Genetic Diversity and Population Structure of Chinese Longsnout Catfish (Leiocassis longirostris) Using Microsatellite DNA Markers
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection and DNA Extraction
2.2. Microsatellite Loci
2.3. Microsatellite Analyses
3. Results
3.1. Polymorphism of Markers
3.2. Genetic Variation within Different Populations
3.3. Population Genetic Differentiation and Structure
4. Discussion
4.1. Genetic Diversity
4.2. Population Structure
4.3. Conservation Implications
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ellegren, H.; Galtier, N. Determinants of genetic diversity. Nat. Rev. Genet. 2016, 17, 422–433. [Google Scholar] [CrossRef] [Scilit]
- Hughes, A.R.; Inouye, B.D.; Johnson, M.T.; Underwood, N.; Vellend, M. Ecological consequences of genetic diversity. Ecol. Lett. 2008, 11, 609–623. [Google Scholar] [CrossRef] [Scilit]
- Gamfeldt, L.; Källström, B. Increasing intraspecific diversity increases predictability in population survival in the face of perturbations. Oikos 2007, 116, 700–705. [Google Scholar] [CrossRef]
- Schäfer, D.; Vincent, H.; Fischer, M.; Kempel, A. The importance of genetic diversity for the translocation of eight threatened plant species into the wild. Glob. Ecol. Conserv. 2020, 24, e01240. [Google Scholar] [CrossRef] [Scilit]
- Frankham, R. Genetics and extinction. Biol. Conserv. 2005, 126, 131–140. [Google Scholar] [CrossRef] [Scilit]
- Liu, Z.J.; Cordes, J.F. DNA marker technologies and their applications in aquaculture genetics. Aquaculture 2004, 238, 1–37. [Google Scholar] [CrossRef] [Scilit]
- Li, J.; Wang, G.; Bai, Z. Genetic variability in four wild and two farmed stocks of the Chinese freshwater pearl mussel (Hyriopsis cumingii) estimated by microsatellite DNA markers. Aquaculture 2009, 287, 286–291. [Google Scholar] [CrossRef] [Scilit]
- Rassmann, K.; Schlötterer, C.; Tautz, D. Isolation of simple-sequence loci for use in polymerase chain reaction-based DNA fingerprinting. Electrophoresis 1991, 12, 113–118. [Google Scholar] [CrossRef] [Scilit]
- Zane, L.; Bargelloni, L.; Patarnello, T. Strategies for microsatellite isolation: A review. Mol. Ecol. 2002, 11, 1–16. [Google Scholar] [CrossRef] [Scilit]
- Abdul Muneer, P.M.; Gopalakrishnan, A.; Musammilu, K.K.; Mohindra, V.; Lal, K.K.; Basheer, V.S.; Lakra, W.S. Genetic variation and population structure of endemic yellow catfish, Horabagrus brachysoma (Bagridae) among three populations of Western Ghat region using RAPD and microsatellite markers. Mol. Biol. Rep. 2009, 36, 1779–1791. [Google Scholar] [CrossRef] [Scilit]
- Bardakci, F.; Skibinski, D.O.F. Application of the RAPD technique in tilapia fish: Species and subspecies identification. Heredity 1994, 73, 117–123. [Google Scholar] [CrossRef] [Scilit]
