Effects of Dietary Supplementation with Bacillus subtilis natto on Growth, Digestive Enzyme Activity, Immune Response, and Intestinal Microorganisms of Red Sea Bream, Pagrus major
Abstract
1. Introduction
2. Materials and Methods
2.1. Fish and Experimental Setup
2.2. Experimental Diet
2.3. Sample Collection
2.4. Digestive Enzyme Analysis
2.5. Biochemical and Blood Analysis
2.6. Immunological Parameter Evaluation
2.7. Growth-Related Genes Analysis (IGF-1 and IGF-2)
2.8. Intestinal Bacterial Analysis
2.9. Statistical Analysis
3. Results
3.1. Growth Performance, Survival, and Feed Utilization
3.2. Digestive Enzyme Activities
3.3. Blood Chemistry
3.4. Immune Responses
3.5. Intestinal Microbiota
3.6. Relative Gene Expression of Growth Factors
4. Discussion
4.1. Growth Performance and Feed Utilization
4.2. Digestive Enzyme Activity
4.3. Blood Biochemistry and Immune Response
4.4. Intestinal Microbiota
4.5. Growth-Related Gene Expression
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- The State of World Fisheries and Aquaculture 2024; FAO: Rome, Italy, 2024; ISBN 978-92-5-138763-4. [CrossRef]
- Rahayu, S.; Amoah, K.; Huang, Y.; Cai, J.; Wang, B.; Shija, V.M.; Jin, X.; Anokyewaa, M.A.; Jiang, M. Probiotics Application in Aquaculture: Its Potential Effects, Current Status in China and Future Prospects. Front. Mar. Sci. 2024, 11, 5905. [Google Scholar] [CrossRef]
- Amenyogbe, E.; Droepenu, E.K.; Ayisi, C.L.; Boamah, G.A.; Duker, R.Q.; Abarike, E.D.; Huang, J. Impact of Probiotics, Prebiotics, and Synbiotics on Digestive Enzymes, Oxidative Stress, and Antioxidant Defense in Fish Farming: Current Insights and Future Perspectives. Front. Mar. Sci. 2024, 11, 8436. [Google Scholar] [CrossRef]
- Torres-Maravilla, E.; Parra, M.; Maisey, K.; Vargas, R.A.; Cabezas-Cruz, A.; Gonzalez, A.; Tello, M.; Bermúdez-Humarán, L.G. Importance of Probiotics in Fish Aquaculture: Towards the Identification and Design of Novel Probiotics. Microorganisms 2024, 12, 626. [Google Scholar] [CrossRef] [PubMed]
- Hoseinifar, S.H.; Sun, Y.-Z.; Wang, A.; Zhou, Z. Probiotics as Means of Diseases Control in Aquaculture, a Review of Current Knowledge and Future Perspectives. Front. Microbiol. 2018, 9, 2429. [Google Scholar] [CrossRef] [PubMed]
- Todorov, S.D.; Lima, J.M.S.; Bucheli, J.E.V.; Popov, I.V.; Tiwari, S.K.; Chikindas, M.L. Probiotics for Aquaculture: Hope, Truth, and Reality. Probiotics Antimicro. Prot. 2024. [Google Scholar] [CrossRef]
- Egerton, S.; Culloty, S.; Whooley, J.; Stanton, C.; Ross, R.P. The Gut Microbiota of Marine Fish. Front. Microbiol. 2018, 9, 873. [Google Scholar] [CrossRef]
