolic disorders. Mol. Metab. 2021, 47, 101169. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Zhao, L.; Liang, J.; Chen, F.; Tang, X.; Liao, L.; Liu, Q.; Luo, J.; Du, Z.; Li, Z.; Luo, J.; et al. High carbohydrate diet induced endoplasmic reticulum stress and oxidative stress, promoted inflammation and apoptosis, impaired intestinal barrier of juvenile largemouth bass (Micropterus salmoides). Fish Shellfish Immunol. 2021, 119, 308–317. [Google Scholar] [CrossRef] [PubMed]
- Park, T.-J.; Lee, S.-H.; Lee, M.-S.; Lee, J.-K.; Lee, S.-H.; Zoh, K.-D. Occurrence of microplastics in the Han River and riverine fish in South Korea. Sci. Total Environ. 2020, 708, 134535. [Google Scholar] [CrossRef]
- Ding, J.; Zhang, S.; Razanajatovo, R.M.; Zou, H.; Zhu, W. Accumulation, tissue distribution, and biochemical effects of polystyrene microplastics in the freshwater fish red tilapia (Oreochromis niloticus). Environ. Pollut. 2018, 238, 1–9. [Google Scholar] [CrossRef]
- Chen, Y.J.; Liu, Y.J.; Yang, H.J.; Yuan, Y.; Liu, F.J.; Tian, L.X.; Liang, G.Y.; Yuan, R.M. Effect of dietary oxidized fish oil on growth performance, body composition, antioxidant defence mechanism and liver histology of juvenile largemouth bass Micropterus salmoides. Aquac. Nutr. 2012, 18, 321–331. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Zhao, L.; Liang, J.; Liu, H.; Gong, C.; Huang, X.; Hu, Y.; Liu, Q.; He, Z.; Zhang, X.; Yang, S.; et al. Yinchenhao Decoction ameliorates the high-carbohydrate diet induced suppression of immune response in largemouth bass (Micropterus salmoides). Fish Shellfish Immunol. 2022, 125, 141–151. [Google Scholar] [CrossRef]
- Zhao, X.; Li, L.; Li, C.; Liu, E.; Zhu, H.; Ling, Q. Heat stress-induced endoplasmic reticulum stress promotes liver apoptosis in largemouth bass (Micropterus salmoides). Aquaculture 2022, 546, 737401. [Google Scholar] [CrossRef]
- Liang, H.; Xu, P.; Xu, G.; Zhang, L.; Huang, D.; Ren, M.; Zhang, L. Histidine Deficiency Inhibits Intestinal Antioxidant Capacity and Induces Intestinal Endoplasmic-Reticulum Stress, Inflammatory Response, Apoptosis, and Necroptosis in Largemouth Bass (Micropterus salmoides). Antioxidants 2022, 11, 2399. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Yu, H.; Zhang, L.; Chen, P.; Liang, X.; Cao, A.; Han, J.; Wu, X.; Zheng, Y.; Qin, Y.; Xue, M. Dietary Bile Acids Enhance Growth, and Alleviate Hepatic Fibrosis Induced by a High Starch Diet via AKT/FOXO1 and cAMP/AMPK/SREBP1 Pathway in Micropterus salmoides. Front. Physiol. 2019, 10, 1430. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Yu, H.H.; Liang, X.F.; Chen, P.; Wu, X.F.; Zheng, Y.H.; Luo, L.; Qin, Y.C.; Long, X.C.; Xue, M. Dietary supplementation of Grobiotic®-A increases short-term inflammatory responses and improves long-term growth performance and liver health in largemouth bass (Micropterus salmoides). Aquaculture 2019, 500, 327–337. [Google Scholar] [CrossRef]