- O’Reilly, P.T.; Canino, M.F.; Bailey, K.M.; Bentzen, P. Inverse relationship between FST and microsatellite polymorphism in the marine fish, walleye pollock (Theragra chalcogramma): Implications for resolving weak population structure. Mol. Ecol. 2004, 13, 1799–1814. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guo, W.; Wang, Z.Y.; Wang, Y.L.; Zhang, Z.P.; Gui, J.F. Isolation and characterization of six microsatellite markers in the large yellow croaker (Pseudosciaena crocea Richardson). Mol. Ecol. Notes 2005, 5, 369–371. [Google Scholar] [CrossRef] [Scilit]
- Li, F.B.; Gui, J.F. Clonal diversity and genealogical relationships of gibel carp in four hatcheries. Anim. Genet. 2008, 39, 28–33. [Google Scholar] [CrossRef] [Scilit]
- Lu, X.; Wang, H.; Dai, P.; Liu, B. Characterization of EST-SSR and genomic-SSR markers in the clam, Meretrix meretrix. Conserv. Genet. Resour. 2011, 3, 655–658. [Google Scholar] [CrossRef] [Scilit]
- Yue, G.H.; Li, J.; Bai, Z.; Wang, C.M.; Feng, F. Genetic diversity and population structure of the invasive alien red swamp crayfish. Biol. Invasions 2010, 12, 2697–2706. [Google Scholar] [CrossRef] [Scilit]
- Guo, X.F.; Liu, M.; Zhou, Y.L.; Wei, W.Y.; Li, Z.; Zhou, L.; Wang, W.Z.; Gui, J.F. Genetic Diversity Evaluation and Population Structure Analysis of Red Swamp Crayfish (Procambarus clarkii) from Lakes and Rice Fields by SSR Markers. Fishes 2022, 7, 142. [Google Scholar] [CrossRef] [Scilit]
- Ferraris, C.J. Checklist of catfishes, recent and fossil (Osteichthyes: Siluriformes), and catalogue of siluriform primary types. Zootaxa 2007, 1418, 1–628. [Google Scholar] [CrossRef] [Scilit]
- Shen, T.; He, X.; Lei, M.; Wang, J.; Li, X.; Li, J. Cloning and structure of a histocompatibility class IIA gene (Lelo-DAA) in Chinese longsnout catfish (Leiocassis longirostris). Genes Genome 2014, 36, 745–753. [Google Scholar] [CrossRef] [Scilit]
- Luo, H.; Li, Y.; Zheng, S.; Zhou, J.; Zou, X.; Li, C.; Ye, H.; Li, Z.; Zhou, C.; Lv, G.; et al. Identification of male sex-specific markers using genome re-sequencing in the Chinese longsnout catfish Leiocassis longirostris. Aquaculture 2022, 558, 738392. [Google Scholar] [CrossRef] [Scilit]
- Wang, Z.; Zhou, J.; Ye, Y.; Wei, Q.; Wu, Q. Genetic structure and low-genetic diversity suggesting the necessity for conservation of the Chinese longsnout catfish, Leiocassis longirostris (Pisces: Bagriidae). Environ. Biol. Fishes 2006, 75, 455–463. [Google Scholar] [CrossRef] [Scilit]
- Zhu, L.; Li, Z.H.; Li, X.X.; Yang, Z.Q. Artificial breeding and culture techniques of Leiocassis longirostris. Aquac. 2020, 41, 54–55. [Google Scholar]
- Yu, H.; Li, Q. Genetic variation of wild and hatchery populations of the Pacific oyster Crassostrea gigas assessed by microsatellite markers. J. Genet. Genom. 2007, 34, 1114–1122. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thorpe, J.P.; Solé-Cava, A.M.; Watts, P.C. Exploited marine invertebrates: Genetics and fisheries. Mar. Genet. 2000, 144, 165–184. [Google Scholar]
