Next Article in Journal
Research Progress on Nutritional Requirements and Formulated Feeds for Siniperca: A Comprehensive Review
Previous Article in Journal
Molecular Barcoding Identification of the Invasive Blue Crabs Along Tunisian Coast
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Comparative Physiological and Transcriptome Analyses Reveal the Responses to Ocean Acidification Challenge of Mactra veneriformis with Different Shell Colors

1
Tianjin Key Laboratory of Aqua-Ecology and Aquaculture, College of Fisheries, Tianjin Agricultural University, Tianjin 300392, China
2
Key Laboratory of Smart Breeding (Co-Construction by Ministry and Province, Ministry of Agriculture and Rural Affairs), Tianjin Agricultural University, Tianjin 300392, China
3
Marine Science Research Institute of Shandong Province (National Oceanographic Center, Qingdao), Qingdao 266104, China
4
Guangdong Provincial Key Laboratory of Applied Marine Biology, South China Sea Institute of Oceanology, Chinese Academy of Sciences, Guangzhou 510301, China
5
Key Laboratory of Tropical Marine Bio-Resources and Ecology, South China Sea Institute of Oceanology, Chinese Academy of Sciences, Guangzhou 510301, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Fishes 2024, 9(12), 486; https://doi.org/10.3390/fishes9120486
Submission received: 28 October 2024 / Revised: 20 November 2024 / Accepted: 26 November 2024 / Published: 29 November 2024

Abstract

:
Mactra veneriformis is highly susceptible to ocean acidification (OA) due to its low shell hardness during its rapid growth period. In this study, oxygen consumption rate, ammonia excretion rate, and transcriptome sequencing of mantle tissue analyses were conducted in white and purple shell-color populations of M. veneriformis under OA stress (pH = 7.6). The findings indicated a significant rise in oxygen consumption rates and ammonia excretion rates following acidification in both the two shell colors, while the clams with purple color showed comparatively lower basal metabolic levels. Transcriptomic analyses demonstrated the expression of key genes related to fatty acid synthesis were significantly inhibited, whereas genes involved in calcification, osmoregulation, and immune response were upregulated under OA exposure in the two shell-color groups. However, some genes such as CA and HSP showed a population-specific response between the two shell-color populations. KEGG enrichment analysis revealed that the MAPK signaling pathway and protein processing in the endoplasmic reticulum were significantly enriched in the two acidification groups. This study provides valuable insights into the response of M. veneriformis to OA stress and also helps to predict the future breeding of valuable strains of M. veneriformis.
Key Contribution: Our study enhances comprehension of the response of M. veneriformis with different shell colors to OA stress and also provides valuable insight for potential selective breeding strategies in this species.

1. Introduction

The concentration of carbon dioxide (CO2) in the atmosphere has experienced an exponential increase since the beginning of the Industrial Revolution, primarily due to anthropogenic activities such as fossil fuel consumption and deforestation [1]. As of March 2024, the CO2 concentration in the atmosphere had increased from 280 ppm before the industrial revolution (1850) to 425.38 ppm [2]. Increased concentrations of CO2 are implicated in driving the greenhouse effect, leading to elevated temperatures in both the atmosphere and oceans. The notion of ocean acidification (OA) was originally proposed by Caldeira and Wickett in 2003; approximately 33% of atmospheric CO2 is absorbed by the ocean, leading to the formation of carbonic acid (H2CO3). This process induces a decline in seawater pH, as well as reductions in carbonate concentration (CO32−) and calcium carbonate (CaCO3) saturation state [3]. The pH of the surface ocean has already experienced a decline of 0.1 units since 1750, ultimately reaching pH 8.1 in 2013 [4]. By the end of 2100 and 2300, the pH levels of the ocean’s surface are expected to undergo a decline by approximately 0.3–0.4 and 0.7–0.8 units, respectively, resulting in increased acidity levels surpassing those observed over the past 400,000 years [5].
Shellfish, especially bivalves, are an important source of dietary animal protein for humans [6], accounting for about 15% of the average per capita animal protein for 1.5 billion people [7]. In addition to their economic importance, marine bivalves exert a substantial influence on marine and coastal ecosystems by serving as habitats for numerous other invertebrates and facilitating the linkage between organic and inorganic carbon cycles. Mollusks, among invertebrates, are considered to be the most susceptible to OA; the shell formation of marine calcifiers may be impaired by the effects of OA, including increased acidity and decreased CO32− concentration, which can accelerate shell dissolution and reduce the supply of substances [8]. In addition, disruptions in the chemical balance of seawater can significantly impede the maintenance of intracellular and extracellular acid–base balance; bivalves may allocate their entire energy budget towards maintaining extracellular pH in order to enhance calcification production under specific environmental conditions [5]. Trade-offs among limited energy resources across different biological processes may exert influences on the growth, reproduction, and immune response of bivalves [1,9]. In particular, a compromised immune response may pose a potential threat by augmenting the vulnerability of bivalves to disease [10,11,12]. Numerous studies have documented the detrimental effects of OA on all life stages of bivalves; it may cause growth [13] and developmental retardation [14], reproduction [15], shell dissolution or reduced calcification rate [8], and immunity reduction [12].
The clam Mactra veneriformis (Mollusca, Bivalvia, Mactridae), a commercially important species, exhibits a wide distribution across the tidal flats in China, Korea, and Japan [16]. The species is typically found inhabiting burrows in sandy or muddy sand substrates, ranging from the mid-tide to low-tide levels and extending towards shallow waters. M. veneriformis is commonly used in biomonitoring programs such as heavy metals and persistent organic pollution in the marine environment [17,18]. In natural habitats, M. veneriformis displays two different shell colors, white and purple. However, limited research has been conducted on the two populations with different shell colors. We have conducted an analysis on color distribution and metallic elements of shells in two shell-colors of Mactra veneriformis in a previous study [19]; the results showed that there are significant differences between them. The population with a purple shell color exhibited significant color on both the inner and outer sides of the shell, with the majority of pigmentation concentrated at the interfaces between the prismatic layer and the horny layer, as well as between the prismatic layer and the nacreous layer. Contrarily, no pigment distribution was observed in either layer in the white shell-color population. Additionally, significant differences in metals content were observed in the two populations. However, the response of different populations to OA is still unknown.
In recent years, transcriptome sequencing (RNA-seq) is considered to be a powerful tool and is widely used to understand the genetic pathways involved in the responses of marine bivalves to OA stress. The current investigation utilized RNA-seq analysis to reveal differently expressed genes (DEGs) among two different shell colors of M. veneriformis under OA, and the physiology responses were evaluated by quantifying the oxygen consumption and ammonia excretion rates.

2. Materials and Methods

2.1. M. veneriformis Collection and Rearing

M. veneriformis individuals with two different colors were collected on 8 July 2023 from Dongjianggang, Tianjin (longtiude:117°82′ E, latitude:39.01′ N). The clams of white color had an average shell length of 24.93 ± 0.13 mm and average weight of 5.01 ± 0.56 g, while the clams of purple color had an average shell length of 26.31 ± 0.16 mm and average weight of 5.36 ± 0.34 g, respectively. All the clams were acclimated in artificial seawater at a temperature of 24 ± 0.1 °C, pH 8.12 ± 0.1, salinity of 25 ppt, and fed with Chlorella pacifica once a day for 1 week before processing.

2.2. Experimental Set-Up

Following a one-week adaptation period, the healthy clams were randomly assigned to four groups and introduced into two distinct environments: the two control groups with different shell colors (Con_w and Con_p) at pH 8.1 (current concentration of pCO2) and two acidification groups with different shell colors (Acd_w and Acd_p) at pH 7.6 (representing the predicted pH level of water surface of the twenty-first century) [20].
There were three replicates of 80-L tanks for each treatment, and each tank contained 65 individuals. The control groups were continuously supplied with ambient air. For the acidification groups (pH = 7.60), air–CO2 mixtures were introduced into the tanks via bubbling. The water was refreshed every day with pre-bubbled seawater, while the pH was monitored using a pH meter three times a day during the experiment. The treatment lasted 30 days for sample collection. We monitored the total alkalinity (TA) twice a week though the acid–base titration method [21], and the daily measurement of other seawater parameters, including temperature, salinity, and dissolved oxygen (DO), was also conducted. The CO2SYS spreadsheet was utilized to calculate the parameters of the carbonate system. The seawater physicochemical parameters are summarized in Table 1.

