Next Article in Journal
Examination of Social Behavior and Cognition in Clownfish (Amphiprion ocellaris): Relationship to Artificial Rearing of Juveniles
Previous Article in Journal
Citizen Science Facilitates Reporting of Reef Fish Species’ Ecological Health Indicators in the Great Barrier Reef, Australia
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fishes
Volume 10
Issue 11
10.3390/fishes10110548
fishes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Dietary Black Soldier Fly (Hermetia illucens) Oil Supplementation on Flesh Quality of Largemouth Bass (Micropterus salmoides)

by
Zichuan Wang
1,2,
Yidan Cao
1,2,
Wei Yang
1,2,
Zeting Wang
1,2,
Yang Kuang
1,2,
Ping Wu
1,2,*,
Chunfang Cai
1,2 and
Yuantu Ye
1,2
1
School of Life Sciences, Soochow University, Suzhou 215123, China
2
Key Laboratory of Aquatic Animal Nutrition, Soochow University, Suzhou 215123, China
*
Author to whom correspondence should be addressed.
Fishes 2025, 10(11), 548; https://doi.org/10.3390/fishes10110548
Submission received: 29 September 2025 / Revised: 23 October 2025 / Accepted: 25 October 2025 / Published: 29 October 2025
(This article belongs to the Section Nutrition and Feeding)
Browse Figures
Versions Notes

Abstract

Black soldier fly (Hermetia illucens) larvae are a promising source of insect lipids, characterized by rapid fatty acid accumulation and a high lauric acid content. This study investigated the effects of dietary black soldier fly oil (BSFO) on muscle quality in largemouth bass (Micropterus salmoides). Experimental diets were formulated to be isonitrogenous, isolipidic, and isophosphoric, with 1.0% and 2.0% BSFO partially replacing soybean oil. A control group received 2.3% soybean oil without BSFO or glycerol monolaurate (GML), while positive controls were supplemented with 0.35% and 0.7% GML. Fish (initial weight: 25.08 ± 0.12 g) were cultured in pond cages for 56 days, and three replicates were established for each treatment group. Muscle quality and nutritional traits were evaluated, including proximate composition, fatty acid profiles, texture properties, fiber diameter, hydroxyproline content, antioxidant capacity, and expression of genes related to muscle development, atrophy, apoptosis, and mTOR signaling. Compared with the control, the 2.0% BSFO group showed a significant increase in muscle hydroxyproline content (p < 0.05), while GML supplementation led to a significant decrease (p < 0.05). In the 1.0% BSFO group, muscle saturated fatty acid (SFA) and monounsaturated fatty acid (MUFA) contents were unchanged (p > 0.05), but n-3/n-6 polyunsaturated fatty acid (PUFA) ratios and highly unsaturated fatty acid (HUFA) levels were significantly elevated (p < 0.05). The dietary supplementation of BSFO enhanced the levels of high-quality fatty acids in the muscle tissue. Antioxidant capacity was also significantly enhanced in the 1.0% BSFO group (p < 0.05) but reduced in the GML groups (p < 0.05). Texture analysis showed that BSFO significantly improved muscle hardness, elasticity, chewiness, and gumminess (p < 0.05). Gene expression analysis revealed no significant effects of BSFO on genes related to myogenesis (myod and myog) and muscle atrophy (mstn and murf1), or apoptosis-related genes (caspase8, caspase9, and caspase3) (p > 0.05); mTOR signaling pathway-related genes (s6k1 and akt1) were significantly upregulated in the 2.0% BSFO group (p < 0.05). In contrast, 0.7% GML significantly upregulated genes related to myogenesis (myod, myf5, and myog), muscle atrophy (mstn, fbxo32, and murf1), and apoptosis (caspase8, caspase9, and caspase3) (p < 0.05). In summary, dietary supplementation with 2.0% BSFO effectively enhances muscle quality in largemouth bass without negatively impacting muscle development.
Keywords:
insect lipids; flesh quality; texture property; antioxidant capacity; muscle development
Key Contribution: Our study aimed to assess the impact of substituting soybean oil with black soldier fly (Hermetia illucens) oil on various aspects of largemouth bass (Micropterus salmoides), including overall body composition, muscle characteristics, fatty acid profiles, textural properties, muscle fiber diameter, muscle antioxidant capacity, and the expression levels of genes associated with muscle development and apoptosis. Notably, dietary supplementation with BSFO effectively enhances muscle quality in largemouth bass.

1. Introduction

Lipids are indispensable in fish nutrition, serving as a vital source of energy and essential nutrients that are fundamental to the growth and health of aquatic species. Traditionally, soybean oil has been a preferred lipid source in commercial fish feed due to its high quality and nutritional value [1]. However, the extensive use of plant-based fats, such as soybean oil, has raised concerns over its competition with human land resources and the associated environmental implications, including deforestation and the excessive application of fertilizers and pesticides. For the sustainable development of aquaculture, it has become important to find new sources of high-quality fats with less impact on environment.
Insects have garnered extensive attention from researchers as a potential feed source for some aquatic animals in recent years [2]. Insects have advantages such as high fertility, fast growth rates, renewable resources, and the ability to utilize organic waste. The black soldier fly (Hermitia illucens) is one of the resource insects designated by the Food and Agriculture Organization (FAO) of the United Nations due to its nutritional comprehensiveness, being well-tolerated, and ease of factory farming [3]. Black soldier fly larvae are rich in medium-chain fatty acids, with lauric acid constituting 21.4–49.3% of total fatty acids [4]. Initially considered a by-product, black soldier fly oil (BSFO) has now attracted attention as a suitable lipid source due to its high lipid content and unique fatty acid profile [5].
Currently, black soldier fly oil has been reported as a fat source for aquatic animal feed. Fawole et al. [6] found that feeding BSFO did not adversely affect the normal performance of juvenile rainbow trout (Oncorhynchus mykiss) or fatty acid deposition in muscle. At the same time, adding BSFO to feed could promote growth, effectively prevent the development of enteritis, and improve the immunity of rainbow trout [5]. Sudha et al. [7] found that BSFO significantly enhanced the expression levels of myod and myog in the white muscle of juvenile striped catfish (Pangasianodon hypophthalmus), thereby promoting muscle development. Furthermore, adding BSFO to feed affects the fatty acid composition of fish because of the high content of lauric acid in BSFO [8,9,10]. So far, BSFO has been less studied in largemouth bass (Micropterus salmoides). Xia et al. [11] found that replacing fish oil with BSFO in largemouth bass feed had no negative effects on growth and decreased liver glycogen content. Conversely, adding BSFO to feed was beneficial for the immunity promotion of largemouth bass.
Largemouth bass, known for its excellent growth performance, strong resilience, and low disease incidence, has become a key economic freshwater fish species [12]. FAO statistics reveal that global annual production of largemouth bass increased from 621 kilotonnes to 804 kilotonnes between 2020 and 2022 [13]. With the expansion of largemouth bass farming, there is a growing imperative to develop new feed lipid sources. Moreover, as living standards improve, consumer demand for high-quality aquatic products is increasing, making the flesh quality of fish a critical consideration when seeking lipid substitutes. After lipid substitution, the flesh quality of fish should not deteriorate and, ideally, should be enhanced.
In this study, we investigated the effects of partially replacing soybean oil with BSFO in feed on the body composition and muscle texture of largemouth bass. Our findings aim to provide data supporting the substitution of soybean oil with BSFO in feed and contribute to the development of new, low-carbon feed options.