- Xiao, M.; Yang, G. Isolation and characterization of 17 microsatellite loci for the Chinese longsnout catfish (Leiocassis longirostris). Mol. Ecol. Resour. 2009, 9, 1039–1041. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, L.; Mou, C.; Zhou, J.; Ye, H.; Wei, Z.; Ke, H.; Hang, Z.; Duan, Y.; Zhao, Z.; Zhao, H.; et al. Genetic Diversity of Chinese Longsnout Catfish (Leiocassis longirostris) in Four Farmed Populations Based on 20 New Microsatellite DNA Markers. Diversity 2022, 14, 654. [Google Scholar] [CrossRef] [Scilit]
- Lalitha, S. Primer Premier 5. Biotech Sofw. Int. Rep. 2000, 1, 270–272. [Google Scholar] [CrossRef] [Scilit]
- Holland, M.M.; Parson, W. GeneMarker® HID: A reliable software tool for the analysis of forensic STR data. J. Forensic Sci. 2011, 56, 29–35. [Google Scholar] [CrossRef] [Scilit]
- Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research–an update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef] [Scilit]
- Meirmans, P.G. Using the AMOVA framework to estimate a standardized genetic differentiation measure. Evolution 2006, 60, 2399–2402. [Google Scholar] [CrossRef] [Scilit]
- Meirmans, P.G.; Hedrick, P.W. Assessing population structure: FST and related measures. Mol. Ecol. Resour. 2011, 11, 5–18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Balloux, F.; Goudet, J. Statistical properties of population differentiation estimators under stepwise mutation in a finite island model. Mol. Ecol. 2002, 11, 771–783. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Excoffier, L.; Lischer, H.E.L. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Mol. Ecol. Resour. 2010, 10, 564–567. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cavalli-Sforza, L.L.; Edwards, A.W. Phylogenetic analysis. Models and estimation procedures. Am. J. Hum. Genet. 1967, 19, 233–257. [Google Scholar] [PubMed]
- Kimura, M. Process Leading to Quasi-Fixation of Genes in Natural Populations Due to Random Fluctuation of Selection Intensities. Genetics 1954, 39, 280–295. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pritchard, J.K.; Stephens, M.; Donnelly, P. Inference of population structure using multilocus genotype data. Genetics 2000, 155, 945–959. [Google Scholar] [CrossRef] [Scilit]
- Evanno, G.; Regnaut, S.; Goudet, J. Detecting the number of clusters of individuals using the software STRUCTURE: A simulation study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef] [Scilit]
- Earl, D.A.; VonHoldt, B.M. STRUCTURE HARVESTER: A website and program for visualizing STRUCTURE output and implementing the Evanno method. Conserv. Genet. Resour. 2012, 4, 359–361. [Google Scholar] [CrossRef] [Scilit]