- Talukder Shefat, S.H. Probiotic Strains Used in Aquaculture. Int. Res. J. Microbiol 2018, 7, 43–55. [Google Scholar] [CrossRef]
- Markowiak, P.; Śliżewska, K. Effects of Probiotics, Prebiotics, and Synbiotics on Human Health. Nutrients 2017, 9, 1021. [Google Scholar] [CrossRef]
- Sun, P.; Wang, J.Q.; Zhang, H.T. Effects of Bacillus subtilis Natto on Performance and Immune Function of Preweaning Calves. J. Dairy Sci. 2010, 93, 5851–5855. [Google Scholar] [CrossRef]
- Nagai, T. Overview of Studies on Bacillus subtilis (Natto) Bacteriophages and the Prospects. JARQ 2012, 46, 305–310. [Google Scholar] [CrossRef][Green Version]
- Heng, Y.; Wang, M.; Jiang, H.; Gao, S.; Zhang, J.; Wan, J.; Song, T.; Ren, Z.; Zhu, Y. Plasma-Activated Acidic Electrolyzed Water: A New Food Disinfectant for Bacterial Suspension and Biofilm. Foods 2022, 11, 3241. [Google Scholar] [CrossRef] [PubMed]
- Zaineldin, A.I.; Hegazi, S.; Koshio, S.; Ishikawa, M.; Bakr, A.; El-Keredy, A.M.S.; Dawood, M.A.O.; Dossou, S.; Wang, W.; Yukun, Z. Bacillus subtilis as Probiotic Candidate for Red Sea Bream: Growth Performance, Oxidative Status, and Immune Response Traits. Fish Shellfish Immunol. 2018, 79, 303–312. [Google Scholar] [CrossRef] [PubMed]
- Dawood, M.A.O.; Koshio, S.; Ishikawa, M.; El-Sabagh, M.; Yokoyama, S.; Wang, W.-L.; Yukun, Z.; Olivier, A. Physiological Response, Blood Chemistry Profile and Mucus Secretion of Red Sea Bream (Pagrus major) Fed Diets Supplemented with Lactobacillus rhamnosus under Low Salinity Stress. Fish Physiol. Biochem. 2017, 43, 179–192. [Google Scholar] [CrossRef] [PubMed]
- Cupp-Enyard, C. Sigma’s Non-Specific Protease Activity Assay—Casein as a Substrate. JoVE (J. Vis. Exp.) 2008, 19, e899. [Google Scholar] [CrossRef]
- Worthington Enzyme Manual: Enzymes and Related Biochemicals; Worthington Biochemical Corporation: Lakewood, NJ, USA, 1993.
- Mustafa, A.; Karmali, A.; Abdelmoez, W. A Sensitive Microplate Assay for Lipase Activity Measurement Using Olive Oil Emulsion Substrate: Modification of the Copper Soap Colorimetric Method. J. Oleo Sci. 2016, 65, 775–784. [Google Scholar] [CrossRef]
- AOAC. Official Methods of Analysis of AOAC International, 21st ed.; AOAC International: Gaithersburg, MD, USA, 2019; ISBN 978-0-935584-89-9. [Google Scholar]
- Siwicki, A.K.; Anderson, D.P.; Rumsey, G.L. Dietary Intake of Immunostimulants by Rainbow Trout Affects Non-Specific Immunity and Protection against Furunculosis. Vet. Immunol. Immunopathol. 1994, 41, 125–139. [Google Scholar] [CrossRef]
- Yamamoto, A.; Iida, T. Bactericidal Activity of Serum of All-Female Triploid Rainbow Trout. Fish Pathol. 1995, 30, 123–124. [Google Scholar] [CrossRef]