2. Materials and Methods

2.1. Experimental Feed and Groups

Five isonitrogenous and isolipidic feeds with 53% crude protein and 8.6% crude lipids were formulated using fishmeal and soybean meal as the main protein sources and soybean oil, BSFO, and glyceryl monolaurate as the main lipid sources. A BSFO-free diet was used as the control. The experimental diets were formulated to be isonitrogenous, isolipidic, and isophosphoric, with 1.0% and 2.0% BSFO partially replacing soybean oil. The control diet contained 2.3% soybean oil with neither BSFO nor glycerol monolaurate (GML), whereas the positive control diets were supplemented with 0.35% and 0.7% GML. Feed ingredients were thoroughly pulverized to pass through a 60-mesh sieve; under full mixing, the oil was mixed and the right amount of water was added to make pellets. The pellet feed was dried at 40 °C and stored at −20 °C until use. The experimental diet formulation and proximate composition are shown in Table 1.
The black soldier fly larvae were rinsed three times with tap water and ultrapure water, and then dried using vacuum freeze-drying. The dried BSFL were subjected to mechanical pressing to extract oil. The extracted oil was centrifuged at 13,000 rpm for 10 min at 40 °C, and the clear supernatant was collected as the BSFO used in this study.

2.2. Experimental Fish and the Feeding Trial

The experimental fish were fed in net cages (1.8 m × 1.5 m × 1.8 m) in a pond covering an area of 10,000 m2. The experimental fish were fed with the diet of the control group for two weeks for acclimation. A total of 600 healthy largemouth bass were randomly divided into 15 net cages (1.8 m × 1.5 m × 1.8 m), with 40 fish per cage (stocking density: 8.23 fish/m3), which had an initial average body weight of 25.08 ± 0.12 g. During the eight-week culture trial, the fish were fed twice daily (06:30 and 17:00) with 3% of their body weight. During farming, the water temperature was maintained at 24–35 °C, dissolved oxygen > 6 mg/L, pH = 7.6 ± 0.5, and NH4+-N < 0.01 mg/L.

2.3. Sample Collection

After the 8-week feeding trial, the fish were fasted for 24 h and anesthetized with an appropriate amount of MS-222 (0.1 mL/L). Three fish were taken from each net cage and stored at −20 °C for body component analysis. Nine fish (three fish for the determination of muscle antioxidant capacity, three fish for the measurement of glycogen and hydroxyproline content in muscle, and three fish for gene expression analysis) in each net cage were randomly selected for dissection, and muscles above the left lateral line were collected, frozen in liquid nitrogen, and stored at −80 °C for biochemical analysis and gene expression analysis. Another 3 fish were dissected, and the muscles above the left lateral line were stored in a 4% paraformaldehyde solution at 4 °C for histologic section preparation. Three fish were taken from each net cage to remove scales and skin, and the muscle below the dorsal fin and above the left lateral line was cut into 1 cm × 1 cm × 1 cm square muscle blocks for texture analysis.

2.4. Proximate Analysis of Body and Muscle Composition

The moisture, crude protein, crude fat, and crude ash contents were calculated according to the National Standards GB5009.3-2016 [14], GB6432-2018 [15], GB/T6433-2006 [16], and GB5009.4-2016 [17], respectively. The fatty acid composition was determined with a fatty acid profile analyzer (6980N, Agilent Technologies, Santa Clara, CA, USA), and the glycogen and hydroxyproline contents of the muscle were determined using the A043-1-1 and A030-2-1 commercial assay kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China).

2.5. Muscle Antioxidant Capacity

Muscle samples were homogenized using a high-throughput tissue grinder (JXFSTPRP-24; Shanghai Jingxin, Shanghai, China). Total superoxide dismutase (T-SOD) and total antioxidant capacity (T-AOC) in muscle were measured by the colorimetric method using the A001-1-2 and A015-1-2 commercial assay kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China).

2.6. Texture Properties of Muscle

Six textural parameters, including hardness, elasticity, chewiness, cohesiveness, gumminess, and resilience, were measured using a texture analyzer (Rapid TA+; Shanghai Tengba Instrument Technology, Shanghai, China). The analyzer was operated with the following parameters: P/36R probe diameter of 3.6 mm, test speeds of 5 mm/s, downward pressure distance of 30% of the sample thickness at 4 s intervals, and a trigger force setting of 5 g.

2.7. Histology of Muscle

Muscle samples were dehydrated in ethanol, infiltrated in xylene, embedded in paraffin, cut serially (5 μm thick), and then stained with hematoxylin and eosin. Sections were observed using a light microscope (DM500; Leica, Wetzlar, German) and photographed. The diameters of the muscle fibers were expressed as the longest axis length using imaging software (ImageJ 2025, USA).

2.8. RT-qPCR Analysis

Total RNA was extracted from muscle using Trizol reagent. RNA concentration was determined using a micro-UV spectrophotometer (NanoDrop 2000; Thermo, Waltham, MA, USA). The total RNA was reverse-transcribed into cDNA with the PrimerScriptTM RT reagent kit with the gDNA Eraser (TaKaRa, Dalian, China) and then stored at −20 °C. The relative expression levels of gapdh were used as an internal reference, and the relative expression levels of the target genes were calculated using the 2−∆∆CT method [18]. Primers designed by Primer Premier 5.0 and the sequences are shown in Table 2.

2.9. Statistical Analysis

SPSS 26 was used for statistical analysis. One-way ANOVA was carried out with Duncan’s multiple-range test at a significance level of 0.05. All the results are presented as means ± standard errors (SEMs). Bar graphs were produced using Origin 2021 software.

3. Results

3.1. The Effect of Black Soldier Fly Oil Supplementation on Body and Muscle Composition

Largemouth bass fed with different levels of BSFO exhibited no significant impact on the crude lipid, crude protein, or ash contents of their whole bodies or muscles (p > 0.05) (Table 3).

3.2. The Effect of Black Soldier Fly Oil and Glyceryl Monolaurate Supplementation on the Glycogen and Hydroxyproline Contents of Muscle

There were no significant effects on glycogen contents in the BSFO and GML groups compared with the control group (p > 0.05) (Table 4). Compared with the control group and BSFO1, hydroxyproline content was significantly increased in the BSFO2 group, whereas it was decreased in both the GML0.35 and GML0.7 groups (p < 0.05) (Table 4).