- Xie, S.; Yin, P.; Tian, L.; Liu, Y.; Niu, J. Lipid metabolism and plasma metabolomics of juvenile largemouth bass Micropterus salmoides were affected by dietary oxidized fish oil. Aquaculture 2020, 522, 735158. [Google Scholar] [CrossRef]
- Yu, L.L.; Yu, H.H.; Liang, X.F.; Li, N.; Wang, X.; Li, F.H.; Wu, X.F.; Zheng, Y.H.; Xue, M.; Liang, X.F. Dietary butylated hydroxytoluene improves lipid metabolism, antioxidant and anti-apoptotic response of largemouth bass (Micropterus salmoides). Fish Shellfish Immunol. 2018, 72, 220–229. [Google Scholar] [CrossRef] [PubMed]
- Hu, Q.; Wang, H.; He, C.; Jin, Y.; Fu, Z. Polystyrene nanoparticles trigger the activation of p38 MAPK and apoptosis via inducing oxidative stress in zebrafish and macrophage cells. Environ. Pollut. 2021, 269, 116075. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Liu, Q.; Han, J.; Feng, J.; Guo, T.; Li, Z.; Min, F.; Jin, R.; Peng, X. N-Acetylcysteine Inhibits Patulin-Induced Apoptosis by Affecting ROS-Mediated Oxidative Damage Pathway. Toxins 2021, 13, 595. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Wang, W.; Mao, X.; Zhang, R.; Zhou, X.X.; Liu, Y.; Zhou, H.; Jia, J.; Yan, B. Nanoplastic Exposure at Environmental Concentrations Disrupts Hepatic Lipid Metabolism through Oxidative Stress Induction and Endoplasmic Reticulum Homeostasis Perturbation. Environ. Sci. Technol. 2023, 57, 14127–14137. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Ye, Y.; Rihan, N.; Zhu, B.; Jiang, Q.; Liu, X.; Zhao, Y.; Che, X. Polystyrene nanoplastics induce lipid metabolism disorder and alter fatty acid composition in the hepatopancreas of Pacific whiteleg shrimp (Litopenaeus vannamei). Sci. Total Environ. 2024, 906, 167616. [Google Scholar] [CrossRef]
- Mallik, A.; Xavier, K.A.M.; Naidu, B.C.; Nayak, B.B. Ecotoxicological and physiological risks of microplastics on fish and their possible mitigation measures. Sci. Total Environ. 2021, 779, 146433. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Z.; Liao, R.; Shi, Y.; Li, J.; Cao, J.; Liao, B.; Wu, J.; Li, G. Polystyrene nanoplastics induce apoptosis of human kidney proximal tubular epithelial cells via oxidative stress and MAPK signaling pathways. Environ. Sci. Pollut. Res. Int. 2023, 30, 110579–110589. [Google Scholar] [CrossRef] [PubMed]
- Ragusa, A.; Matta, M.; Cristiano, L.; Matassa, R.; Battaglione, E.; Svelato, A.; Luca, C.D.; Avino, S.D.; Gulotta, A.; Rongioletti, M.C.A.; et al. Deeply in Plasticenta: Presence of Microplastics in the Intracellular Compartment of Human Placentas. Int. J. Environ. Res. Public Health 2022, 19, 11593. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Cnop, M.; Foufelle, F.; Velloso, L.A. Endoplasmic reticulum stress, obesity and diabetes. Trends Mol. Med. 2012, 18, 59–68. [Google Scholar] [CrossRef] [PubMed]
- Xu, W.; Wang, C.; Hua, J. X-box binding protein 1 (XBP1) function in diseases. Cell Biol. Int. 2021, 45, 731–739. [Google Scholar] [CrossRef] [PubMed]