2.3. Oxygen Consumption Rate and Ammonia Excretion Rate Measurement

Both the oxygen consumption rate (RO) and ammonia excretion rates (RN) were determined on days 15 and 30 after acidification stress. Two clams were sealed for 2 h in a chamber filled with oxygen saturated seawater. The concentration of dissolved oxygen (DO) in the water was measured at the start and after 2 h according to standard procedure [22], while the amount of ammonia produced in 2 h was determined using the phenol- hypochlorite method [23]. The measurements were performed in triplicate, with a control chamber that did not contain any clams. Subsequently, the soft tissues of each clam were dried at 90 °C until a constant weight to determine their dry mass.
The RO, RN per unit dry mass, and the O:N ratio (O/N) were calculated according to the formulas below:
RO = [(Ot − O0-ΔOC) × V]/(W × t)
RN = [(Nt − N0-ΔNC) × V]/(W × t)
O/N = (RO/16)/(RN/14)
where O0 (mg/L) and Ot (mg/L) is the DO concentration at the beginning and the end of the experiment, respectively; ΔOC (mg/L) represents the variation of DO concentration in the empty chamber; N0 (mg/L) and Nt (mg/L) is the ammonia nitrogen concentration at the beginning and the end of the experiment, respectively; ΔNC (mg/L) represents the variation of ammonia nitrogen concentration in the empty chamber; V (L) is seawater volume; W (g) represents the mean dry weight in experimental group; t (h) is the duration of experiment.

2.4. Sample Preservation, RNA Extraction, and Transcriptome Sequencing

The mantles of M. veneriformis were sampled immediately after acidification stress; three samples were selected, respectively, from each group (Acd_w, Acd_p, Con_w, and Con_p), and each sample was mixed by three individuals. The tissues were put into liquid nitrogen after collection and stored at −80 °C for RNA extraction. The frozen samples were finely pulverized into a powder using liquid nitrogen. Then, the Trizol reagent (Invitrogen, Waltham, MA, USA) was employed for total RNA extraction following the manufacturer’s instructions. Bioanalyzer 2100 platforms were used to confirm RNA concentration and purity.
Each RNA sample was reverse transcribed with the PrimeScriptTM RT reagent Kit with gDNA Eraser (Takara, Tokyo, Japan) to obtain cDNA. Then, 250–350 bp cDNA fragments were selected and purified by AMPure XP beads and amplified with PCR primer to construct a library. After being quantified by Qubit 4.0, twelve libraries of M. veneriformis (Acd_p1, Acd_p2, Acd_p3, Acd_w1, Acd_w2, Acd_w3, Con_p1, Con_p2, Con_p3, Con_w1, Con_w2, Con_w3) were sequenced at LC-Bio Technology CO., Ltd. (Hangzhou, China) using Illumina NovaSeq 6000 (Santa Clara, CA, USA).

2.5. Assembly and Functional Annotation

The raw data underwent a quality assurance process to ensure the acquisition of clean reads, and low-quality reads were removed, such as adapter, PloyA and PloyG, by Cutadapt (Version: 1.9). Then, sequence quality was verified using FastQC (Version: 0.11.9). The Q20, Q30, and GC content were subsequently calculated. Finally, we aligned reads of all samples to the <Mactra veneriformis> reference genome using HISAT2 (Version: 2.2.1) package. The approach involved an initial step of discarding a fraction of the reads using quality information associated with each read, followed by mapping the remaining reads to the reference genome. HISAT2 enables the alignment of multiple reads (default up to 20) and allows a maximum of two mismatches during read-to-reference mapping. Additionally, HISAT2 constructed a database containing potential splice junctions and validates them by comparing unmapped reads with this collection of presumed junctions. The assembly of the mapped reads from each sample was performed using StringTie [24] with default parameters. Afterwards, the comprehensive transcriptome was reconstructed by merging the transcriptomes of all samples using gffcompare software (Version: 0.9.8). For homology annotation, all assembled unigenes were aligned against the public databases, including Nr, Swiss-Prot, Pfam, GO, EggNOG, and KEGG databases, using DIAMOND (Version: 2.0.15) with a threshold of Evalue < 0.00001.

2.6. Differential Expression and Function Enrichment Analysis

StringTie and ballgown (Version: 3.19) were employed to evaluate the expression levels of all transcripts. Then, the abundance of mRNA expressions was determined by FPKM values calculation. We used DEseq [25] to identify the differentially expressed genes (DEGs) between different groups. The genes that exhibited a false discovery rate (FDR) below 0.05 and an absolute fold change of at least 2 were identified as differentially expressed genes.

2.7. Quantitative Real-Time PCR Validation

To verify the accuracy of transcriptome sequencing results, 12 differentially expressed genes associated with acidification stress response were selected for quantitative real-time PCR (RT-qPCR) validation (Table 2). The total RNA was reverse transcribed into cDNA using the PrimeScriptTM RT reagent Kit with gDNA Eraser (Takara, Tokyo, Japan). The GAPDH gene was used as the internal control for RT-qPCR analysis. Primers (Table 2) were designed for these genes using Primer3-BLAST online software [26]. The RT-qPCR reaction was conducted in a total volume of 20 μL, including 10 μL SYBRGreen (Takara, Tokyo, Japan), 7 μL ddH2O, 1 μL cDNA template, and 1 μL forward and reverse primers (200 nM) with the following cycling profile: 95 °C for 3 Min, 39 cycles of 95 °C for 10 s, 60 °C for 30 s, and 72 °C for 30 s. Each sample was processed in triplicate on the BIO-RAD CFX Connect Real-Time System. The relative expression levels of the target genes were determined by subjecting all data to analysis using the 2−ΔΔCT method.

3. Results

3.1. Oxygen Consumption and Ammonia Excretion

As shown in Table 3 and Table 4, for both the shell-color clams, the oxygen consumption rates and ammonia excretion rates were significantly higher in the acidification groups compared to the control groups at 15 d and 30 d (p < 0.05), and there were no significant differences in these two indexes between 15 d and 30 d after acidification (p < 0.05). The O/N ratios were significantly lower in the acidification groups compared to the control groups at 15 d and 30 d in both the two shell-colors of clams (p < 0.05), and there were no significant differences in the index between 15 d and 30 d after acidification. Moreover, the oxygen consumption rates and O/N ratios of the white color groups were significantly higher than the purple groups both at 15 d and 30 d in pH 7.6 (p < 0.05). However, no significant differences in ammonia excretion rates were found between the two different color groups (p > 0.05).

3.2. Transcriptome Sequencing, Assembly, and Gene Function Annotation

A total of 42,127,851.67 average clean reads each replicate group were filtered from 43,327,351.50 average raw reads per replicate group, with Q20 (%) varying from 99.10% to 99.21%. The average of the total mapped ratio for the four groups exceeded 97.24%, thereby satisfying the preliminary requirements of transcriptomic analysis (Table 5). The library was generated using Illumina sequencing, resulting in the assembly of 21,113 unigenes with an average length of 2017 bp (Table 6). The raw sequence data have been submitted to the NCBI Gene Expression Omnibus (GEO) datasets with accession number <GSE280202>.
25,145 genes were discovered in this study, and their functions were annotated using databases including Nr, Swiss-Prot, Pfam, eggNOG, GO, and KEGG. A total of 14,904 genes of M. veneriformis were annotated in the GO database, accounting for 59.27%. Based on KEGG analysis, 6037 single genes were annotated, approximately 24.01% (Table 7).