- Lygren, B.; Sveier, H.; Hjeltnes, B.; Waagbø, R. Examination of the Immunomodulatory Properties and the Effect on Disease Resistance of Dietary Bovine Lactoferrin and Vitamin C Fed to Atlantic Salmon (Salmo salar) for a Short-Term Period. Fish Shellfish Immunol. 1999, 9, 95–107. [Google Scholar] [CrossRef]
- Zhang, Y.; Cui, H.; Sun, D.; Liu, L.; Xu, X. Effects of Doe-Litter Separation on Intestinal Bacteria, Immune Response and Morphology of Suckling Rabbits. World Rabbit Sci. 2018, 26, 71–79. [Google Scholar] [CrossRef]
- Patra, A.K.; Yu, Z. Effects of Vanillin, Quillaja saponin, and Essential Oils on in Vitro Fermentation and Protein-Degrading Microorganisms of the Rumen. Appl. Microbiol. Biotechnol. 2014, 98, 897–905. [Google Scholar] [CrossRef]
- Yu, Z.; Michel, F.C.; Hansen, G.; Wittum, T.; Morrison, M. Development and Application of Real-Time PCR Assays for Quantification of Genes Encoding Tetracycline Resistance. Appl. Environ. Microbiol. 2005, 71, 6926–6933. [Google Scholar] [CrossRef] [PubMed]
- Giri, S.S.; Sukumaran, V.; Sen, S.S.; Jena, P.K. Effects of Dietary Supplementation of Potential Probiotic Bacillus subtilis VSG1 Singularly or in Combination with Lactobacillus plantarum VSG3 or/and Pseudomonas aeruginosa VSG2 on the Growth, Immunity and Disease Resistance of Labeo rohita. Aquac. Nutr. 2014, 20, 163–171. [Google Scholar] [CrossRef]
- Ramesh, D.; Souissi, S. Effects of Potential Probiotic Bacillus subtilis KADR1 and Its Subcellular Components on Immune Responses and Disease Resistance in Labeo rohita. Aquac. Res. 2018, 49, 367–377. [Google Scholar] [CrossRef]
- Telli, G.S.; Ranzani-Paiva, M.J.T.; de Carla Dias, D.; Sussel, F.R.; Ishikawa, C.M.; Tachibana, L. Dietary Administration of Bacillus subtilis on Hematology and Non-Specific Immunity of Nile Tilapia Oreochromis niloticus Raised at Different Stocking Densities. Fish Shellfish Immunol. 2014, 39, 305–311. [Google Scholar] [CrossRef]
- Yu, Y.; Wang, C.; Wang, A.; Yang, W.; Lv, F.; Liu, F.; Liu, B.; Sun, C. Effects of Various Feeding Patterns of Bacillus coagulans on Growth Performance, Antioxidant Response and Nrf2-Keap1 Signaling Pathway in Juvenile Gibel Carp (Carassius auratus Gibelio). Fish Shellfish Immunol. 2018, 73, 75–83. [Google Scholar] [CrossRef]
- Sun, Y.-Z.; Yang, H.-L.; Ma, R.-L.; Lin, W.-Y. Probiotic Applications of Two Dominant Gut Bacillus Strains with Antagonistic Activity Improved the Growth Performance and Immune Responses of Grouper Epinephelus coioides. Fish Shellfish Immunol. 2010, 29, 803–809. [Google Scholar] [CrossRef]