- Jakobsson, M.; Rosenberg, N.A. CLUMPP: A cluster matching and permutation program for dealing with label switching and multimodality in analysis of population structure. Bioinformatics 2007, 23, 1801–1806. [Google Scholar] [CrossRef] [Scilit]
- Rosenberg, N.A. DISTRUCT: A program for the graphical display of population structure. Mol. Ecol. Notes 2004, 4, 137–138. [Google Scholar] [CrossRef] [Scilit]
- Kalinowski, S.T.; Taper, M.L.; Marshall, T.C. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Mol. Ecol. 2007, 16, 1099–1106. [Google Scholar] [CrossRef] [Scilit]
- Dray, S.; Legendre, P.; Peres-Neto, P.R. Spatial modelling: A comprehensive framework for principal coordinate analysis of neighbour matrices (PCNM). Ecol. Model. 2006, 196, 483–493. [Google Scholar] [CrossRef] [Scilit]
- Rice, W.R. Analyzing tables of statistical tests. Evolution 1989, 43, 223–225. [Google Scholar] [CrossRef] [Scilit]
- Wright, S. Evolution in Mendelian populations. Genetics 1931, 16, 97. [Google Scholar] [CrossRef] [Scilit]
- Botstein, D.; White, R.L.; Skolnick, M.; Davis, R.W. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am. J. Hum. Genet. 1980, 32, 314. [Google Scholar]
- Conover, D.O. Local adaptation in marine fishes: Evidence and implications for stock enhancement. Bull. Mar. Sci. 1998, 62, 477–493. [Google Scholar]
- Hughes, A.R.; Stachowicz, J.J. Genetic diversity enhances the resistance of a seagrass ecosystem to disturbance. Proc. Natl. Acad. Sci. USA 2004, 101, 8998–9002. [Google Scholar] [CrossRef] [Scilit]
- Hoban, S.; Arntzen, J.A.; Bruford, M.W.; Godoy, J.A.; Rus Hoelzel, A.; Segelbacher, G.; Vilà, C.; Bertorelle, G. Comparative evaluation of potential indicators and temporal sampling protocols for monitoring genetic erosion. Evol. Appl. 2014, 7, 984–998. [Google Scholar] [CrossRef] [Scilit]
- DeWoody, J.A.; Avise, J.C. Microsatellite variation in marine, freshwater and anadromous fishes compared with other animals. J. Fish Biol. 2000, 56, 461–473. [Google Scholar] [CrossRef]
- Yang, G.; Xiao, M.; Yu, Y.; Xu, S. Genetic variation at mtDNA and microsatellite loci in Chinese longsnout catfish (Leiocassis longirostris). Mol. Biol. Rep. 2012, 39, 4605–4617. [Google Scholar] [CrossRef] [Scilit]
- Reiner, G.; Lang, M.; Willems, H. Impact of different panels of microsatellite loci, different numbers of loci, sample sizes, and gender ratios on population genetic results in red deer. Eur. J. Wildl. Res. 2019, 65, 25. [Google Scholar] [CrossRef] [Scilit]
- Liu, F.; Xia, J.H.; Bai, Z.Y.; Fu, J.J.; Li, J.L.; Yue, H.G. High genetic diversity and substantial population differentiation in grass carp (Ctenopharyngodon idella) revealed by microsatellite analysis. Aquaculture 2009, 297, 51–56. [Google Scholar] [CrossRef] [Scilit]