3.3. The Effect of Black Soldier Fly Oil Supplementation on the Fatty Acid Composition of Body and Muscle

Table 5 shows the effects on the fatty acid composition of the bodies and muscles of largemouth bass exerted by black soldier fly oil supplementation. C12:0 (lauric acid), C14:0, and ∑SFA contents in the body were significantly higher in the BSFO supplementation groups compared with the control group (p < 0.05), and C20:5n-3 (EPA), C22:6n-3 (DHA), ∑n-3 PUFA, and ∑HUFA contents were significantly lower in the BSFO groups compared with the control group (p < 0.05). The n-3/n-6 PUFA ratios were not significantly different across all groups (p > 0.05).
In the muscle, EPA, HUFA, and∑n-3 PUFA contents were significantly higher in the BSFO groups compared with the control group (p < 0.05), and the contents of DHA and ∑n-6 PUFAs were significantly lower in the control group (p < 0.05). The n-3/n-6 PUFA ratios were significantly higher in the BSFO groups than in the control group (p < 0.05).

3.4. The Effect of Black Soldier Fly Oil and Glyceryl Monolaurate Supplementation on the Antioxidant Capacity of Muscle

There was no significant difference in T-SOD activity among the groups (p > 0.05), as shown in Table 6. The T-AOC in the muscle was not affected by BSFO supplementation (p > 0.05) and was significantly lower in the GML0.35 and GML0.7 groups compared with the control group (p < 0.05).

3.5. The Effect of Black Soldier Fly Oil Supplementation on the Texture of Muscle

As shown in Table 7, the hardness, elasticity, chewiness, and gumminess of muscle significantly increased compared with the control (p < 0.05), and cohesiveness and resilience were not affected by BSFO supplementation (p > 0.05).

3.6. The Effect of Black Soldier Fly Oil Supplementation on the Histology of Muscle

As shown in Figure 1, compared with the control, the mean diameter of myofibers and the distribution of them in the muscle were not affected by BSFO supplementation (p > 0.05). The histological morphological structure of largemouth bass myofibers was similar in both the soybean oil feed group and the BSFO groups.

3.7. The Effect of Fat Source Supplementation on the Relative Gene Expression Levels in the Muscle

The relative expression levels of myogenesis genes, TOR pathway-related genes, and muscle apoptosis-related genes of largemouth bass are shown in Figure 2. Compared with the control group, the relative expression levels of myf5 related to myog were significantly lower in the BSFO1 group (p < 0.05), and the relative expression levels of fbxo32 related to muscle atrophy were significantly higher in the BSFO2 group (p < 0.05). Adding BSFO to the diet reduced the relative expression levels of 4ebp1 significantly (p < 0.05). The relative expression levels of akt1 and s6k1 were significantly higher in the BSFO2 group (p < 0.05). The results showed that the addition of BSFO in the diet had no significant effect on the relative expression levels of apoptosis-related genes (p > 0.05).
Compared with the control group, the relative expression levels of all genes related to myogenesis, the TOR pathway, and muscle apoptosis were significantly higher in the GML0.7 group (p < 0.05), and the relative expression levels of fbxo32, s6k1, caspase8, and caspase9 were significantly lower in the GML0.35 group (p < 0.05).

4. Discussion

4.1. Effect of BSFO Replacing Soybean Oil on Flesh Quality of Largemouth Bass

Flesh textural characteristics, pivotal in quality assessment, are typically evaluated using the texture profile analysis method [19]. This method quantifies key textural parameters such as hardness, elasticity, chewiness, cohesiveness, gumminess, and resilience, mimicking the human chewing process. These parameters are influenced by several factors, including intramuscular and intermuscular fat content, collagen content in connective tissues, and myofiber diameter and density [20]. Notably, hardness is a critical parameter for consumers, often reflecting the perceived value of meat [21]. Previous studies on fish have shown that the addition of black soldier fly oil alters the texture of flesh in terms of changes in hardness, elasticity, chewiness, and gumminess [22,23,24]. In this study, we found that hardness, elasticity, chewiness, and gumminess reached higher values in the BSFO1 group, while they decreased in the BSFO2 group, whose diet was characterized by a higher degree of substitution compared with the BSFO1 group, though the values were still higher than in the control group. This result is similar to a previous discovery in largemouth bass, where the addition of BSFO to the diet significantly increased flesh hardness [22]. Among the texture characteristics of flesh, hardness is especially closely related to muscle lipid content [25]. In the present study, the muscle lipid content of largemouth bass did not change significantly when the fish were fed with BSFO instead of soybean oil. Previous studies in O. mykiss, Cyprinus carpio var. Jian, and largemouth bass also found that the usage of BSFO in diets could not vary the lipid content of muscle [6,8,11].
In addition, the characteristics of fish myofibers influence the quality of the flesh, particularly the hardness, which is directly related to myofiber diameter and density [26]. Previous studies have shown that the hardness and chewiness of flesh decrease as myofiber diameter increases and myofiber density decreases [27,28]. However, in this study, the increase in muscle hardness was not attributed to alterations in myofiber diameter, as substituting soybean oil with BSFO did not yield significant changes in either the diameter or density of largemouth bass myofibers. Our results contrast with the findings of Xia et al. [11], who observed a significant increase in the diameter of Micropterus salmoides myofibers when BSFO replaced more than 50% of fish oil, whereas replacement levels equal to or below 50% elicited no change. It is possible that the difference in results is due to the difference between the fish oil and soybean oil used in the control group. Stratos et al. [29]. demonstrated that caspase-mediated apoptosis was negatively correlated with myofiber diameter. In this study, fish fed BSFO showed no significant impact on the relative expression levels of the apoptosis initiators caspase8 and caspase9 and the apoptosis effector caspase3. However, the relative expression levels of caspase8, caspase9, and caspase3 were significantly upregulated in the GML0.35 and GML0.7 groups. This suggested that lauric acid can induce apoptosis. Interestingly, despite the high lauric acid content in BSFO, its inclusion in fish diets did not exhibit these adverse effects, highlighting the potential of BSFO as a valuable feed component, even with its high concentration of lauric acid.
Furthermore, collagen content also affects the hardness of fish muscles. As a key component of the extracellular matrix, collagen is crucial for sustaining muscle growth and texture in fish [30]. Hydroxyproline, constituting 13.4% of the total amino and imine content in collagen and present in trace amounts in elastin, is absent in other proteins, making it a reliable indicator of collagen levels in muscle tissues [31]. In this study, we found that hydroxyproline content increased in the muscle of largemouth bass fed BSFO instead of soybean oil, which indicated that the increase in collagen amount is a reason for the increase in flesh hardness.
In order to explore the mechanisms behind the observed changes in the muscle texture of largemouth bass, we examined the expression levels of genes associated with muscle growth. Østbye et al. [32] found a positive correlation between muscle hardness and myogenesis in Atlantic salmon (Salmo salar). The process of fish muscle growth is regulated by a variety of factors, including myogenic regulatory factors (MRFs) and atrophy factors. MRFs are a family of basic helix–loop–helix transcription factors, including myod, myf5, mrf4, and myog, and can convert a large number of different cell types into muscle [33]. When the inhibition of myogenesis and protein degradation by atrophy factors exceed protein synthesis, muscle protein loss occurs, leading to a corresponding decrease in muscle hardness [34]. The genes mstn, fbxo32, and MuRF1 are three atrophy signs that reliably indicate muscle protein loss [35,36,37]. After an 8-week feeding trial with dietary BSFO, we assessed its impact on the relative expression levels of myod, myf5, myog, mstn, fbxo32, and MuRF1 in the muscle. Previous studies have shown that some trophic factors affected the expression levels of one or more genes in MRFs, such as dietary methionine levels for rainbow trout juveniles [38], dietary lysine and histidine levels for Oreochromis niloticus [39], and dietary plant protein levels for Solea senegalensis [40]. Sudha et al. [7] found that replacing fish oil with BSFO increased the expression levels of genes related to muscle myogenesis in Pangasianodon hypophthalmus while reducing myostatin expression levels. However, another study on replacing fish oil in largemouth bass diets with BSFO found that there were no significant differences in mRNA expression levels of myod1, murf1, myos, myog, myf5, and paxbp-1 [11]. In this study, we replaced soybean oil in largemouth bass diets with BSFO and found that the relative expression levels of genes related to muscle myogenesis and atrophy were not affected in the BSFO2 group compared with the control group. In the BSFO1 group, the expression level of myf5 decreased significantly, while the expression level of fbxo32 increased significantly, revealing the primary reason why muscle hardness in the BSFO1 group was higher than that in the control group and the BSFO2 group.
In this study, the relative expression levels of genes related to muscle myogenesis and atrophy were upregulated in the GML0.7 group compared with the control. Despite the substantial lauric acid content in BSFO, the relative expression levels of these genes in the BSFO group were significantly lower than those in the GML group. This suggests that certain components within BSFO may mitigate the adverse effects typically associated with lauric acid, highlighting the potential for BSFO to modulate muscle gene expression in a beneficial manner.
The target of rapamycin (TOR) pathway integrates signals from extracellular and intracellular agents, which can regulate protein synthesis and promote cell survival, proliferation, and growth [41]. In the TOR pathway, kinase akt activates TOR target proteins, phosphorylates kinase S6K1 and eukaryotic translation initiation factor 4E-BP1, and regulates protein synthesis to promote muscle growth [42]. As demonstrated by Goodman et al., sustained activation of Akt1 and its downstream effector S6K1 is sufficient to stimulate muscle protein synthesis and, consequently, promote skeletal muscle growth [43]. In the present study, the relative expression levels of akt1 and s6k1 were significantly upregulated, suggesting that BSFO promotes cell growth and may lead to increased hardness in muscle.