- Liu, K.-F.; Chiu, C.-H.; Shiu, Y.-L.; Cheng, W.; Liu, C.-H. Effects of the Probiotic, Bacillus subtilis E20, on the Survival, Development, Stress Tolerance, and Immune Status of White Shrimp, Litopenaeus Vannamei Larvae. Fish Shellfish Immunol. 2010, 28, 837–844. [Google Scholar] [CrossRef]
- Liu, C.-H.; Chiu, C.-H.; Wang, S.-W.; Cheng, W. Dietary Administration of the Probiotic, Bacillus subtilis E20, Enhances the Growth, Innate Immune Responses, and Disease Resistance of the Grouper, Epinephelus coioides. Fish Shellfish Immunol. 2012, 33, 699–706. [Google Scholar] [CrossRef]
- Iwashita, M.K.P.; Nakandakare, I.B.; Terhune, J.S.; Wood, T.; Ranzani-Paiva, M.J.T. Dietary Supplementation with Bacillus subtilis, Saccharomyces cerevisiae and Aspergillus oryzae Enhance Immunity and Disease Resistance against Aeromonas hydrophila and Streptococcus iniae Infection in Juvenile Tilapia Oreochromis niloticus. Fish Shellfish Immunol. 2015, 43, 60–66. [Google Scholar] [CrossRef]
- Wang, Y.-B.; Li, J.-R.; Lin, J. Probiotics in Aquaculture: Challenges and Outlook. Aquaculture 2008, 281, 1–4. [Google Scholar] [CrossRef]
- Newaj-Fyzul, A.; Adesiyun, A.A.; Mutani, A.; Ramsubhag, A.; Brunt, J.; Austin, B. Bacillus subtilis AB1 Controls Aeromonas Infection in Rainbow Trout (Oncorhynchus mykiss, Walbaum). J. Appl. Microbiol. 2007, 103, 1699–1706. [Google Scholar] [CrossRef] [PubMed]
- Liang, Q.; Yuan, M.; Xu, L.; Lio, E.; Zhang, F.; Mou, H.; Secundo, F. Application of Enzymes as a Feed Additive in Aquaculture. Mar. Life Sci. Technol. 2022, 4, 208–221. [Google Scholar] [CrossRef] [PubMed]
- You, S.; Ma, Y.; Yan, B.; Pei, W.; Wu, Q.; Ding, C.; Huang, C. The Promotion Mechanism of Prebiotics for Probiotics: A Review. Front Nutr. 2022, 9, 1000517. [Google Scholar] [CrossRef] [PubMed]
- Mutalib, A.; Alhassan, E.; Larbi Ayisi, C. Evaluating the Impact of Varied Probiotic Levels (Bacillus subtilis 200) on Feed Utilization, Growth Performance, and Proximate Composition in African Catfish (Clarias gariepinus). J. Energy Nat. Resour. Manag. 2024, 9, 52–63. [Google Scholar] [CrossRef]
- Ghosh, T. Recent Advances in the Probiotic Application of the Bacillus as a Potential Candidate in the Sustainable Development of Aquaculture. Aquaculture 2025, 594, 741432. [Google Scholar] [CrossRef]
- Etesami, H.; Jeong, B.R.; Glick, B.R. Potential Use of Bacillus spp. as an Effective Biostimulant against Abiotic Stresses in Crops—A Review. Curr. Res. Biotechnol. 2023, 5, 100128. [Google Scholar] [CrossRef]
- Miljaković, D.; Marinković, J.; Balešević-Tubić, S. The Significance of Bacillus spp. in Disease Suppression and Growth Promotion of Field and Vegetable Crops. Microorganisms 2020, 8, 1037. [Google Scholar] [CrossRef]