3.3. Analysis of DEGs Between Different Groups

A total of 1488 unigenes were identified as significant DEGs among the four experimental groups. To elucidate the response mechanisms of M. veneriformis with different colors against acidification stress, a comparative analysis was conducted on the significant DEGs between the two acidification groups (Acd_p and Acd_w) and their control groups. There were 643 DEGs (242 upregulated and 401 downregulated) differentially expressed in Acd_p vs. Con_p, while 406 DEGs (201 upregulated and 205 downregulated) were differentially expressed in Acd_w vs. Con_w (Figure 1a,b). In addition, 356 DEGs (185 upregulated and 171 downregulated) were found to be differentially expressed between the two color groups under pH 7.6, while 83 DEGs (53 upregulated and 30 upregulated) were found between the two control groups. (Figure 1c,d). Acd_p vs. Con_p showed the largest number of DEGs relative to the other comparisons.
The numbers of DEGs unique to each pairwise comparison, as well as those shared among multiple comparisons, were summarized using a Venn diagram (Figure 2). Among the DEGs, one unigene was significantly differentially expressed in all groups. There were 39 shared DEGs between Acd_w vs. Con_w and Acd_p vs. Con_p, respectively; most of these genes correspond to lipid metabolism, tyrosine metabolism, and the heat shock protein family.

3.4. Identification of OA-Responsive Genes

To investigate the expression levels of the OA-responsive genes we focused on, further analysis was conducted by creating a hierarchical cluster. The expression profiles of the DEGs were categorized into three main clusters (lipid metabolism-responsive genes, immune-responsive genes, and calcification- and osmotic regulation-related genes) for two color populations under OA stress (Figure 3). The expression of fatty acid synthase (FASN), a key gene related to fatty acid biosynthesis, showed significant downregulation in both two acidification groups, while acetyl-CoA carboxylase (ACC) was also observed to be downregulated in clams with purple shell color. On the other hand, genes related to shell formation and osmotic regulation were upregulated in M. veneriformis under OA stress. Among them, the tyrosinase gene (TYR) was significantly expressed in both acidification groups; carbonic anhydrase (CA) and several members of the solute carrier family were upregulated in the purple shell-color and white shell-color groups, respectively. The expression levels of some immune-responsive genes were found to be upregulated in both shell-color groups under pH 7.6 conditions, suggests that OA stress activates these genes to mitigate damage to itself. Interestingly, we observed an opposite expression pattern of heat shock proteins in the two distinct color groups.

3.5. GO and KEGG Enrichment Analysis

GO enrichment analysis was performed to obtain a comprehensive understanding of the biological functions of DEGs, which can be classified into biological processes, cellular components, and molecular functions. The category of cellular components demonstrated the most significant enrichment of DEGs across all pairwise comparisons. However, the most significantly enriched GO terms varied across the different color groups under OA stress.
In the Acd_p vs. Con_p comparison (Figure 4a), the major biological process terms represented were obsolete oxidation–reduction process (GO:0055114), followed by biological process (GO:0008150) and regulation of transcription DNA-templated (GO:0006355). The major cellular component terms were cytoplasm (GO:0005737), followed by integral component of membrane (GO:0016021) and membrane (GO:0016020). The most strongly represented molecular functions were ATP binding (GO:0005524), followed by metal ion binding (GO:0046872) and protein binding (GO:0005515). In the Acd_w vs. Con_w comparison (Figure 4b), the major biological process terms represented was cell adhesion (GO:0007155), followed by obsolete oxidation–reduction process (GO:0055114) and cell migration (GO:0016477). The major cellular component terms were integral component of membrane (GO:0016021), followed by membrane (GO:0016020) and cytoplasm (GO:0005737). The most strongly represented molecular functions were calcium ion binding (GO:0005509), followed by protein binding (GO:0005515) and DNA binding (GO:0003677). Several terms such as obsolete oxidation–reduction process, metal ion binding, ATP binding, cytoplasm, and protein binding identified in the enrichment analysis may play important roles in lipid metabolism, calcification and osmotic regulation, and regulating immunity against OA.
The KEGG analysis revealed that 60 pathways were significantly enriched in Acd_p vs. Con_p, 48 in Acd_w vs. Con_w; these pathways are involved in diverse cellular processes, metabolism, biosynthesis, genetic information processing, and organismal systems (Figure 5). Among all the categories, the metabolism category exhibited the highest number of DEGs, which further classified into major subgroups: Fatty acid biosynthesis, Amino sugar and nucleotide sugar metabolism, Glutathione metabolism, and Glucosinolate biosynthesis. However, some differences were observed in these pathways among the acidification groups with the two shell colors. In comparing Acd_p vs. Con_p, the most significant enrichment in pathways was seen in the MAPK signaling pathway (map04016), followed by amino acid sugar and ribose metabolism (map00520) and, finally, fatty acid synthesis (map00061). In comparing Acd_w vs. Con_w, the pathway with the most significantly enriched factor was protein processing in the endoplasmic reticulum (map04141), followed by pathogen interactions (map04626) and, finally, phagocytosis (map04145).

3.6. RT-qPCR Validation

To verify the transcriptome results, we selected 12 genes based on their functions to focus on. Six genes (tyrosinase protein (TYR), caveolin-1-like(CAV1), perlucin-like protein (PLP), immunity adhesion receptor DC-SIGN (DC-SIGN), fatty acid synthase (FASN), and heat shock protein 90 (HSP90)) were associated with OA stress in the white shell color, and six genes (tyrosinase protein (TYR), heat shock 70 kDa protein 12A (HSP70), carbonic anhydrase (CA), neo-calmodulin (CaM), nuclear pore complex protein Nup160 (NUP160), and fatty acid synthase (FASN)) were associated with OA stress in the purple shell color. The expression levels of these genes showed the same trends as those observed from the transcriptome data (Figure 6). This finding implied the reliability of the RNA-seq data.

4. Discussion

4.1. Oxygen Consumption, Ammonia Excretion, and O/N Ratios

Our results showed that the oxygen consumption rate and ammonia excretion rate of the acidification groups with the two shell colors were significantly higher than those of the control groups, indicating that the metabolic traits of M. veneriformis were affected significantly by acidification exposure. The basic metabolic rate of aquatic organisms generally increases in response to environmental stressors, including elevated temperature [27], increased CO2 levels [28], and different modes of transportation [29] within the organism’s tolerance range. The heightened metabolic rate can be regarded as a physiological response to environmental stressors. The O/N ratio is purported to provide an indication of the relative utilization of protein in the process of energy metabolism [30]. The decrease in the O/N value indicates a higher protein proportion relative to the breakdown of lipids and/or carbohydrates [29]. We also observed a significant decline in the O/N ratio of both the color groups under acidification stress in this study, indicating that acidification exerts an influence on energy metabolism and induces a shift in the clams’ metabolic preference from lipid metabolism towards protein metabolism. The utilization of protein as an energy source generally indicates that the organism is experiencing stressful conditions. For instance, a significant decrease in O/N ratio was observed in Pinctada maxima after transportation [30]. In our study, the clams with purple color exhibited lower levels of RO and O/N ratio compared to those with white color, both before and after acidification. The results suggest that variations exist among distinct shell-color populations in their basal metabolism, particularly under acidification conditions, which may facilitate their survival under conditions of limited oxygen availability [31]. We found that purple populations in high-density farmed environments had lower mortality rates compared to white populations (unpublished data). We hypothesize that the metabolic characteristics of purple color populations may help their higher survival rate and tolerance to OA.