4.2. Effect of Dietary BSFO on Fatty Acid Profile of Largemouth Bass

The fatty acid profile in fish is directly affected by the fatty acid composition of the feed [44]. BSFO is predominantly composed of SFAs, the majority of which are lauric acid [45]. The results showed that as the level of BSFO supplementation in the feed increased, the content of lauric acid increased in the whole body and muscle of largemouth bass. Similar results have been reported in gilthead seabream [9]. In addition, feeding BSFO instead of soybean oil can result in an increase in C22:6n-3 (DHA) in muscle in Jian carp [8]. However, the fatty acid profile determined in rainbow trout was not consistent with these results, the usage of BSFO as a replacement for soybean oil causing no significant change in the DHA content of the muscle [6]. In the present study, replacing soybean oil with BSFO did not cause the DHA content to change in largemouth bass muscle, but significantly elevated C20:5n-3 (EPA) content in muscle, which may be attributed to the fact that lauric acid can be preferentially oxidized, allowing EPA to be better retained in muscle. The result that whole body contains more lauric acid than the muscle seems to support this idea.
In addition, the n-3/n-6 ratio is an important parameter for assessing the nutrition of flesh. Studies have shown that a high n-3/n-6 ratio is favorable for human health because n-3 PUFAs can reduce inflammatory responses, whereas n-6 PUFAs cause inflammation [46,47,48]. In the present study, n-3/n-6 levels were also significantly higher in the BSFO1 and BSFO2 groups than in the control group. This is in agreement with the results of previous studies [6,10]. Thus, the addition of BSFO to the diet increased EPA levels and n-3/n-6 ratios in largemouth bass muscle, thereby improved fatty acid quality.

4.3. Effect of Dietary BSFO on Antioxidant Capacity of Largemouth Bass

T-AOC is the total level of various antioxidant macromolecules, antioxidant small molecules, and enzymes within a system [49,50]. T-SOD is an antioxidant enzyme that protects cells from peroxidative damage [51]. In the present study, replacing soybean oil with BSFO had no significant effect on T-AOC or T-SOD activities in muscle. The results showed that inclusion of BSFO up to 2% in the diet had no significant effect on the antioxidant capacity of largemouth bass. Similar results have been reported, for instance, in juvenile yellow catfish; BSFO as a substitute for soybean oil has no significant effect on antioxidant capacity [52].
However, another study found that the addition of BSFO to largemouth bass diets resulted in an increase in T-SOD activities in the liver, suggesting that BSFO improves the antioxidant capacity of largemouth bass [11]. Because different studies have produced conflicting results [11,52], to investigate how BSFO affects the antioxidant capacity of largemouth bass, we fed largemouth bass using feed in which soybean oil was partially substituted with GML. The results showed that the total antioxidant capacity of largemouth bass was significantly reduced. However, this may not be a universal phenomenon. For example, a study in hybrid grouper fish indicated that GML increased the activity of SOD [53]. In Trachinotus ovatus, 0.15% GML significantly increased total antioxidant capacity and superoxide dismutase activities [54]. Similarly, the dietary addition of GML significantly increased SOD activity in juvenile grouper fish [55]. The different results may be due to the different effects of GML on different species of fish. In the present study, total antioxidant capacity was significantly lower in the GML groups than in the control, whereas in the BSFO groups it remained comparable to that in the control, suggesting that certain components in BSFO might mitigate the GML-induced impairment of antioxidant capacity in largemouth bass.

5. Conclusions

Our results showed that the addition of BSFO to a largemouth bass diet increased muscle hardness, enhanced flesh quality, and increased EPA levels and n-3/n-6 ratios in largemouth bass muscle and improved fatty acid quality. BSFO had no effect on antioxidant capacity. In summary, dietary inclusion of black soldier fly oil at 2% significantly improved the flesh quality of largemouth bass without measurable adverse effects, providing a solid basis for BSFO as a novel, sustainable lipid source for aquafeeds.