- Liu, H.; Wang, S.; Cai, Y.; Guo, X.; Cao, Z.; Zhang, Y.; Liu, S.; Yuan, W.; Zhu, W.; Zheng, Y.; et al. Dietary Administration of Bacillus subtilis HAINUP40 Enhances Growth, Digestive Enzyme Activities, Innate Immune Responses and Disease Resistance of Tilapia, Oreochromis niloticus. Fish Shellfish Immunol 2017, 60, 326–333. [Google Scholar] [CrossRef]
- Li, L.; Wang, Y.-T.; Meng, S.-T.; Wei, X.-F.; Yang, Z.-Y.; Zhu, R.; Li, D.-L.; Wu, L.-F. Effects of Single or Conjoint Administration of Poly-β-Hydroxybutyrate and Bacillus subtilis on Growth, Antioxidant Capacity and Apoptosis of Common Carp (Cyprinus carpio). Anim. Feed Sci. Technol. 2024, 318, 116110. [Google Scholar] [CrossRef]
- Abdel-Tawwab, M.; Eldessouki, E.A.; Abd-Ellatieff, H.A.; Khalil, R.H.; El-Sabbagh, N.M.; Saleh, H.M.; Saleh, N.A.; Abdelhakim, T.M.N.; Samak, D.H. Antagonistic Effects of Bacillus subtilis-Derived Chitosan Nanoparticles on Growth Performance, Stress Biomarkers, and Histological Alterations of Cadmium-Intoxicated Nile Tilapia Fingerlings. Aquacult. Int. 2024, 32, 10269–10299. [Google Scholar] [CrossRef]
- Magnadóttir, B. Innate Immunity of Fish (Overview). Fish Shellfish Immunol. 2006, 20, 137–151. [Google Scholar] [CrossRef] [PubMed]
- Shija, V.M.; Amoah, K.; Cai, J. Effect of Bacillus Probiotics on the Immunological Responses of Nile Tilapia (Oreochromis niloticus): A Review. Fishes 2023, 8, 366. [Google Scholar] [CrossRef]
- Rahman, A.; Shefat, S.; Anas Chowdhury, M.; Khan, S. Effects of Probiotic Bacillus on Growth Performance, Immune Response and Disease Resistance in Aquaculture. Preprints 2021, 12, 1–10. [Google Scholar]
- Nayak, S.K. Probiotics and Immunity: A Fish Perspective. Fish Shellfish Immunol. 2010, 29, 2–14. [Google Scholar] [CrossRef] [PubMed]
- Aly, S.M.; Abdel-Galil Ahmed, Y.; Abdel-Aziz Ghareeb, A.; Mohamed, M.F. Studies on Bacillus Subtilis and Lactobacillus acidophilus, as Potential Probiotics, on the Immune Response and Resistance of Tilapia Nilotica (Oreochromis niloticus) to Challenge Infections. Fish Shellfish Immunol. 2008, 25, 128–136. [Google Scholar] [CrossRef]
- Zhou, X.; Tian, Z.; Wang, Y.; Li, W. Effect of Treatment with Probiotics as Water Additives on Tilapia (Oreochromis niloticus) Growth Performance and Immune Response. Fish Physiol. Biochem. 2010, 36, 501–509. [Google Scholar] [CrossRef]
- Ringø, E. Evaluation of Probiotic Strain Bacillus subtilis C-3102 as a Feed Supplement for Koi Carp (Cyprinus carpio). J. Aquac. Res. Dev. 2011, S1, 005. [Google Scholar] [CrossRef]