- Berrebi, P.; Jesenšek, D.; Crivelli, A.J. Natural and domestic introgressions in the marble trout population of Soča River (Slovenia). Hydrobiologia 2017, 785, 277–291. [Google Scholar] [CrossRef] [Scilit]
- Berrebi, P.; Povz, M.; Jesensek, D.; Cattaneo-Berrebi, G.; Crivelli, A.J. The genetic diversity of native, stocked and hybrid populations of marble trout in the Soca river, Slovenia. Heredity 2000, 85, 277–287. [Google Scholar] [CrossRef] [Scilit]
- Gross, R.; Gum, B.; Reiter, R.; Kühn, R. Genetic introgression between Arctic charr (Salvelinus alpinus) and brook trout (Salvelinus fontinalis) in Bavarian hatchery stocks inferred from nuclear and mitochondrial DNA markers. Aquac. Int. 2004, 12, 19–32. [Google Scholar] [CrossRef] [Scilit]




| Location | Sample Name | Sample Size | Geographic Locations | Collection Date |
|---|---|---|---|---|
| Upper reaches of Yangtze River | Yibin (YB) | 14 | Sichuan (28.7669° N, 104.6279° E) | June 2022 |
| Jiangan (JA) | 13 | Sichuan (28.7359° N, 105.0724° E) | October 2021 | |
| Middle reaches of Yangtze River | Shishou (SS) | 18 | Hubei (29.7382° N, 112.3955° E) | June 2022 |
| Jiayu (JY) | 34 | Hubei (29.9956° N, 113.8760° E) | October 2021 | |
| Wuhan (WH) | 7 | Hubei (30.6827° N, 114.5270° E) | July 2021 | |
| Lower reaches of Yangtze River | Anqing (AQ) | 20 | Anhui (29.8971° N, 116.3881° E) | May 2022 |
| Zhenjiang (ZJ) | 8 | Jiangsu (32.1976° N, 119.2702° E) | December 2021 | |
| Upper reaches of Pearl River | Zhexiang (PRZX) | 27 | Guizhou (25.1621° N, 106.2552° E) | May 2022 |
| Sichuan Province | Stock seed (SCYZ) | 29 | Sichuan (30.3958° N, 103.6672° E) | October 2021 |
| Locus | Repeat Motif | Forward Primer Sequence (5′-3′) | Reverse Primer Sequence (5′-3′) | Allele Ranges (bp) |
|---|---|---|---|---|
| Lli033 | (CA)11 | GCTTGCACACGTCTGTGTTT | GCATCTGGTCAGGTGTTTCA | 192–198 |
| Lli060 | (GT)22 | GAACGAGGTGCAGCAGTACA | CAACATCAGCAAGTTCCAGC | 195–212 |
| Lli075 | (AT)8 | GAGAGCCTTCTGTCACTCGG | TGAGCTTTGTTCTTGCGATG | 254–264 |
| Lli079 | (GT)19 | CAGGGTTCTTTGGCACCTTA | ATGTGTTCAGGGATTCCAGC | 209–215 |
| Lli081 | (TG)15 | TGTTCTGTGGTGGCTTTACG | GCTCGTTAAAGGAGGGAAGG | 143–147 |
| Lli083 | (AC)12 | CAGACAAAGGCACTGATGGA | CTGCTGCTGTGATGTGTTGA | 237–251 |
| Lli093 | (ATC)9 | TGACGCCTCGTCATATCAGT | TACCGAGGTGAAACTTTGGC | 286–303 |
| Lli102 | (TTA)16 | TTTCACACTTCCTCGTGCAT | ACTCCACTGAGGGTGAAACG | 239–245 |
| Lli104 | (AC)6 | AGGTTGCGTAAAGGTTGTGG | CGTTGCTGTTGTAACGGAGA | 336–346 |
| Lli128 | (CT)11 | ACAAGATCATGCTAGGCGCT | TGAGACCAGGCTGTGATGTC | 260–278 |
| Lli134 | (AG)14 | TGGGTGGAGCTAATTTCTGG | TGAGACTGTGCTGCTGTTCC | 282–295 |
| Lli159 | (CT)11 | CTGCCACAGAAAGCACAGTC | CCTAAAGACACGAGGAAGCG | 237–252 |
| Lli167 | (AAT)22 | AGCCGTGAACAGAAGGAGTT | GGGACGGAAAGATGTTCTGA | 217–238 |