Author Contributions

Conceptualization, P.W.; methodology, P.W.; software, Z.W. (Zichuan Wang); formal analysis, Z.W. (Zichuan Wang), Y.C., W.Y., Z.W. (Zeting Wang) and Y.K.; investigation, W.Y., Z.W. (Zeting Wang) and Y.K.; resources, P.W.; data curation, Z.W. (Zichuan Wang), Y.C., W.Y. and P.W.; writing—original draft preparation, Z.W. (Zichuan Wang) and Y.C.; writing—review and editing, Z.W. (Zichuan Wang), Y.C. and P.W.; supervision, P.W., C.C. and Y.Y.; project administration, P.W., C.C. and Y.Y.; funding acquisition, P.W. and Y.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Natural Science Foundation of the Higher Education Institutions of Jiangsu Province (20KJA240001); the Foundation of ReProtein Biotechnology (Suzhou) Co., Ltd. (H211372); and the Priority Academic Program Development of the Jiangsu Higher Education Institutions (PAPD).

Institutional Review Board Statement

This study was conducted according to the SOPs of the Provincial Aquatic Animal Nutrition Key Laboratory of Soochow University and approved by the Animal Welfare Ethics Committee of Soochow University (Approval No. SUDA20250320A12; 20 March 2025).

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Acknowledgments

The authors thank all the students and staff who contributed to and supported the entire study.

Conflicts of Interest

The authors declare that this study received funding from the Foundation of ReProtein Biotechnology (Suzhou) Co., Ltd. (H211372). The funder was not involved in the study design; the collection, analysis, or interpretation of data; the writing of the article; or the decision to submit it for publication.