- Tabas, I.; Ron, D. Integrating the mechanisms of apoptosis induced by endoplasmic reticulum stress. Nat. Cell Biol. 2011, 13, 184–190. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Marciniak, S.J.; Ron, D. Endoplasmic reticulum stress signaling in disease. Physiol. Rev. 2006, 86, 1133–1149. [Google Scholar] [CrossRef] [PubMed]
- Kemper, C.; Sack, M.N. Linking nutrient sensing, mitochondrial function, and PRR immune cell signaling in liver disease. Trends Immunol. 2022, 43, 886–900. [Google Scholar] [CrossRef] [PubMed]
- Wu, D.; Lu, X.; Dong, L.-X.; Tian, J.; Deng, J.; Wei, L.; Wen, H.; Zhong, S.; Jiang, M. Nano polystyrene microplastics could accumulate in Nile tilapia (Oreochromis niloticus): Negatively impacts on the liver and intestinal health through water exposure. J. Environ. Sci. 2024, 137, 604–614. [Google Scholar] [CrossRef]
- Gu, X.; Fu, H.; Sun, S.; Qiao, H.; Zhang, W.; Jiang, S.; Xiong, Y.; Jin, S.; Gong, Y.; Wu, Y. Dietary cholesterol-induced transcriptome differences in the intestine, hepatopancreas, and muscle of Oriental River prawn Macrobrachium nipponense. Comp. Biochem. Physiol. Part D Genom. Proteom. 2017, 23, 39–48. [Google Scholar] [CrossRef] [PubMed]
- Shimano, H.; Sato, R. SREBP-regulated lipid metabolism: Convergent physiology—Divergent pathophysiology. Nat. Rev. Endocrinol. 2017, 13, 710–730. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Chen, Z.; Lam, V.; Han, J.; Hassler, J.; Finck, B.N.; Davidson, N.O.; Kaufman, R.J. IRE1α-XBP1s induces PDI expression to increase MTP activity for hepatic VLDL assembly and lipid homeostasis. Cell Metab. 2012, 16, 473–486. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Lee, A.H.; Scapa, E.F.; Cohen, D.E.; Glimcher, L.H. Regulation of hepatic lipogenesis by the transcription factor XBP1. Science 2008, 320, 1492–1496. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Zheng, W.; Sun, Q.; Li, L.; Cheng, Y.; Chen, Y.; Lv, M.; Xiang, X. Role of endoplasmic reticulum stress in hepatic glucose and lipid metabolism and therapeutic strategies for metabolic liver disease. Int. Immunopharmacol. 2022, 113 Pt B, 109458. [Google Scholar] [CrossRef] [PubMed]
- Celik, C.; Lee, S.Y.T.; Yap, W.S.; Thibault, G. Endoplasmic reticulum stress and lipids in health and diseases. Prog. Lipid Res. 2023, 89, 101198. [Google Scholar] [CrossRef] [PubMed]
- Shan, B.; Wang, X.; Wu, Y.; Xu, C.; Xia, Z.; Dai, J.; Shao, M.; Zhao, F.; He, S.; Yang, L.; et al. The metabolic ER stress sensor IRE1α suppresses alternative activation of macrophages and impairs energy expenditure in obesity. Nat. Immunol. 2017, 18, 519–529. [Google Scholar] [CrossRef] [PubMed]
Pathway | Gene 1 | Primer Sequence | Products | Sources |
---|---|---|---|---|
β-actin F | ATCGCCGCACTGGTTGTTGAC | 336 | [29] | |
β-actin R | CCTGTTGGCTTTGGGGTTC | |||
ER stress | chopα F | GATGAGCAGCCTAAGCCACG | 153 | [30] |
chopα R | AACAGGTCAGCCAAGAAGTCG | |||
chopβ F | GTATCTTCATTACCAGTCCACCAG | 156 | / | |
chopβ R | AGGCGTTTCTTTGCTTTCC | |||
Jnk-1 F | TGCACTACCTGAGCCACTTG | 505 | [31] | |
Jnk-1 R | TGTGCTTCCTGGCTGATGTT | |||
grp78 F | ATCTGGGTGGTGGCACTTTT | 91 | [31] | |