4.2. Analysis of DEGs Related to Lipid Metabolism

Lipids serve as both an energy source and storage mechanism, while also contributing to the structural integrity of biological membranes by acting as selective filters for various exogenous substances [32]. Bivalves heavily rely on lipids as a primary source of energy [33,34]. In our experiment, the KEGG enrichment analysis revealed a significant enrichment of DEGs in the lipid metabolism process, highlighting a strong association between OA exposure and lipid metabolism levels. The expression of enzyme FASN, key enzymes involved in fatty acid synthesis, was significantly inhibited by OA in both the color groups. Moreover, a significant decrease in ACC was also observed in the purple shell-color group under OA stress. As a homodimer in animal tissues, FASN catalyzes the synthesis process of saturated fatty acids, including myristate, palmitate, and stearate, while acetyl-CoA, malonyl-CoA, and NADPH serve as substrates in this process [35]. The reaction catalyzed by ACC serves as the initial crucial step in the biosynthesis of long chain fatty acids [36,37].
OA, temperature, and persistent organic pollutants (POPs) stress have been found in marine organisms to cause lipid metabolism disorders. For example, the downregulation of FASN was found in Chlamys farreri [38] under POPs exposure, while excessive accumulation of TGs was detected in the ovarian tissue. A similar result has been seen in purple-hinge rock scallop [1] that high temperature and high pCO2 led to a significant increase in total lipids and even reorganization of fatty acid chains. Aquatic animals need more energy to maintain physiological processes such as calcification and acid–base balance under OA exposure. Our results demonstrated that M. veneriformis of both of the two colors employ shared adaptive strategies to OA stress: genes related to FASN were downregulated, which suggests clams conserve energy in metabolic activities as a survival technique for coping with environmental challenges. Moreover, the observed downregulation of FASN in mammals is likely attributed to the intracellular accumulation of high lipid content [39]. However, further in-depth research is imperative to substantiate this conjecture.

4.3. Analysis of DEGs Related to Calcification and Osmoregulation

Our results demonstrated a significant upregulation of TYR in response to OA stress in both of the two color groups. TYRS belong to the type-3 copper protein superfamily and possess two conserved domains for binding copper, namely Cu (A) and Cu (B) [40]. Several studies had reported that TYRS were closely associated with the shell formation of bivalves. Furthermore, recent research utilizing CRISPR/Cas9 technology to knockout TYRS had further confirmed its role in the early shell calcification of mollusks [41]. High expression of TYRS has been found in early larvae stages, such as in Mytilus galloprovincialis [42] and Crassostrea gigas [43]. Under ocean acidification stress, the expression of TyrA1 mRNA in Crassostrea angulata was predominantly observed during the trochophore and early D-veliger stages, exhibiting particularly elevated levels in the trochophore stage [44]. Meanwhile, the TYR gene has been found to be significantly upregulated compared with the control group under the combined effects of OA and tralopyril in the adult Crassostrea gigas [45]. Moreover, TYRS serve as crucial enzymes that regulate the melanin biosynthetic pathway. They are secreted from the mantle and subsequently transported to the prismatic shell layer, where they actively participate in melanin biosynthesis and contribute to shell pigmentation [46]. Significant expression levels of TYR have been found in different color stains in marine bivalves such as C. gigas [39], Ruditapes philippinarum [47], Meretrix meretrix [48], and Pinctada margaritifera [49]. In our study, the significant difference of TYR expression was observed after acidification in both white and purple color groups, while no differences were found between the control groups. These findings suggest that TYR plays a crucial role in shell formation rather than pigmentation in M. veneriformis, and it could potentially compensate for the damage caused by acidification in both color populations.
In addition, a significant upregulation of CA was observed under acidification stress only in the purple color group. CA, as a family of metalloenzymes that can catalyze the reversible hydration/dehydration reactions of CO2, has been found in virtually all organisms [50]. It plays a crucial role in the regulation of intracellular and extracellular concentrations of CO2, H+, and HCO3 [51] and has been confirmed to involve in biological functions such as pH homeostasis, respiration, bone resorption, or calcification [52]. It has been suggested that CA is involved in the biocalcification process and is essential for shell development in mollusks [53]. Additionally, some members of the solute carrier family were found to be significantly upregulated under OA in the white color population. As a group of ion transport proteins, the solute carrier family plays a key role in bicarbonate transport, which can maintain acid–base balance and is responsible for maintaining intracellular pH [54]. Our findings suggested that both color groups of M. veneriformis employed effective coping strategies to maintain biocalcification and acid–base balance under the OA stress.

4.4. Analysis of DEGs Related to Immune Response

Bivalves possess an intrinsic immune defense system that confers protection against pathogens, thereby safeguarding these marine organisms [55]. HSPs are chaperones proteins with diverse functions, including protein synthesis, folding, assembly, and degradation [56,57]. Under environmental stress, HSPs can preserve cellular integrity against stress-induced damage though binding and stabilize misfolded proteins [58]. Studies have reported that heat shock proteins (HSPs) regulated immune system responses to various stressors in aquatic animals, such as elevated levels of CO2 [59], metal contamination [60], hypoxia [61], and pathogenic infection [62].
In our study, the expression levels of HSP22 and HSP70 were found to be upregulated in response to OA stress in the purple color group, while HSP22 and HSP90 were downregulated in the white color group. These results suggested HSPs played a more active role in protecting the organism of M. veneriformis with purple color against acidification. We also observed upregulation of other immune-related factors in the two shell-color populations, including toll-like receptor 13 (TLR13) and methyltransferase-like protein 24 (METTL24) in the purple color group and carbohydrate sulfotransferase 10 (CHST10), caveolin-1 (CAV1), C-type mannose receptor 2 (MRC2), and immunity adhesion receptor DC-SIGN (DC-SIGN) in the white color group. All of these factors play a crucial role in modulating the immune response of M. veneriformis to OA challenge. Similar results were found in Ruditapes philippinarum [63] and Crassostrea virginica [64]. Immunity pathways were significantly activated in Ruditapes philippinarum transgenerational exposure to OA, and immune factors including toll-like receptor 4 (TLR4) and TNF receptor-associated factor (TRAF) involved in these processes were upregulated. Meanwhile, HSP90 was downregulated, indicating a strong cellular stress response to OA. The results from Crassostrea virginica indicated that prolonged exposure to OA stress for a duration of 10 months led to significant downregulation of most immune factors, not only in larvae but also in adult oysters. These findings suggested that OA compromised the immune function of organisms, rendering them more susceptible.

5. Conclusions

In summary, we analyzed gene expression and physical responses exposed to ocean acidification of M. veneriformis with two colors. The results showed a significant increase in basal metabolism levels in both the two shell-color populations after acidification, while the clams with purple color showed comparatively lower metabolic levels. Transcriptomic analyses demonstrate that the two colors of clams employ shared mechanisms for fatty acid metabolism and shell formation to reduce OA damage to the self, while different osmoregulation and immune response patterns were also found between them. Our results provide useful information related to the response of M. veneriformis to OA stress, and also help predict the future breeding of valuable strains of M. veneriformis.

Author Contributions

Conceptualization, L.C. and G.H.; methodology, L.C. and G.H.; formal analysis, L.C. and G.H.; investigation, L.C., G.H., J.L., S.L., H.L. and X.W.; resources, L.C., G.H. and L.L.; data curation, G.H. and H.W.; writing—original draft preparation, L.C. and G.H.; writing—review and editing, L.C. and G.H.; supervision, L.C.; project administration, L.C.; funding acquisition, Y.G. and W.L. All authors have read and agreed to the published version of the manuscript.

Funding

The project was supported by Open Fund of Key Laboratory of Smart Breeding (Co-construction by Ministry and Province), Ministry of Agriculture and Rural Affairs (2023-TJAUKLSBF-2112); Earmarked fund (CARS-48) from Modern Agroindustry Technology Research System; National Natural Science Foundation of China (42176129); Natural Science Foundation of Guangdong Province (2022A1515010779); Guangdong Provincial Key Laboratory of Applied Marine Biology (2020B1212060058); Key R&D Program of Shandong Province, China (2021LZGC027); Modern Agro-industry Technology Research System in Shandong Province (SDAIT-14-02) and The University Student Innovation Training Program in Tianjin (202410061031).

Institutional Review Board Statement

Since Mactra veneriformis are invertebrates, ethical review and approval were waived for this study. The content of this article does not involve human or animal research in its institutional review board statement.

Informed Consent Statement

This study did not involve humans.