| Lli181 | (GT)16 | ACAATGACGCAGGAAGAGGA | TACCCTGGCCTTTGTGAGAC | 230–245 |
| Lli190 | (CTCA)11 | TGGATCCCTAGCCCTATCCT | TTGCATGTCGTTCACAGTCA | 252–271 |
| Locus | Na | ne | I | Ho | He | Fis | PIC | Prob | Signif |
|---|---|---|---|---|---|---|---|---|---|
| Lli033 | 10 | 3.3 | 1.50 | 0.66 | 0.70 | −0.03 | 0.66 | 0.00 | *** |
| Lli060 | 13 | 6.7 | 2.11 | 0.80 | 0.85 | −0.02 | 0.84 | 0.00 | *** |
| Lli075 | 10 | 2.4 | 1.24 | 0.49 | 0.59 | 0.11 | 0.55 | 0.00 | *** |
| Lli079 | 16 | 4.7 | 1.81 | 0.76 | 0.79 | −0.03 | 0.76 | 0.00 | *** |
| Lli081 | 12 | 3.9 | 1.59 | 0.71 | 0.74 | 0.01 | 0.70 | 0.00 | *** |
| Lli083 | 13 | 4.6 | 1.83 | 0.74 | 0.78 | −0.03 | 0.76 | 0.00 | *** |
| Lli093 | 9 | 5.1 | 1.76 | 0.74 | 0.80 | 0.06 | 0.78 | 0.00 | *** |
| Lli102 | 12 | 3.8 | 1.58 | 0.69 | 0.73 | −0.01 | 0.69 | 0.00 | *** |
| Lli104 | 11 | 5.1 | 1.84 | 0.80 | 0.80 | 0.00 | 0.78 | 0.07 | ns |
| Lli128 | 15 | 6.8 | 2.14 | 0.85 | 0.85 | −0.05 | 0.84 | 0.00 | *** |
| Lli134 | 14 | 6.2 | 2.05 | 0.78 | 0.84 | 0.01 | 0.82 | 0.00 | *** |
| Lli159 | 14 | 2.6 | 1.33 | 0.60 | 0.62 | −0.08 | 0.58 | 0.00 | *** |
| Lli167 | 12 | 8.9 | 2.27 | 0.93 | 0.89 | −0.13 | 0.88 | 0.02 | * |
| Lli181 | 13 | 5.0 | 1.95 | 0.77 | 0.80 | −0.04 | 0.78 | 0.00 | *** |
| Lli190 | 11 | 3.9 | 1.69 | 0.73 | 0.75 | −0.03 | 0.72 | 0.00 | *** |
| Mean | 12.3 | 4.9 | 1.78 | 0.74 | 0.77 | −0.02 | 0.74 | ||
| St Dev | 1.95 | 1.73 | 0.30 | 0.10 | 0.08 |
| Population | Na | ne | I | Ho | He | F | |
|---|---|---|---|---|---|---|---|
| AQ | Mean | 8.9 | 5.30 | 1.80 | 0.77 | 0.78 | 0.02 |
| SE | 0.6 | 0.55 | 0.10 | 0.04 | 0.02 | 0.04 | |
| JA | Mean | 5.5 | 3.65 | 1.41 | 0.72 | 0.70 | −0.04 |
| SE | 0.4 | 0.28 | 0.09 | 0.05 | 0.03 | 0.05 | |
| JY | Mean | 7.3 | 4.48 | 1.62 | 0.75 | 0.75 | 0.00 |
| SE | 0.5 | 0.38 | 0.08 | 0.02 | 0.02 | 0.02 | |
| SCYZ | Mean | 5.2 | 2.94 | 1.19 | 0.72 | 0.61 | −0.18 |
| SE | 0.3 | 0.28 | 0.08 | 0.05 | 0.04 | 0.02 | |
| SS | Mean | 6.6 | 4.28 | 1.56 | 0.78 | 0.74 | −0.06 |
| SE | 0.6 | 0.39 | 0.09 | 0.04 | 0.03 | 0.03 | |
| WH | Mean | 5.3 | 4.04 | 1.42 | 0.71 | 0.70 | −0.02 |
| SE | 0.5 | 0.44 | 0.11 | 0.06 | 0.04 | 0.06 | |
| YB | Mean | 5.6 | 3.44 | 1.37 | 0.71 | 0.68 | −0.07 |
| SE | 0.4 | 0.26 | 0.08 | 0.04 | 0.03 | 0.04 | |
| ZJ | Mean | 7.1 | 5.12 | 1.77 | 0.70 | 0.79 | 0.12 |
| SE | 0.2 | 0.29 | 0.04 | 0.04 | 0.01 | 0.05 | |
| PRZX | Mean | 5.7 | 3.73 | 1.42 | 0.71 | 0.70 | −0.01 |
| SE | 0.4 | 0.33 | 0.09 | 0.04 | 0.03 | 0.04 | |
| Total | Mean | 6.3 | 4.11 | 1.51 | 0.73 | 0.72 | −0.03 |
| SE | 0.2 | 0.13 | 0.03 | 0.01 | 0.01 | 0.01 |
| AQ | JA | JY | SCYZ | SS | WH | YB | ZJ | PRZX | |
|---|---|---|---|---|---|---|---|---|---|
| AQ | - | 2.89 | 3.66 | 2.02 | 3.39 | 3.20 | 2.48 | 4.57 | 2.89 |
| JA | 0.080 | - | 11.08 | 4.05 | 13.51 | 4.07 | 10.30 | 5.34 | 16.14 |