- Dash, P.; Tandel, R.S.; Bhat, R.A.H.; Mallik, S.; Pandey, N.N.; Singh, A.K.; Sarma, D. The Addition of Probiotic Bacteria to Microbial Floc: Water Quality, Growth, Non-Specific Immune Response and Disease Resistance of Cyprinus carpio in Mid-Himalayan Altitude. Aquaculture 2018, 495, 961–969. [Google Scholar] [CrossRef]
- Dawood, M.A.O.; Koshio, S.; Abdel-Daim, M.M.; Van Doan, H. Probiotic Application for Sustainable Aquaculture. Rev. Aquac. 2019, 11, 907–924. [Google Scholar] [CrossRef]
- Merrifield, D.L.; Ringo, E. Aquaculture Nutrition: Gut Health, Probiotics and Prebiotics; John Wiley & Sons: Hoboken, NJ, USA, 2014; ISBN 978-0-470-67271-6. [Google Scholar]
- Ma, T.; Shen, X.; Shi, X.; Sakandar, H.A.; Quan, K.; Li, Y.; Jin, H.; Kwok, L.-Y.; Zhang, H.; Sun, Z. Targeting Gut Microbiota and Metabolism as the Major Probiotic Mechanism—An Evidence-Based Review. Trends Food Sci. Technol. 2023, 138, 178–198. [Google Scholar] [CrossRef]
- Chandrasekaran, P.; Weiskirchen, S.; Weiskirchen, R. Effects of Probiotics on Gut Microbiota: An Overview. Int. J. Mol. Sci. 2024, 25, 6022. [Google Scholar] [CrossRef] [PubMed]
- Talwar, C.; Nagar, S.; Lal, R.; Negi, R.K. Fish Gut Microbiome: Current Approaches and Future Perspectives. Indian J. Microbiol. 2018, 58, 397–414. [Google Scholar] [CrossRef] [PubMed]
- Bikle, D.D.; Tahimic, C.; Chang, W.; Wang, Y.; Philippou, A.; Barton, E.R. Role of IGF-I Signaling in Muscle Bone Interactions. Bone 2015, 80, 79–88. [Google Scholar] [CrossRef]
- Ndandala, C.B.; Zhou, Q.; Li, Z.; Guo, Y.; Li, G.; Chen, H. Identification of Insulin-like Growth Factor (IGF) Family Genes in the Golden Pompano, Trachinotus ovatus: Molecular Cloning, Characterization and Gene Expression. Int. J. Mol. Sci. 2024, 25, 2499. [Google Scholar] [CrossRef]
- Weil, C.; Lebret, V.; Gabillard, J.-C. The IGF/IGFBP System in Rainbow Trout (Oncorhynchus mykiss) Adipose Tissue: Expression Related to Regional Localization and Cell Type. Fish Physiol. Biochem. 2011, 37, 843–852. [Google Scholar] [CrossRef]
Ingredient | Test Diet (g/kg) |
---|---|
Brown fish meal 1 | 600.0 |
Wheat flour | 100.0 |
Soybean lecithin 2 | 30.0 |
Pollack liver oil 3 | 45.0 |
HUFA (DHA + EPA) | 5.0 |
Vitamin premix 4 | 30.0 |
Mineral premix 5 | 30.0 |
Stay-C 6 | 3.0 |
Activated gluten 7 | 50.0 |
α-Cellulose 8 | 78.0 |
Amino acid premix 9 | 9.0 |
CMC 10 | 10.0 |
BSN Prep 11 | 10.0 |
Total | 1000 |
Ingredient | Test Diet | ||||
---|---|---|---|---|---|
BN0 | BN1 | BN2 | BN3 | BN4 | |
BSN counts (CFU/Kg) | 2.33 × 103 | 9.71 × 106 | 9.68 × 107 | 9.64 × 108 | 9.34 × 109 |
Crude Protein (g/kg) | 50.16 | 50.19 | 50.20 | 50.28 | 50.49 |
Crude Lipid (g/kg) | 13.91 | 13.87 | 13.95 | 13.98 | 14.01 |