Data Availability Statement

The data presented in this study are available from the first author. The data are contained within the article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Lindsay, A.; Karin, E.; Kram, G.W.; Holtgrieve, A.B.; Courtney, J.F.; Jacqueline, L.; Padilla, G. Ocean acidification and warming effects on the physiology, skeletal properties, and microbiome of the purple-hinge rock scallop. Comp. Biochem. Phys. A 2020, 240, 110579. [Google Scholar]
  2. Earth’s CO2 Home Page. Available online: https://www.co2.earth/ (accessed on 1 March 2024).
  3. Caldeira, K.; Wickett, M.E. Oceanography: Anthropogenic carbon and ocean pH. Nature 2003, 425, 365. [Google Scholar] [CrossRef] [PubMed]
  4. Stocker, T.F.; Qin, D.; Plattner, G.K.; Tignor, M.; Allen, S.K.; Boschung, J.; Nauels, A.; Xia, Y.; Bex, V.; Midgley, P.M. Climate Change 2013: The Physical Science Basis. Contribution of Working Group I to the Fifth Assessment Report of the Intergovernmental Panel on Climate Change; Cambridge University Press: Cambridge, UK; New York, NY, USA, 2013; pp. 1–30. [Google Scholar]
  5. Li, J.; Zhou, Y.Y.; Qin, Y.P.; Wei, J.K.; Shigong, P.Y.; Ma, H.T.; Li, Y.P.; Yuan, X.C.; Zhao, L.Q.; Yan, H.; et al. Assessment of the juvenile vulnerability of symbiont-bearing giant clams to ocean acidification. Sci. Total Environ. 2022, 812, 152265. [Google Scholar] [CrossRef] [PubMed]
  6. Tan, K.S.; Leng, X.; Zhao, Y. Amino acid variations in polymorphic noble scallops, Chlamys nobilis. J. Food Process. Preserv. 2019, 43, e14262. [Google Scholar] [CrossRef]
  7. FAO. FAO Yearbook Fishery and Aquaculture Statistics 2019; Food and Agriculture Organization: Rome, Italy, 2021; 110p. [Google Scholar]
  8. Guo, X.Y.; Huang, M.Q.; Luo, X.; You, W.W.; Caihuan, K. Impact of ocean acidification on shells of the abalone species Haliotis diversicolor and Haliotis discus hannai. Mar. Environ. Res. 2023, 192, 106183. [Google Scholar] [CrossRef]
  9. Schalkhausser, B.; Bock, C.; Stemmer, K.; Brey, T.; Pörtner, H.O.; Lannig, G. Impact of ocean acidification on escape performance of the king scallop, Pecten maximus, from Norway. Mar. Biol. 2013, 160, 1995–2006. [Google Scholar]
  10. Wang, Q.; Cao, R.; Ning, X.; You, L.; Mu, C.; Wang, C.; Wei, L.; Cong, M.; Wu, H.; Zhao, J. Effects of ocean acidification on immune responses of the Pacific oyster Crassostrea gigas. Fish Shellfish Immunol. 2016, 49, 24–33. [Google Scholar] [CrossRef]
  11. Su, W.; Zha, S.; Wang, Y.; Shi, W.; Xiao, G.; Chai, X.; Wu, H.; Liu, G.B. Pyrene exposure under future ocean acidification scenarios weakens the immune responses of blood clam, Tegillarca granosa. Fish Shellfish Immunol. 2017, 63, 465–470. [Google Scholar] [CrossRef]
  12. Castillo, N.; Saavedra, L.M.; Vargas, C.A.; Gallardo, E.C.; Détrée, C. Ocean acidification and pathogen exposure modulate the immune response of the edible mussel Mytilus chilensis. Fish Shellfish Immunol. 2017, 70, 149–155. [Google Scholar] [CrossRef]
  13. Talmage, S.C.; Gobler, C.J. Effects of elevated temperature and carbon dioxide on the growth and survival of larvae and juveniles of three species of northwest Atlantic bivalves. PLoS ONE 2011, 6, e26941. [Google Scholar] [CrossRef]
  14. Wessel, N.; Martin, S.; Badou, A.; Dubois, P.; Huchette, S.; Julia, V.; Nunes, F.; Harney, E.; Paillard, C.; Auzoux-Bordenave, S. Effect of CO2–induced ocean acidification on the early development and shell mineralization of the European abalone (Haliotis tuberculata). J. Exp. Mar. Bio. Ecol. 2018, 508, 52–63. [Google Scholar] [CrossRef]
  15. Boulais, M.; Chenevert, K.J.; Demey, A.T.; Darrow, E.S.; Robison, M.R.; Roberts, J.P.; Volety, A. Oyster reproduction is compromised by acidification experienced seasonally in coastal regions. Sci. Rep. 2017, 7, 13276. [Google Scholar] [CrossRef] [PubMed]
  16. Zhao, X.R.; Wang, Q.; Li, X.F.; Xu, H.; Ren, C.B.; Yang, Y.Y.; Xu, S.H.; Wei, G.X.; Duan, Y.J.; Tan, Z.T.; et al. Norgestrel causes digestive gland injury in the clam Mactra veneriformis: An integrated histological, transcriptomics, and metabolomics study. Sci. Total Environ. 2023, 871, 162110. [Google Scholar] [CrossRef] [PubMed]
  17. Fang, Y.; Yang, H.S.; Liu, B.Z.; Zhang, L.B. Transcriptional response of lysozyme, metallothionein, and superoxide dismutase to combined exposure to heavy metals and bacteria in Mactra veneriformis. Comp. Biochem. Phys. C 2013, 157, 54–62. [Google Scholar] [CrossRef]
  18. Dong, S.H.; Yang, Y.Y.; Cheng, B.; Ren, C.B.; Zhang, H.W.; Xu, H.; Zhu, N.; Wang, W.S.; Dang, Y.J.; Li, M.Z.; et al. Responses of antioxidant defenses in the clam Mactra veneriformis to 2,2′,4,4′-tetrabromodiphenyl ether exposure. Comp. Biochem. Phys. C 2019, 217, 98–105. [Google Scholar] [CrossRef]
  19. He, W.C.; Huang, G.Y.; Liang, J.; Chen, L.M.; Guo, Y.J. Analysis of shell color distribution and metallic elements of shells in surf clam (Mactra veneriformis). Tianjin Agric. Sci. 2024, 30, 35–41. (In Chinese) [Google Scholar]
  20. Matthews, H.D.; Wynes, S. Current global efforts are insufficient to limit warming to 1.5 °C. Science 2022, 376, 1404–1409. [Google Scholar] [CrossRef]
  21. Zang, W.L. Analysis of Fish Culture Water Quality; Beijing Agriculture Press: Beijing, China, 1991. (In Chinese) [Google Scholar]
  22. Stickland, J.; Parsons, T. A practical handbook of seawater analysis. Fish. Res. Board Can. Bull. 1968, 55, 167. [Google Scholar]
  23. Solorzano, L. Determination of ammonia in natural water by the phenolhypochlorite method. Limnol. Oceanogr. 1969, 14, 799–801. [Google Scholar]
  24. Pertea, M.; Kim, D.; Pertea, G.; Leek, J.T.; Salzberg, S.L. Transcript-level expression analysis of RNA-seq experiments with HISA T, StringTie and Ballgown. Nat. Protoc. 2016, 11, 1650–1667. [Google Scholar] [CrossRef]
  25. Anders, A. Analysing RNA-Seq Data with the DESeq Package; European Molecular Biology Laboratory (EMBL): Barcelona, Spain, 2012; pp. 1–25. [Google Scholar]
  26. Primer Designing Tool. Available online: https://www.ncbi.nlm.nih.gov/tools/primer-blast/ (accessed on 15 November 2023).
  27. Kamermans, P.; Saurel, C. Interacting climate change effects on mussels (Mytilus edulis and M. galloprovincialis) and oysters (Crassostrea gigas and Ostreaedulis): Experiments for bivalve individual growth models. Aquat. Living. Resour. 2022, 35, 1. [Google Scholar] [CrossRef]
  28. Matoo, O.B.; Ivanina, A.V.; Ullstad, C.; Beniash, E.; Sokolova, I.M. Interactive effects of elevated temperature and CO2 levels on metabolism and oxidative stress in two common marine bivalves (Crassostrea virginica and Mercenaria mercenaria). Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2013, 164, 545–553. [Google Scholar] [CrossRef] [PubMed]
  29. Zheng, X.; Yin, Z.; Wang, L.F.; Wei, S.K.; Zhang, M.; Shao, X.F.; Vasquez, H.E.; Gu, G.F. Survival and physiological responses of pearl oyster Pinctada maxima seedlings: Comparative analysis of wet (submerged) and dry (waterless) transportation methods. Aquaculture 2025, 594, 741462. [Google Scholar] [CrossRef]
  30. Bayne, B.L.; Brown, D.A.; Burns, K.; Dixon, D.R.; Ivanovici, A.; Livingstone, D.R.; Lowe, D.M.; Moore, M.N.; Stebbing, A.R.D.; Widdows, J. The Effects of Stress and Pollution on Marine Animals; Praeger: Westport, CT, USA, 1985. [Google Scholar]
  31. Richards, J.G. Metabolic and molecular responses of fish to hypoxia. In Fish Physiology; Academic Press: Cambridge, MA, USA, 2009; pp. 443–485. [Google Scholar]
  32. Yoon, D.S.; Kim, D.H.; Kim, J.H.; Sakakura, Y.; Hagiwara, A.; Park, H.G.; Lee, M.C.; Lee, J.S. Interactions between lipid metabolism and the microbiome in aquatic organisms: A review. Mar. Pollut. Bull. 2024, 207, 116858. [Google Scholar] [CrossRef] [PubMed]
  33. Milke, L.M.; Bricelj, V.M.; Parrish, C.C. Growth of post larval sea scallops, Placopecten magellanicus, on microalgal diets, with emphasis on the nutritional role of lipids and fatty acids. Aquaculture 2004, 234, 293–317. [Google Scholar] [CrossRef]
  34. Rocchetta, I.; Mazzuca, M.; Conforti, V.; Ruiz, L.; Balzaretti, V.; Molina, M.D.C.R. Effect of chromium on the fatty acid composition of two strains of Euglena gracilis. Environ. Pollut. 2006, 141, 353–358. [Google Scholar] [CrossRef]