grp78 R | CCCAGATGAGTGTCACCGTT | |||
perk F | CCACCGCAGAGCAGATGTAA | 117 | [31] | |
perk R | TGCTGGAGTCATCCTACCGA | |||
atf4 F | GCGGACATTTGTGTTGCACT | 101 | [31] | |
atf4 R | CTGTCCTGCCAGGTGATGAA | |||
ire-1 F | CTGCCAGATCCGCATACACT | 96 | [31] | |
ire-1 R | GGTGTCCACTCTTGAAGGCA | |||
xbp-1 F | ACACCCTCGACACGAAAGA | 213 | [32] | |
xbp-1 R | AGAATGCCCAGTAGCAAATC | |||
atf6 F | GACGCCCCGCATAAGAGTAA | 107 | [31] | |
atf6 R | GCAGACTTGAGGAGAGCTGG | |||
eif2α F | CCTCGTTTGTCCGTCTGTATC | 92 | [30] | |
eif2α R | GCTGACTCTGTCGGCCTTG | |||
Lipid metabolism | srebp-1 F | AGTCTGAGCTACAGCGACAAGG | 127 | [33] |
srebp-1 R | TCATCACCAACAGGAGGTCACA | |||
acaca F | CTAACTGCCATCCCATGTGC | 113 | / | |
acaca R | CGGATAATGGCTCGCACAAA | |||
cpt-1 F | CATGGAAAGCCAGCCTTTAG | 128 | [34] | |
cpt-1 R | GAGCACCAGACACGCTAACA | |||
fasn F | ATCCCTCTTTGCCACTGTTG | 121 | [34] | |
fasn R | GAGGTGATGTTGCTCGCATA | |||
srebf-2 F | TTGACCACCCTCTGCCTAAG | 178 | / | |
srebf-2 R | CCCTTGTTCAGCCAGTTTCC | |||
hmgcr F | GGTGGAGTGCTTAGTAATCGG | 125 | [35] | |
hmgcr R | ACGCAGGGAAGAAAGTCAT | |||
ppar-γ F | CCTGTGAGGGCTGTAAGGGTTT | 118 | [36] | |
ppar-γ R | TTGTTGCGGGACTTCTTGTGA | |||
Apoptosis | foxo1 F | CTATGAATGGCCGCTTGCTCA | 164 | [35] |
foxo1 R | TCGTCCATATCCGTTGGTGTTG | |||
caspase-3 F | GCTTCATTCGTCTGTGTTC | 98 | [36] | |
caspase-3 R | CGAAAAAGTGATGTGAGGTA | |||
caspase-8 F | GAGACAGACAGCAGACAACCA | 195 | [36] | |
caspase-8 R | TTCCATTTCAGCAAACACATC | |||
caspase-9 F | CTGGAATGCCTTCAGGAGACGGG | 125 | [36] | |
caspase-9 R | GGGAGGGGCAAGACAACAGGGTG | |||
Bax F | AAATGTGGGAGCCAGACATC | 112 | [34] | |
Bax R | AGGCTCCTGGTCTCCTTCTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, K.; Chen, J.; Wang, Y.; Chen, M.; Bao, X.; Chen, X.; Xie, S.; Lin, Z.; Yu, Y. Investigating Polystyrene Nano-Plastic Effects on Largemouth Bass (Micropterus salmoides) Focusing on mRNA Expression: Endoplasmic Reticulum Stress and Lipid Metabolism Dynamics. Fishes 2024, 9, 342. https://doi.org/10.3390/fishes9090342
Zhang K, Chen J, Wang Y, Chen M, Bao X, Chen X, Xie S, Lin Z, Yu Y. Investigating Polystyrene Nano-Plastic Effects on Largemouth Bass (Micropterus salmoides) Focusing on mRNA Expression: Endoplasmic Reticulum Stress and Lipid Metabolism Dynamics. Fishes. 2024; 9(9):342. https://doi.org/10.3390/fishes9090342
Chicago/Turabian StyleZhang, Kaipeng, Jing Chen, Yamin Wang, Mingshi Chen, Xiaoxue Bao, Xiaotong Chen, Shan Xie, Zhenye Lin, and Yingying Yu. 2024. "Investigating Polystyrene Nano-Plastic Effects on Largemouth Bass (Micropterus salmoides) Focusing on mRNA Expression: Endoplasmic Reticulum Stress and Lipid Metabolism Dynamics" Fishes 9, no. 9: 342. https://doi.org/10.3390/fishes9090342
APA StyleZhang, K., Chen, J., Wang, Y., Chen, M., Bao, X., Chen, X., Xie, S., Lin, Z., & Yu, Y. (2024). Investigating Polystyrene Nano-Plastic Effects on Largemouth Bass (Micropterus salmoides) Focusing on mRNA Expression: Endoplasmic Reticulum Stress and Lipid Metabolism Dynamics. Fishes, 9(9), 342. https://doi.org/10.3390/fishes9090342