Ash (g/kg) | 10.10 | 10.08 | 10.11 | 10.05 | 9.97 |
Gross energy (kJ/g) * | 21.77 | 21.77 | 21.78 | 21.81 | 21.84 |
Name | Primer Sequence: 5′-3′ | Accession Number |
---|---|---|
IGF-1 (F) | TAAACCCACACCGAGTGACA | AB050670.1 |
IGF-1 (R) | GCGATGAAGAAAAGCTACGG | |
IGF-2 (F) | CGGCAAACTAGTGATGAGCA | AB360966.1 |
IGF-2 (R) | CAGTGTCAAGGGGGAAGTGT | |
β-actin (F) * | TCTGTCTGGATCGGAGGTC | JN226150.1 |
β-actin (R) | AAGCATTTGCGGTGGACG |
Items | Primer | Primer Sequence (5′-3′) | Amplicon Size (bp) |
---|---|---|---|
Total bacteria | Forward | CGGCAACGAGCGCAACCC | 130 (125–146) |
Reverse | CCATTGTAGCACGTGTGTAGCC | ||
B. subtilis | Forward | TCTGCTCGTGAACGGTGCT | 319 |
Reverse | TTTCGCCTTATTTACTTGG | ||
Lb. | Forward | TGGAAACAGRTGCTAATACCG | 222 |
Reverse | GTCCATTGTGGAAGATTCCC | ||
E. coli | Forward | CATGCCGCGTGTATGAAGAA | 96 |
Reverse | CGGGTAACGTCAATGAGCAAA |
Parameters | Test Groups | ||||
---|---|---|---|---|---|
BN0 | BN1 | BN2 | BN3 | BN4 | |
IBW 1 | 11.23 ± 0.10 | 11.23 ± 0.11 | 11.25 ± 0.17 | 11.23 ± 0.15 | 11.24 ± 0.13 |
FBW 2 | 33.75 ± 0.40 a | 33.77 ± 0.55 a | 35.35 ± 0.48 ab | 36.41 ± 0.67 b | 36.28 ± 0.60 b |
WGR 3 | 200.66 ± 4.12 a | 200.71 ± 5.77 a | 214.22 ± 4.56 ab | 224.22 ± 6.58 ab | 222.78 ± 5.43 b |
SGR 4 | 1.96 ± 0.03 a | 1.97 ± 0.04 ab | 2.04 ± 0.04 ab | 2.10 ± 0.04 b | 2.09 ± 0.03 b |
FI 5 | 46.48 ± 1.08 | 46.48 ± 0.88 | 45.36 ±1.24 | 47.04 ± 2.04 | 48.72 ± 2.31 |
FCE 6 | 48.45 ± 2.14 | 48.49 ± 2.55 | 53.13 ± 2.87 | 53.53 ± 3.12 | 51.40 ± 2.98 |
PER 7 | 96.59 ± 4.12 | 96.62 ± 4.52 | 105.84 ± 4.10 | 106.46 ± 4.87 | 101.79 ± 5.21 |
SR 8 | 95.00 ± 5.00 | 96.67 ± 5.77 | 95.00 ± 5.00 | 96.67 ± 2.89 | 93.33 ± 5.77 |
Parameters | Test Groups | ||||
---|---|---|---|---|---|
BN0 | BN1 | BN2 | BN3 | BN4 | |
Hematocrit (%) | 32.3 ± 1.5 a | 37.0 ± 3.6 ab | 38.0 ± 1.6 b | 40.5 ± 1.3 b | 39.7 ± 1.5 b |
Hemoglobin (mg/dL) | 12.63 ± 2.42 | 11.87 ± 1.23 | 12.56 ± 1.04 | 13.66 ± 3.12 | 14.65 ± 2.44 |
T-Cho (mg/dL) 1 | 169.3 ± 6.9 | 166.3 ± 9.8 | 171.5 ± 10.2 | 172.7 ± 12.1 | 182.0 ± 10.4 |
BUN (mg/dL) 2 | 6.3 ± 0.3 | 6.2 ± 0.6 | 6.7 ± 0.9 | 7.0 ± 1.3 | 6.3 ± 0.8 |
T-Bill (mg/dL) 3 | 0.31 ± 0.03 a | 0.56 ± 0.06 b | 0.74 ± 0.15 b | 0.88 ± 0.24 b | 0.78 ± 0.19 b |
GOT (IU/L) 4 | 68.0 ± 12.0 | 80.5 ± 16.5 | 73.0 ± 10.0 | 84.0 ± 5.51 | 96.0 ± 21.07 |
GPT(IU/L) 5 | 58.3 ± 17.1 | 56.5 ± 6.5 | 64.3 ± 13.2 | 45.7 ± 19.9 | 68.7 ± 13.3 |
TG (mg/dL) 6 | 185.0 ± 45.5 | 180.7 ± 25.1 | 207.0 ± 18.9 | 182.37 ± 31.7 | 156.0 ± 26.5 |
T-Pro (g/dL) 7 | 3.17 ± 0.23 a | 3.67 ± 0.35 ab | 3.76 ± 0.36 ab | 4.22 ± 0.26 b | 4.10 ± 0.26 ab |
GLU (mg/dL) 8 | 53.5 ± 5.5 | 52.0 ± 4.3 | 55.0 ± 9.1 | 57.3 ± 7.9 | 57.7 ± 10.2 |