  35. Chirala, S.S.; Wakil, S.J. Structure and function of animal fatty acid synthase. Lipids 2004, 39, 1045–1053. [Google Scholar] [CrossRef]
  36. Tong, L. Acetyl-coenzyme A carboxylase: Crucial metabolic enzyme and attractive target for drug discovery. Cell. Mol. Life. Sci. 2005, 62, 1784–1803. [Google Scholar] [CrossRef]
  37. Waldrop, G.L.; Holden, H.M.; Maurice, M.S. The enzymes of biotin dependent CO2 metabolism: What structures reveal about their reaction mechanisms. Protein. Sci. 2012, 21, 1597–1619. [Google Scholar] [CrossRef]
  38. Xu, R.Y.; Pan, L.Q.; Yang, Y.Y.; Zhou, Y.Y.; Li, D.Y. Temporal transcriptome analysis in female scallop Chlamys farreri: First molecular insights into the disturbing mechanism on lipid metabolism of reproductive-stage dependence under “benzo[a]pyrene exposure”. Sci. Total Environ. 2020, 746, 142032. [Google Scholar] [CrossRef]
  39. Oleksiak, M.F. Changes in gene expression due to chronic exposure to environmental pollutants. Aquat. Toxicol. 2008, 90, 161–171. [Google Scholar] [CrossRef] [PubMed]
  40. Ren, G.; Chen, C.; Jin, Y.F.; Zhang, G.F.; Hu, Y.W.; Shen, W.Y. A novel tyrosinase gene plays a potential role in modification the shell organic matrix of the triangle mussel Hyriopsis cumingii. Front. Physiol. 2020, 11, 100. [Google Scholar] [CrossRef] [PubMed]
  41. Li, Q.; Yu, H.; Li, Q. Dual sgRNA-directed tyrosinases knockout using CRISPR/Cas9 technology in Pacific oyster (Crassostrea gigas) reveals their roles in early shell calcification. Gene 2024, 927, 148748. [Google Scholar] [CrossRef] [PubMed]
  42. Lydia, K.; Mark, C.; Bitter, A.M.; Claudia, A.E.; Carles, P.; Jean, P.G.; Remi, D. Molecular basis of ocean acidification sensitivity and adaptation in Mytilus galloprovincialis. iScience 2020, 25, 104677. [Google Scholar]
  43. Huan, P.; Liu, G.; Wang, H. Identification of a tyrosinase gene potentially involved in early larval shell biogenesis of the Pacific oyster Crassostrea gigas. Dev. Genes Evol. 2013, 223, 389–394. [Google Scholar] [CrossRef]
  44. Yang, B.Y.; Pu, F.; Li, L.L. Functional analysis of a tyrosinase gene involved in early larval shell biogenesis in Crassostrea angulata and its response to ocean acidification. Comp. Biochem. Phys. 2017, 206, 8–15. [Google Scholar] [CrossRef]
  45. Wang, X.; Li, P.; Cao, X.Q.; Liu, B.; He, S.W.; Cao, Z.H.; Xing, S.Y.; Liu, L.; Li, Z.H. Effects of ocean acidification and tralopyril on bivalve biomineralization and carbon cycling: A study of the Pacific Oyster (Crassostrea gigas). Environ. Pollut. 2022, 313, 120161. [Google Scholar] [CrossRef]
  46. Nagai, K.; Yano, M.; Morimoto, K.; Miyamoto, H. Tyrosinase localization in mollusc shells. Comp. Biochem. Physiol. B 2007, 146, 207–214. [Google Scholar] [CrossRef]
  47. Jiang, K.Y.; Jiang, L.W.; Nie, H.T.; Huo, Z.M.; Yan, X.W. Molecular cloning and expression analysis of tyrosinases (tyr) in four shell-color strains of Manila clam Ruditapes philippinarum. PeerJ 2020, 8, e8641. [Google Scholar] [CrossRef]
  48. Yao, H.H.; Cui, B.Y.; Li, X.Y.; Lin, Z.H.; Dong, Y.H. Characteristics of a Novel Tyrosinase Gene Involved in the Formation of Shell Color in Hard Clam Meretrix meretrix. J. Ocean. Univ. China 2020, 19, 183–190. [Google Scholar] [CrossRef]
  49. Auffret, P.; Luyer, J.L.; Koua, M.S.; Quilien, V.; Chin-Long, K.Y. Tracing key genes associated with the Pinctada margaritifera albino phenotype from juvenile to cultured pearl harvest stages using multiple whole transcriptome sequencing. BMC Genom. 2020, 21, 622. [Google Scholar] [CrossRef] [PubMed]
  50. Esbaugh, A.J.; Perry, S.F.; Bayaa, M.; Georgalis, T.; Nickerson, J.; Tufts, B.L.; Gilmour, K.M. Cytoplasmic carbonic anhydrase isozymes in rainbow trout Oncorhynchus mykiss: Comparative physiology and molecular evolution. J. Exp. Biol. 2005, 208, 1951–1961. [Google Scholar] [CrossRef] [PubMed]
  51. Chegwidden, W.R.; Carter, N.D.; Edwards, Y.H. The Carbonic Anhydrases: New Horizons; Birkhauser: Basel, Switherland, 2000. [Google Scholar]
  52. Nathalie, L.R.; Daniel, J.J.; Benjamin, M.; Paula, R.S.; Fredeic, M. Carbonic anhydrase and metazoan biocalcification: A focus on molluscs. Key Eng. Mater. 2015, 672, 151–157. [Google Scholar]
  53. Perfetto, R.; Prete, S.D.; Vullo, D.; Sansone, G.; Barone, C.; Rossi, M.; Supuran, C.T.; Capasso, C. Biochemical characterization of the native α-carbonic anhydrase purified from the mantle of the Mediterranean mussel, Mytilus galloprovincialis. J. Enzym. Inhib. Med. Chem. 2017, 32, 632–639. [Google Scholar] [CrossRef]
  54. Horwitz, R.; Norin, T.; Watson, S.A.; Pistevos, J.C.A.; Beldade, R.; Hacquart, S.; Gattuso, J.P.; Riccardo, R.M.; Jeremie, V.D.; Killen, S.S.; et al. Near-future ocean warming and acidification alter foraging behavior, locomotion, and metabolic rate in a keystone marine mollusk. Sci. Rep. 2020, 10, 5461. [Google Scholar] [CrossRef]
  55. Ertl, N.G.; O’Connor, W.A.; Elizur, A. Molecular effects of a variable environment on Sydney rock oysters, Saccostrea glomerata: Thermal and low salinity stress, and their synergistic effect. Mar. Genom. 2019, 43, 19–32. [Google Scholar] [CrossRef]
  56. Feige, U.; Polla, B.S. Hsp70- a multi-gene, multi-structure, multi-function family with potential clinical applications. Experientia 1994, 50, 979–986. [Google Scholar] [CrossRef]
  57. Srivastava, P. Roles of heat-shock proteins in innate and adaptive immunity. Nat. Rev. Immunol. 2022, 2, 185–194. [Google Scholar] [CrossRef]
  58. Bendena, W.G.; Ayme-Southgate, A.; Garbe, J.C.; Pardue, M.L. Expression of heat-shock locus hsr-omega in nonstressed cells during development in Drosop- hila melanogaster. Dev. Biol. 1991, 144, 65–77. [Google Scholar] [CrossRef]
  59. Moya, L.; Huisman, S.; Foret, J.P.; Gattuso, D.; Hayward, C.; Ball, E.E.; Miller, D.J. Rapid acclimation of juvenile corals to CO2-mediated acidification by upregulation of heat shock protein and Bcl-2 genes. Mol. Ecol. 2015, 24, 438–452. [Google Scholar] [CrossRef]
  60. Jiang, W.W.; Fang, J.H.; Du, M.R.; Gao, Y.P.; Fang, J.G.; Jiang, Z.J. Integrated transcriptomics and metabolomics analyses reveal benzo[a] pyrene enhances the toxicity of mercury to the Manila clam, Ruditapes philippinarum. Ecotoxicol. Environ. Saf. 2021, 213, 112038. [Google Scholar] [CrossRef] [PubMed]
  61. Ulaje, S.A.; Lluch-Cota, S.E.; Sicard, M.T.; Ascencio, F.; Cruz-Hernandez, P.; Racotta, I.S.; Rojo-Arreola, L. Litopenaeus vannamei oxygen consumption and HSP gene expression at cyclic conditions of hyperthermia and hypoxia. J. Therm. Biol. 2020, 92, 102666. [Google Scholar] [CrossRef] [PubMed]
  62. Wang, L.B.; Xu, Q.W.; Yu, Z.J.; Hu, Z.X.; Li, H.; Shi, W.J.; Wan, X.H. Transcriptomic Analysis Provides Insights into the Energetic Metabolism and Immune Responses in Litopenaeus vannamei Challenged by Photobacterium damselae subsp. damselae. Fishes 2024, 9, 350. [Google Scholar] [CrossRef]
  63. Xu, Y.; Luo, X.; Masanja, F.; Deng, Y.W.; Zhao, L.Q. Transcriptomic insights into cessation of clam embryonic development following transgenerational exposure to ocean acidity extreme. Mar. Environ. Res. 2024, 198, 106561. [Google Scholar] [CrossRef]
  64. Schwaner, C.; Barbosa, M.; Haley, J.; Espinosa, P.E.; Allam, B. Transcriptomics, proteomics, and physiological assays reveal immunosuppression in the eastern oyster Crassostrea virginica exposed to acidification stress. Fish Shellfish Immunol. 2024, 146, 109366. [Google Scholar] [CrossRef]
Figure 1. Volcano plots showing the DEGs between comparisons. (a) Acd_p vs. Con_p; (b) Acd_w vs. Con_w; (c) Acd_p vs. Acd_w; (d) Con_p vs. Con_w. Acd, acidification group; Con, control subject; p, clams with purple shell color; w, clams with white shell color. Red plots represent upregulated genes; blue plots represent downregulated genes; and grey plots represent non-significantly differentially expressed genes.
Figure 1. Volcano plots showing the DEGs between comparisons. (a) Acd_p vs. Con_p; (b) Acd_w vs. Con_w; (c) Acd_p vs. Acd_w; (d) Con_p vs. Con_w. Acd, acidification group; Con, control subject; p, clams with purple shell color; w, clams with white shell color. Red plots represent upregulated genes; blue plots represent downregulated genes; and grey plots represent non-significantly differentially expressed genes.
Fishes 09 00486 g001