References

  1. Peng, S.M.; Chen, L.Q.; Qin, J.G.; Hou, J.L.; Yu, N.; Long, Z.Q.; Ye, J.Y.; Sun, X.J. Effects of replacement of dietary fish oil by soybean oil on growth performance and liver biochemical composition in juvenile black seabream, Acanthopagrus schlegeli. Aquaculture 2008, 276, 154–161. [Google Scholar] [CrossRef]
  2. Moon, S.J.; Lee, J.W. Current views on insect feed and its future. Entomol. Res. 2015, 45, 283–285. [Google Scholar] [CrossRef]
  3. Diener, S.; Zurbrügg, C.; Tockner, K. Conversion of organic material by black soldier fly larvae: Establishing optimal feeding rates. Waste Manag. Res. 2009, 27, 603–610. [Google Scholar] [CrossRef]
  4. Ewald, N.; Vidakovic, A.; Langeland, M.; Kiessling, A.; Sampels, S.; Lalander, C. Fatty acid composition of black soldier fly larvae (Hermetia illucens)—Possibilities and limitations for modification through diet. Waste Manag. 2020, 102, 40–47. [Google Scholar] [CrossRef]
  5. Kumar, V.; Fawole, F.J.; Romano, N.; Hossain, M.S.; Labh, S.N.; Overturf, K.; Small, B.C. Insect (black soldier fly, Hermetia illucens) meal supplementation prevents the soybean meal-induced intestinal enteritis in rainbow trout and health benefits of using insect oil. Fish Shellfish. Immunol. 2021, 109, 116–124. [Google Scholar] [CrossRef]
  6. Fawole, F.J.; Labh, S.N.; Hossain, M.S.; Overturf, K.; Small, B.C.; Welker, T.L.; Hardy, R.W.; Kumar, V. Insect (black soldier fly larvae) oil as a potential substitute for fish or soy oil in the fish meal-based diet of juvenile rainbow trout (Oncorhynchus mykiss). Anim. Nutr. 2021, 7, 1360–1370. [Google Scholar] [CrossRef] [PubMed]
  7. Sudha, C.; Ahilan, B.; Felix, N.; Uma, A.; Chidambaram, P.; Prabu, E. Replacement of fish oil with black soldier fly larvae oil and vegetable oils: Effects of growth, whole-body fatty acid profile, digestive enzyme activity, haemato-biochemical responses and muscle growth-related gene expression of juvenile striped catfish, Pangasianodon hypophthalmus. Aquac. Res. 2022, 53, 3097–3111. [Google Scholar] [CrossRef]
  8. Li, S.L.; Ji, H.; Zhang, B.X.; Tian, J.J.; Zhou, J.S.; Yu, H.B. Influence of black soldier fly (Hermetia illucens) larvae oil on growth performance, body composition, tissue fatty acid composition and lipid deposition in juvenile Jian carp (Cyprinus carpio var. Jian). Aquaculture 2016, 465, 43–52. [Google Scholar] [CrossRef]
  9. Moutinho, S.; Oliva-Teles, A.; Pulido-Rodríguez, L.; Parisi, G.; Magalhaes, R.; Monroig, O.; Peres, H. Effects of black soldier fly (Hermetia illucens) larvae oil on fillet quality and nutritional traits of gilthead seabream. Aquaculture 2024, 579, 740219. [Google Scholar] [CrossRef]
  10. Goda, A.M.A.; El-Haroun, E.; Nazmi, H.; Van Doan, H.; Aboseif, A.M.; Taha, M.K.S.; Abou Shabana, N.M. Black soldier fly oil-based diets enriched in lauric acid enhance growth, hematological indices, and fatty acid profiles of Nile tilapia, Oreochromis niloticus fry. Aquac. Rep. 2024, 37, 102269. [Google Scholar] [CrossRef]
  11. Xia, M.; Hu, Z.C.; Wang, G.; Yuan, X.T.; Ji, H.; Sun, J.; Yu, H.B. Evaluation of black soldier fly (Hermetia illucens) larvae oil as a potential lipid source for largemouth bass (Micropterus salmoides): Growth performance, myofiber development and glucolipid metabolism. Anim. Feed. Sci. Technol. 2024, 318, 116102. [Google Scholar] [CrossRef]
  12. Wang, D.; Yao, H.; Li, Y.H.; Xu, Y.J.; Ma, X.F.; Wang, H.P. Global diversity and genetic landscape of natural populations and hatchery stocks of largemouth bass Micropterus salmoides across American and Asian regions. Sci. Rep. 2019, 9, 16697. [Google Scholar] [CrossRef]
  13. FAO. The State of World Fisheries and Aquaculture 2024; FAO: Rome, Italy, 2024; Available online: https://openknowledge.fao.org/handle/20.500.14283/cd0683en (accessed on 25 September 2025).
  14. National Food Safety Standard GB5009.3–2016; Determination of Moisture in Foods. China Standard Press: Beijing, China, 2016.
  15. Feed Industry Standard GB/T6432-2018; Determination of Crude Protein in Foods-Kjeldahl Method. China Standard Press: Beijing, China, 2018.
  16. Feed Industry Standard GB/T6433-2006; Determination of Crude Fat in Foods. China Standard Press: Beijing, China, 2006.
  17. National Food Safety Standard GB5009.4-2016; Determination of Ash in Foods. China Standard Press: Beijing, China, 2016.
  18. Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
  19. Tang, Y.H.; Zhang, Z.; Weng, M.; Shen, Y.A.; Lai, W.C.; Hao, T.T.; Yao, C.W.; Bu, X.Y.; Du, J.L.; Li, Y.R.; et al. Glycerol monolaurate improved intestinal barrier, antioxidant capacity, inflammatory response and microbiota dysbiosis in large yellow croaker (Larimichthys crocea) fed with high soybean oil diets. Fish Shellfish. Immunol. 2023, 141, 109031. [Google Scholar] [CrossRef]
  20. Ye, Y.T. Technology integration and innovation to improve the edible quality of freshwater cultured fish. Feed. Ind. 2022, 43, 1–11. [Google Scholar] [CrossRef]
  21. de Huidobro, F.R.; Miguel, E.; Blázquez, B.; Onega, E. A comparison between two methods (Warner-Bratzler and texture profile analysis) for testing either raw meat or cooked meat. Meat Sci. 2005, 69, 527–536. [Google Scholar] [CrossRef] [PubMed]
  22. Yuan, H.L.; Hu, J.R.; Li, X.C.; Sun, Q.X.; Tan, X.H.; You, C.H.; Dong, Y.W.; Huang, Y.H.; Zhou, M. Dietary black soldier fly oil enhances growth performance, flesh quality, and health status of largemouth bass (Micropterus salmoides). Anim. Nutr. 2024, 18, 234–245. [Google Scholar] [CrossRef] [PubMed]
  23. Miron, L.; Montevecchi, G.; Macavei, L.I.; Maistrello, L.; Antonelli, A.; Thomas, M. Effect of black soldier fly larvae protein on the texture of meat analogues. Lwt-Food Sci. Technol. 2023, 181, 114745. [Google Scholar] [CrossRef]
  24. Chen, Y.K.; Zhong, J.; Chen, X.Q.; Li, X.M.; Pu, H.Q.; Chen, B.Y.; Guo, Y.C.; Chen, A.Q.; Li, W.J.; Hu, P.; et al. Dietary astaxanthin alleviates black soldier fly oil-induced negative changes of fatty acids content and muscle quality on (Oncorhynchus mykiss) via mammalian target of rapamycin and AMP-activated protein kinase pathway. Anim. Nutr. 2024, 19, 313–324. [Google Scholar] [CrossRef]
  25. Boleman, S.J.; Boleman, S.L.; Miller, R.K.; Taylor, J.F.; Cross, H.R.; Wheeler, T.L.; Koohmaraie, M.; Shackelford, S.D.; Miller, M.F.; West, R.L.; et al. Consumer evaluation of beef of known categories of tenderness. J. Anim. Sci. 1997, 75, 1521–1524. [Google Scholar] [CrossRef]