Parameters | Test Groups | ||||
---|---|---|---|---|---|
BN0 | BN1 | BN2 | BN3 | BN4 | |
NBT (OD at 540 nm) | 0.61 ± 0.02 aA | 0.67 ± 0.04 abAB | 0.78 ± 0.04 bcAB | 0.82 ± 0.03 cB | 0.81 ± 0.03 cB |
Serum bactericidal activity (%) | 68.30 ± 2.30 a | 67.97 ± 3.50 a | 76.88 ± 6.50 ab | 85.23 ± 4.20 b | 81.00 ± 5.26 ab |
Mucus bactericidal activity (%) | 62.30 ± 2.40 a | 64.97 ± 2.90 ab | 66.88 ± 2.65 ab | 75.23 ± 3.10 b | 76.40 ± 5.60 ab |
Serum lysozyme activity (%) | 14.20 ± 2.40 a | 20.50 ± 2.90 ab | 21.80 ± 2.65 ab | 25.30 ± 3.10 b | 26.20 ± 3.40 b |
Mucus lysozyme activity (%) | 23.20 ± 2.50 | 22.80 ± 2.90 | 26.88 ± 3.65 | 25.23 ± 3.10 | 26.40 ± 5.60 |
Parameters | Test Groups | ||||
---|---|---|---|---|---|
BN0 | BN1 | BN2 | BN3 | BN4 | |
B. subtilis | 3.87 ± 0.45 aA | 3.98 ± 0.42 aAB | 5.50 ± 0.62 abAB | 5.69 ± 0.71 bAB | 6.21 ± 0.87 bB |
Lb. | 4.38 ± 0.54 a | 4.53 ± 0.34 ab | 5.00 ± 0.66 ab | 6.01 ± 0.69 b | 5.90 ± 0.51 b |
E. coli | 3.26 ± 0.20 b | 3.11 ± 0.18 b | 2.79 ± 0.17 b | 2.59 ± 0.11 b | 2.02 ± 0.08 a |
Total bacteria | 6.23 ± 0.25 | 6.43 ± 0.24 | 6.87 ± 0.31 | 7.02 ± 0.43 | 7.10 ± 0.50 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, Y.; Ishikawa, M.; Koshio, S.; Yokoyama, S.; Dossou, S.; Wang, W.; Seo, S.; Chen, J.; Zheng, S.; Zhang, X. Effects of Dietary Supplementation with Bacillus subtilis natto on Growth, Digestive Enzyme Activity, Immune Response, and Intestinal Microorganisms of Red Sea Bream, Pagrus major. Fishes 2024, 9, 446. https://doi.org/10.3390/fishes9110446
Zhang Y, Ishikawa M, Koshio S, Yokoyama S, Dossou S, Wang W, Seo S, Chen J, Zheng S, Zhang X. Effects of Dietary Supplementation with Bacillus subtilis natto on Growth, Digestive Enzyme Activity, Immune Response, and Intestinal Microorganisms of Red Sea Bream, Pagrus major. Fishes. 2024; 9(11):446. https://doi.org/10.3390/fishes9110446
Chicago/Turabian StyleZhang, Yukun, Manabu Ishikawa, Shunsuke Koshio, Saichiro Yokoyama, Serge Dossou, Weilong Wang, Seok Seo, Jiayi Chen, Shuang Zheng, and Xiaoxiao Zhang. 2024. "Effects of Dietary Supplementation with Bacillus subtilis natto on Growth, Digestive Enzyme Activity, Immune Response, and Intestinal Microorganisms of Red Sea Bream, Pagrus major" Fishes 9, no. 11: 446. https://doi.org/10.3390/fishes9110446
APA StyleZhang, Y., Ishikawa, M., Koshio, S., Yokoyama, S., Dossou, S., Wang, W., Seo, S., Chen, J., Zheng, S., & Zhang, X. (2024). Effects of Dietary Supplementation with Bacillus subtilis natto on Growth, Digestive Enzyme Activity, Immune Response, and Intestinal Microorganisms of Red Sea Bream, Pagrus major. Fishes, 9(11), 446. https://doi.org/10.3390/fishes9110446