Figure 2. Venn diagrams showings unigenes significantly differentially expressed in all groups. The numbers in the large circles represent the total DEGs in each group, while the overlap shows the common DEGs between groups. Acd, acidification group; Con, control subject; p, clams with purple shell color; w, clams with white shell color.
Figure 2. Venn diagrams showings unigenes significantly differentially expressed in all groups. The numbers in the large circles represent the total DEGs in each group, while the overlap shows the common DEGs between groups. Acd, acidification group; Con, control subject; p, clams with purple shell color; w, clams with white shell color.
Fishes 09 00486 g002
Figure 3. Hierarchical cluster results of the transcripts of Acd_p vs. Con_p (a) and Acd_w vs. Con_w (b) related genes under ocean acidification. Acd, acidification group; Con, control subject; p, clams with purple shell color; w, clams with white shell color (purple genes are associated with calcification and osmotic regulation; green genes are associated with lipid metabolism; green genes are associated with immune response).
Figure 3. Hierarchical cluster results of the transcripts of Acd_p vs. Con_p (a) and Acd_w vs. Con_w (b) related genes under ocean acidification. Acd, acidification group; Con, control subject; p, clams with purple shell color; w, clams with white shell color (purple genes are associated with calcification and osmotic regulation; green genes are associated with lipid metabolism; green genes are associated with immune response).
Fishes 09 00486 g003aFishes 09 00486 g003b
Figure 4. GO enrichment bubble plot assigned to DEGs in the Acd_p vs. Con_p (a) and Acd_w vs. Con_w (b). Con, control subjects; Acd, acidification groups; p, clams with purple shell color; w, clams with white shell color. GO enrichment analysis assigned DEGs to three different categories: biological processes (blue), cellular components (green), and molecular functions (orange). The x axis is Z-Score. Z-Score = (up − down)/(S0.5) shows the degree of difference in the number of up and down-regulated genes. The y axis is the −log10 value of p.value/q.value (adj p-value) for the GO enrichment analysis. Bubble color indicates the classification of GO. Information on significantly enriched bubbles is listed on the righthand side.
Figure 4. GO enrichment bubble plot assigned to DEGs in the Acd_p vs. Con_p (a) and Acd_w vs. Con_w (b). Con, control subjects; Acd, acidification groups; p, clams with purple shell color; w, clams with white shell color. GO enrichment analysis assigned DEGs to three different categories: biological processes (blue), cellular components (green), and molecular functions (orange). The x axis is Z-Score. Z-Score = (up − down)/(S0.5) shows the degree of difference in the number of up and down-regulated genes. The y axis is the −log10 value of p.value/q.value (adj p-value) for the GO enrichment analysis. Bubble color indicates the classification of GO. Information on significantly enriched bubbles is listed on the righthand side.
Fishes 09 00486 g004
Figure 5. KEGG pathways in the enrichment analysis of M. veneriformis between Acd_p vs. Acd_w (a); Acd_w vs. Con_w (b); Con, control subjects; Acd, acidification groups; p, clams with purple shell color; w, clams with white shell color.
Figure 5. KEGG pathways in the enrichment analysis of M. veneriformis between Acd_p vs. Acd_w (a); Acd_w vs. Con_w (b); Con, control subjects; Acd, acidification groups; p, clams with purple shell color; w, clams with white shell color.
Fishes 09 00486 g005
Figure 6. Results of RT-qPCR and RNA-seq analysis for the selected genes exhibiting differential expressions under acidified seawater with white and purple shell-color clams. (a) Acd_w vs. Con_w; (b) Acd_p vs. Con_p. Acd, acidification group; Con, control subjects; p, clams with purple shell color; w, clams with white shell color.
Figure 6. Results of RT-qPCR and RNA-seq analysis for the selected genes exhibiting differential expressions under acidified seawater with white and purple shell-color clams. (a) Acd_w vs. Con_w; (b) Acd_p vs. Con_p. Acd, acidification group; Con, control subjects; p, clams with purple shell color; w, clams with white shell color.
Fishes 09 00486 g006aFishes 09 00486 g006b
Table 1. Mean carbonate chemistry parameters of seawater.
Table 1. Mean carbonate chemistry parameters of seawater.
pH LevelpHTT (°C)TA (mmol kg−1)pCO2 (μatm)ΩaΩc
8.18.12 ± 0.124 ± 0.12.6 ± 0.0445439 ± 73.69 ± 0.065.80 ± 0.10
7.67.63 ± 0.124 ± 0.12.5 ± 0.02701548 ± 161.30 ± 0.012.04 ± 0.20
Note: pH on the total scale (pHT); temperature (T); total alkalinity (TA); CO2 partial pressure (pCO2); saturation state for aragonite (Ωa) and calcite (Ωc).
Table 2. Primers for RT−qPCR validation.
Table 2. Primers for RT−qPCR validation.
Gene IdDescriptionForward Primer Sequence (5′–3′)Reverse Primer Sequence (5′–3′)
Mve01G012410Fatty acid synthaseGACGGTATGGCAGAGGTTCTGAGGTAGTCGGCATGAT
Mve06G013870tyrosinase proteinGGCACAGAGTCTACTTAGCGGCGTTCTCCAATTAGCA
Mve01G001290Heat shock protein 90GGACACTGGTATTGGTATGACGACTTTATCAGCAACGAGGT
Mve08G005750Caveolin-1TGGAAGGCAAGTTACAAGTGTCTCGGAGACATGGTGTG
Mve14G002240Perlucin-like proteinCAATGGTGGTGACTTAGTTCAACCATTCTCTTGTCCGTGTTCTG
Mve15G004870Tubulin beta chainCGTGCCATCCTTGTAGATGTGACCTTTAGCCCAGTT
Mve05G016370Immunity adhesion receptor DC-SIGNATCTGAGATGGGAGAACTGTTAGGTCCGACAAGAAATACTGCTTT
Mve09G004530Heat shock 70 kDa protein GTCAGCATCTGTCGTGGTATTCTCTTCAGCCTCGTATCC
Mve06G007180Carbonic anhydraseCTACAGTCTTGCGGACAACCGAGTGTTCCAAATCTCATCA
Mve18G006540Neo-calmodulinATCCGAACTCATCCGAAGCTCACCCAACCGTCTCATTAC
Mve16G007370Chitinase-3-like protein 1GAATCTGAAACTGGTGCCATCCCACTTGTATAAATCCGCCATT
Mve14G000320nuclear pore complex protein Nup160CTTTGAACCGAGGAAACCCTGGCTACAGGTGTGAGATAC
Table 3. Comparison of oxygen consumption rates, ammonia excretion rates, and O:N ratios in purple color groups.
Table 3. Comparison of oxygen consumption rates, ammonia excretion rates, and O:N ratios in purple color groups.
DaypHRO (mg·(g·h)−1)RN (mg·(g·h)−1)O/N
15 d7.61.309 ± 0.050 a0.087 ± 0.003 a13.132 ± 0.160 a
8.11.087 ± 0.013 b0.060 ± 0.003 b15.793 ± 0.506 b
30 d7.61.643 ± 0.060 a0.136 ± 0.060 a10.601 ± 0.587 a
8.11.062 ± 0.114 b0.062 ± 0.070 b15.095 ± 1.082 b
Note: Means sharing the same letter exhibit no statistically significant differences. Statistical analysis was conducted using one-way analysis of variance (p < 0.05).
Table 4. Comparison of oxygen consumption rates, ammonia excretion rates, and O:N ratios in white color groups.
Table 4. Comparison of oxygen consumption rates, ammonia excretion rates, and O:N ratios in white color groups.
DaypHRO (mg·(g·h)−1)RN (mg·(g·h)−1)O/N
15 d7.61.607 ± 0.007 a0.088 ± 0.038 a16.015 ± 0.753 a
8.11.439 ± 0.025 b0.050 ± 0.079 b21.749 ± 0.882 b
30 d7.61.813 ± 0.035 a0.123 ± 0.089 a13.058 ± 0.918 a
8.11.401 ± 0.116 b0.066 ± 0.036 b20.860 ± 1.000 b
Note: Means sharing the same letter exhibit no statistically significant differences. Statistical analysis was conducted using one-way analysis of variance (p < 0.05).
Table 5. RNA-seq information.
Table 5. RNA-seq information.
GroupRaw Data (Gb)Valid Data (Gb)Q20(%)Q30(%)GC Content (%)Total ReadsTotal Mapped (%)
Acd_p6.25 G6.07 G99.2196.5536.0040,488,71697.10
Acd_w6.45 G6.29 G99.1196.0935.6741,902,27297.40
Con_p6.30 G6.14 G99.2096.6436.1740,930,98497.38
Con_w6.99 G6.78 G99.1096.4936.3345,189,43497.07
Table 6. Summary statistics of M. veneriformis transcriptome assembly.
Table 6. Summary statistics of M. veneriformis transcriptome assembly.
Min.length (bp)Mean.length (bp)Max.length (bp)Total.length (bp)
Unigenes1502017.11439,85550,720,321
Table 7. Information of gene annotation.
Table 7. Information of gene annotation.
Number of UnigenesPercentage (%)
Annotated in all Databases21,11383.97%
Annotated in GO14,90459.27%
Annotated in KEGG603724.01%
Total Unigenes25,145100.00%
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Chen, L.; Huang, G.; Liang, S.; Liang, J.; Wang, H.; Liu, H.; Wang, X.; Li, L.; Guo, Y.; Liu, W. Comparative Physiological and Transcriptome Analyses Reveal the Responses to Ocean Acidification Challenge of Mactra veneriformis with Different Shell Colors. Fishes 2024, 9, 486. https://doi.org/10.3390/fishes9120486