  26. Sampath, W.; Zhang, Y.; Liu, J.H.; Yang, M.X.; Zhang, W.B.; Mai, K.S. Dietary taurine improves muscle growth and texture characteristics in juvenile turbot (Scophthalmus maximus). Aquac. Rep. 2020, 17, 100305. [Google Scholar] [CrossRef]
  27. Hu, Z.C.; Li, H.D.; Liu, S.; Xue, R.R.; Sun, J.; Ji, H. Assessment of black soldier fly (Hermetia illucens) larvae meal as a potential substitute for soybean meal on growth performance and flesh quality of grass carp Ctenopharyngodon idellus. Anim. Nutr. 2023, 14, 425–449. [Google Scholar] [CrossRef] [PubMed]
  28. Valente, L.M.P.; Cornet, J.; Donnay-Moreno, C.; Gouygou, J.P.; Bergé, J.P.; Bacelar, M.; Escórcio, C.; Rocha, E.; Malhao, F.; Cardinal, M. Quality differences of gilthead sea bream from distinct production systems in Southern Europe: Intensive, integrated, semi-intensive or extensive systems. Food Control 2011, 22, 708–717. [Google Scholar] [CrossRef]
  29. Stratos, I.; Li, Z.D.; Rotter, R.; Herlyn, P.; Mittlmeier, T.; Vollmar, B. Inhibition of caspase mediated apoptosis restores muscle function after crush injury in rat skeletal muscle. Apoptosis 2012, 17, 269–277. [Google Scholar] [CrossRef]
  30. Lin, F.; Lin, J.L.; Liu, X.; Yuan, Y.Y.; Liu, G.Q.; Ye, X.K. Effects of temperature on muscle growth and collagen deposition in zebrafish (Danio rerio). Aquac. Rep. 2022, 22, 100952. [Google Scholar] [CrossRef]
  31. Burjanadze, T.V. Hydroxyproline Content and Location in Relation to Collagen Thermal-Stability. Biopolymers 1979, 18, 931–938. [Google Scholar] [CrossRef]
  32. Ostbye, T.K.K.; Ruyter, B.; Standal, I.B.; Stien, L.H.; Bahuaud, D.; Dessen, J.E.; Latif, M.S.; Fyhn-Terjesen, B.; Rorvik, K.A.; Morkore, T. Functional amino acids stimulate muscle development and improve fillet texture of Atlantic salmon. Aquac. Nutr. 2018, 24, 14–26. [Google Scholar] [CrossRef]
  33. Weintraub, H. The Myod Family and Myogenesis-Redundancy, Networks, and Thresholds. Cell 1993, 75, 1241–1244. [Google Scholar] [CrossRef]
  34. Kitajima, Y.; Yoshioka, K.; Suzuki, N. The ubiquitin–proteasome system in regulation of the skeletal muscle homeostasis and atrophy: From basic science to disorders. J. Physiol. Sci. 2020, 70, 40. [Google Scholar] [CrossRef]
  35. Rodriguez, J.; Vernus, B.; Chelh, I.; Cassar-Malek, I.; Gabillard, J.C.; Sassi, A.H.; Seiliez, I.; Picard, B.; Bonnieu, A. Myostatin and the skeletal muscle atrophy and hypertrophy signaling pathways. Cell. Mol. Life Sci. 2014, 71, 4361–4371. [Google Scholar] [CrossRef]
  36. Coelho, P.D.; Guarnier, F.A.; Figueiredo, L.B.; Zaramela, L.S.; Pacini, E.S.A.; Godinho, R.O.; Gomes, M.D. Identification of potential target genes associated with the reversion of androgen-dependent skeletal muscle atrophy. Arch. Biochem. Biophys. 2019, 663, 173–182. [Google Scholar] [CrossRef]
  37. Kakareka, K.; Waddell, D. Characterizing the Role of Muscle-Specific RING Finger 1 (MuRF1) as a Regulator of Atrophy-Induced Gene Expression. Faseb J. 2017, 31, 1021.4. [Google Scholar] [CrossRef]
  38. Alami-Durante, H.; Cluzeaud, M.; Bazin, D.; Schrama, J.W.; Saravanan, S.; Geurden, I. Muscle growth mechanisms in response to isoenergetic changes in dietary non-protein energy source at low and high protein levels in juvenile rainbow trout. Comp. Biochem. Physiol. A-Mol. Integr. Physiol. 2019, 230, 91–99. [Google Scholar] [CrossRef] [PubMed]
  39. Richter, B.L.; Silva, T.S.D.; Michelato, M.; Marinho, M.T.; Gonçalves, G.S.; Furuya, W.M. Combination of lysine and histidine improves growth performance, expression of muscle growth-related genes and fillet quality of grow-out Nile tilapia. Aquac. Nutr. 2021, 27, 568–580. [Google Scholar] [CrossRef]
  40. Valente, L.M.P.; Cabral, E.M.; Sousa, V.; Cunha, L.; Fernandes, J.M.O. Plant protein blends in diets for Senegalese sole affect skeletal muscle growth, flesh texture and the expression of related genes. Aquaculture 2016, 453, 77–85. [Google Scholar] [CrossRef]
  41. Thomas, G.; Hall, M.N. TOR signalling and control of cell growth. Curr. Opin. Cell Biol. 1997, 9, 782–787. [Google Scholar] [CrossRef]
  42. Lushchak, O.; Strilbytska, O.; Piskovatska, V.; Storey, K.B.; Koliada, A.; Vaiserman, A. The role of the TOR pathway in mediating the link between nutrition and longevity. Mech. Ageing Dev. 2017, 164, 127–138. [Google Scholar] [CrossRef]
  43. Goodman, C.A.; Frey, J.W.; Mabrey, D.M.; Jacobs, B.L.; Lincoln, H.C.; You, J.S.; Hornberger, T.A. The role of skeletal muscle mTOR in the regulation of mechanical load-induced growth. J. Physiol.-Lond. 2011, 589, 5485–5501. [Google Scholar] [CrossRef]
  44. Renna, M.; Schiavone, A.; Gai, F.; Dabbou, S.; Lussiana, C.; Malfatto, V.; Prearo, M.; Capucchio, M.T.; Biasato, I.; Biasibetti, E.; et al. Evaluation of the suitability of a partially defatted black soldier fly (Hermetia illucens L.) larvae meal as ingredient for rainbow trout (Oncorhynchus mykiss Walbaum) diets. J. Anim. Sci. Biotechnol. 2017, 8, 57. [Google Scholar] [CrossRef]
  45. Henry, M.; Gasco, L.; Piccolo, G.; Fountoulaki, E. Review on the use of insects in the diet of farmed fish: Past and future. Anim. Feed. Sci. Technol. 2015, 203, 1–22. [Google Scholar] [CrossRef]
  46. Fabrikov, D.; Barroso, F.G.; Sánchez-Muros, M.J.; Hidalgo, M.C.; Cardenete, G.; Tomás-Almenar, C.; Melenchón, F.; Guil-Guerrero, J.L. Effect of feeding with insect meal diet on the fatty acid compositions of sea bream (Sparus aurata), tench (Tinca tinca) and rainbow trout (Oncorhynchus mykiss) fillets. Aquaculture 2021, 545, 737170. [Google Scholar] [CrossRef]
  47. Dong, Y.Z.; Wei, Y.; Wang, L.; Song, K.; Zhang, C.X.; Lu, K.L.; Rahimnejad, S. Dietary n-3/n-6 polyunsaturated fatty acid ratio modulates growth performance in spotted seabass (Lateolabrax maculatus) through regulating lipid metabolism, hepatic antioxidant capacity and intestinal health. Anim. Nutr. 2023, 14, 20–31. [Google Scholar] [CrossRef] [PubMed]
  48. Grootendorst-van Mil, N.H.; Tiemeier, H.; Steenweg-de Graaff, J.; Koletzko, B.; Demmelmair, H.; Jaddoe, V.W.V.; Steegers, E.A.P.; Steegers-Theunissen, R.P.M. Maternal plasma n-3 and n-6 polyunsaturated fatty acids during pregnancy and features of fetal health: Fetal growth velocity, birth weight and duration of pregnancy. Clin. Nutr. 2018, 37, 1367–1374. [Google Scholar] [CrossRef] [PubMed]
  49. Gyan, W.R.; Yang, Q.H.; Tan, B.P.; Dong, X.H.; Chi, S.Y.; Liu, H.Y.; Zhang, S. Effects of replacing fishmeal with dietary dried distillers grains with solubles on growth, serum biochemical indices, antioxidative functions, and disease resistance for Litopenaeus vannamei juveniles. Aquac. Rep. 2021, 21, 100821. [Google Scholar] [CrossRef]