| JY | 0.064 | 0.022 | - | 5.53 | 18.90 | 8.75 | 8.85 | 9.86 | 11.33 |
| SCYZ | 0.110 | 0.058 | 0.043 | - | 5.16 | 3.96 | 5.05 | 3.65 | 4.76 |
| SS | 0.069 | 0.018 | 0.013 | 0.046 | - | 6.38 | 10.79 | 7.32 | 17.02 |
| WH | 0.072 | 0.058 | 0.028 | 0.059 | 0.038 | - | 3.56 | 5.76 | 4.27 |
| YB | 0.092 | 0.024 | 0.027 | 0.047 | 0.023 | 0.066 | - | 4.77 | 14.14 |
| ZJ | 0.052 | 0.045 | 0.025 | 0.064 | 0.033 | 0.042 | 0.050 | - | 5.77 |
| PRZX | 0.080 | 0.015 | 0.022 | 0.050 | 0.014 | 0.055 | 0.017 | 0.042 | - |
| AQ | JA | JY | SCYZ | SS | WH | YB | ZJ | PRZX | |
|---|---|---|---|---|---|---|---|---|---|
| AQ | |||||||||
| JA | 0.362 | ||||||||
| JY | 0.308 | 0.103 | |||||||
| SCYZ | 0.401 | 0.181 | 0.135 | ||||||
| SS | 0.321 | 0.088 | 0.065 | 0.139 | |||||
| WH | 0.310 | 0.238 | 0.140 | 0.225 | 0.172 | ||||
| YB | 0.382 | 0.100 | 0.099 | 0.135 | 0.085 | 0.255 | |||
| ZJ | 0.320 | 0.255 | 0.194 | 0.291 | 0.220 | 0.259 | 0.275 | ||
| PRZX | 0.346 | 0.068 | 0.086 | 0.135 | 0.073 | 0.213 | 0.072 | 0.234 |
| Source | df | SS | MS | Est. Var. | % |
|---|---|---|---|---|---|
| Among Pops | 8 | 149.012 | 18.627 | 0.355 | 6% |
| Among Indiv | 161 | 899.005 | 5.584 | 0.071 | 1% |
| Within Indiv | 170 | 925.000 | 5.441 | 5.441 | 93% |
| Total | 339 | 1973.018 | 5.868 | 100% |
| Source | df | SS | MS | Est. Var. | % |
|---|---|---|---|---|---|
| Among Pops | 1 | 19.545 | 19.545 | 0.159 | 3% |
| Among Indiv | 112 | 720.775 | 6.435 | 0.479 | 8% |
| Within Indiv | 114 | 624.500 | 5.478 | 5.478 | 90% |
| Total | 227 | 1364.820 | 6.116 | 100% |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hou, Y.; Ye, H.; Song, X.; Fan, J.; Li, J.; Shao, J.; Wang, Y.; Lin, D.; Yue, H.; Ruan, R.; et al. Genetic Diversity and Population Structure of Chinese Longsnout Catfish (Leiocassis longirostris) Using Microsatellite DNA Markers. Fishes 2024, 9, 35. https://doi.org/10.3390/fishes9010035
Hou Y, Ye H, Song X, Fan J, Li J, Shao J, Wang Y, Lin D, Yue H, Ruan R, et al. Genetic Diversity and Population Structure of Chinese Longsnout Catfish (Leiocassis longirostris) Using Microsatellite DNA Markers. Fishes. 2024; 9(1):35. https://doi.org/10.3390/fishes9010035
Chicago/Turabian StyleHou, Yanling, Huan Ye, Xinhua Song, Jiahui Fan, Junyi Li, Jian Shao, Yizhou Wang, Danqing Lin, Huamei Yue, Rui Ruan, and et al. 2024. "Genetic Diversity and Population Structure of Chinese Longsnout Catfish (Leiocassis longirostris) Using Microsatellite DNA Markers" Fishes 9, no. 1: 35. https://doi.org/10.3390/fishes9010035
APA StyleHou, Y., Ye, H., Song, X., Fan, J., Li, J., Shao, J., Wang, Y., Lin, D., Yue, H., Ruan, R., & Li, C. (2024). Genetic Diversity and Population Structure of Chinese Longsnout Catfish (Leiocassis longirostris) Using Microsatellite DNA Markers. Fishes, 9(1), 35. https://doi.org/10.3390/fishes9010035