AMA Style

Chen L, Huang G, Liang S, Liang J, Wang H, Liu H, Wang X, Li L, Guo Y, Liu W. Comparative Physiological and Transcriptome Analyses Reveal the Responses to Ocean Acidification Challenge of Mactra veneriformis with Different Shell Colors. Fishes. 2024; 9(12):486. https://doi.org/10.3390/fishes9120486

Chicago/Turabian Style

Chen, Limei, Gengyin Huang, Shuang Liang, Jian Liang, Hefeng Wang, Huiru Liu, Xiaoyu Wang, Li Li, Yongjun Guo, and Wenguang Liu. 2024. "Comparative Physiological and Transcriptome Analyses Reveal the Responses to Ocean Acidification Challenge of Mactra veneriformis with Different Shell Colors" Fishes 9, no. 12: 486. https://doi.org/10.3390/fishes9120486

APA Style

Chen, L., Huang, G., Liang, S., Liang, J., Wang, H., Liu, H., Wang, X., Li, L., Guo, Y., & Liu, W. (2024). Comparative Physiological and Transcriptome Analyses Reveal the Responses to Ocean Acidification Challenge of Mactra veneriformis with Different Shell Colors. Fishes, 9(12), 486. https://doi.org/10.3390/fishes9120486

Article Metrics

Back to TopTop