  50. Lin, H.X.; Yang, Q.H.; Wang, A.J.; Wang, J.X.; Tan, B.P.; Ray, G.W.; Dong, X.H.; Chi, S.Y.; Liu, H.Y.; Zhang, S. Effects of fish meal under different storage conditions on growth, serum biochemical indices and antioxidant capacity for juvenile grouper Epinephelus coioides. Aquac. Nutr. 2021, 27, 723–733. [Google Scholar] [CrossRef]
  51. Anuar, N.S.; Shafie, S.A.; Maznan, M.A.F.; Zin, N.; Azmi, N.A.S.; Raoof, R.A.; Myrzakozha, D.; Samsulrizal, N. Lauric acid improves hormonal profiles, antioxidant properties, sperm quality and histomorphometric changes in testis and epididymis of streptozotocin-induced diabetic infertility rats. Toxicol. Appl. Pharmacol. 2023, 470, 116558. [Google Scholar] [CrossRef]
  52. Hu, J.R.; Yi, J.C.; Wang, G.X.; Mo, W.Y.; Huang, Y.H. Effects of dietary soybean oil replace with black soldier fly larvae oil on growth performance, plasma biochemical indexes and liver lipid droplets of juvenile yellow catfish. Acta Hydrobiol. Sin. 2020, 44, 717–727. [Google Scholar]
  53. Li, X.H.; Yi, Y.M.; Wu, J.H.; Yang, Q.H.; Tan, B.P.; Chi, S.Y. Effects of Plant-Derived Glycerol Monolaurate (GML) Additive on the Antioxidant Capacity, Anti-Inflammatory Ability, Muscle Nutritional Value, and Intestinal Flora of Hybrid Grouper (Epinephelus fuscoguttatus♀ × Epinephelus lanceolatus♂). Metabolites 2022, 12, 1089. [Google Scholar] [CrossRef]
  54. Lin, H.X.; Tan, B.P.; Yang, Q.H.; Chi, S.Y.; Wei, H.J.; Wu, Y.C.; Ray, G.W.; Yohana, M.A. Effects of Dietary Glycerol Monolaurate on Growth, Antioxidant Capacity and Lipid Metabolism in Cage-Farmed Pompano (Trachinotus ovatus) Juveniles. Front. Mar. Sci. 2022, 9, 914134. [Google Scholar] [CrossRef]
  55. Li, X.H.; Zhu, D.W.J.; Mao, M.L.; Wu, J.W.; Yang, Q.H.; Tan, B.P.; Chi, S.Y. Glycerol Monolaurate Alleviates Oxidative Stress and Intestinal Flora Imbalance Caused by Salinity Changes for Juvenile Grouper. Metabolites 2022, 12, 1268. [Google Scholar] [CrossRef]
Fishes 10 00548 g001
Figure 1. The effect of black soldier fly oil replacing soybean oil on the histology of muscle in largemouth bass. Control, BSFO1, and BSFO2 represent diets with BSFO inclusion levels of 0%, 1%, and 2%, respectively. (A–C) Transversal section of the white muscle of fish fed different experimental diets. Hematoxylin–eosin staining. Photomicrographs: magnification 100×; scale bar: 100 μm. (D) Average diameter of myofibers. (E) the distribution of myofiber diameters.
Figure 1. The effect of black soldier fly oil replacing soybean oil on the histology of muscle in largemouth bass. Control, BSFO1, and BSFO2 represent diets with BSFO inclusion levels of 0%, 1%, and 2%, respectively. (A–C) Transversal section of the white muscle of fish fed different experimental diets. Hematoxylin–eosin staining. Photomicrographs: magnification 100×; scale bar: 100 μm. (D) Average diameter of myofibers. (E) the distribution of myofiber diameters.
Fishes 10 00548 g001
Fishes 10 00548 g002aFishes 10 00548 g002b
Figure 2. Effects of black soldier oil replacing soybean oil on the regulation of myogenesis, TOR pathway-related genes, and apoptosis-related genes of largemouth bass. Control, BSFO1, and BSFO2 represent diets with BSFO inclusion levels of 0%, 1%, and 2%, respectively. GML0.35 and GML0.7 represent diets with GML inclusion levels of 0.35% and 0.7%, respectively. (A) Myogenesis regulation-related genes. (B) TOR pathway-related genes. (C) Apoptosis-related genes.
Figure 2. Effects of black soldier oil replacing soybean oil on the regulation of myogenesis, TOR pathway-related genes, and apoptosis-related genes of largemouth bass. Control, BSFO1, and BSFO2 represent diets with BSFO inclusion levels of 0%, 1%, and 2%, respectively. GML0.35 and GML0.7 represent diets with GML inclusion levels of 0.35% and 0.7%, respectively. (A) Myogenesis regulation-related genes. (B) TOR pathway-related genes. (C) Apoptosis-related genes.
Fishes 10 00548 g002aFishes 10 00548 g002b
Table 1. Largemouth bass experimental diet composition (g/kg) and nutrient composition.
Table 1. Largemouth bass experimental diet composition (g/kg) and nutrient composition.
ItemsControlBSFO1BSFO2GML0.35GML0.7
Tapioca100100100100100
Full-fat rice bran116.5116.5116.5116.5116.5
Cotton meal8080808080
Corn gluten meal3535353535
Fish meal500500500500500
Hemoglobin powder3030303030
Chicken meal9090909090
Black soldier fly oil0102000
Soybean oil2313319.516
Glyceryl monolaurate0003.57
Ca(H2PO4)21515151515
Premix 11010101010
Ruiantai 20.50.50.50.50.5
Proximate analysis (%, DM)
Moisture10.676.565.5111.2310.09
Crude protein53.3053.4053.1253.3753.22
Crude lipids8.668.648.778.668.70
Ash13.5113.3313.4313.3913.40
1 Premix contained the following per kilogram of feed: vitamin A, 8 mg; vitamin B1, 18 mg; vitamin B2, 8 mg; vitamin B6, 12 mg, vitamin B12, 0.02 mg; vitamin C, 300 mg; vitamin D3, 3 mg; vitamin K3, 5 mg; folic acid, 5 mg; pantothenic acid, 25 mg; niacin, 25 mg; inositol, 100 mg; Mg, 96 mg; Fe, 64 mg; Zn, 19 mg; Mn, 13 mg; Cu, 2.5 mg; I, 0.021 mg; Se, 0.07 mg; Co, 0.016 mg; K, 0.05 mg. 2 Ruiantai is a natural plant-based additive.
Table 2. The sequences of gene primers used for RT-qPCR.
Table 2. The sequences of gene primers used for RT-qPCR.
GeneForward Primer (5′-3′)Reverse Primer (5′-3′)
myf5GAGGAGGACGAGCATGTCAGGAGGTGCAACGTCTCAAAGC
myodGCGACTAAGCAAGGTGAACGCTGCAGGGACTCGATGTAGC
myogGAGTTGGGGTGACAGGAACATCTGGTTTGGGTTCATCAGG
mstnTGATTGCTTTGGGTCCAGTCCCTTCATTCGCAGTTTGCTC
fbxo32GACATGGCTGCCAAGAAGAGTGAAGGCCTCTCCCAGTGTA
MuRF1TGGACGACACGTGTAAGCTGGTGGACACCTTCTGCTGCTC
caspase7CCATGGTGAAGAGGGAATGACGGACCCGAATCTGTCTGTA
caspase8GAGGGGACAAAGAGGTGGAGGAGCCTGTGGAAGTGTTTCG
caspase9TCGGGCCTTTCCATTATTTCAACAACCTGAGTGGGTGCTG
akt1AGGACGCTACTACGCCATGACCGCTCCTCTGAGAACACAC
s6k1GGCTCATCCCTTCTTTCGACGGCTTGATTCGCACTCTCAC
4ebp1GACTGCCAGAAGACCACTGCCAGCAGGAACTTTCGGTCAT
gapdhAAGGGTGGTGCCAAGAGAGTAGTCTTCTGAGTGGCGGTGA
Table 3. Effects of black soldier fly oil supplementation on body and muscle composition of largemouth bass (dry weight, %).
Table 3. Effects of black soldier fly oil supplementation on body and muscle composition of largemouth bass (dry weight, %).
ItemsControlBSFO1BSFO2
Whole fish body
Crude lipids (%)20.71 ± 0.9823.06 ± 1.6724.59 ± 1.84
Crude protein (%)61.12 ± 1.1259.96 ± 2.5258.68 ± 2.24
Ash (%)15.29 ± 0.7213.95 ± 0.4613.95 ± 0.12
Muscle
Crude lipids (%)16.51 ± 0.8317.04 ± 1.0619.80 ± 1.75
Crude protein (%)80.09 ± 0.9179.49 ± 2.7279.09 ± 1.94
Ash (%)5.87 ± 0.275.90 ± 0.126.27 ± 0.12
Control, BSFO1, and BSFO2 represent diets with BSFO inclusion levels of 0%, 1%, and 2%, respectively. All data are expressed as means ± SEMs (n = 3).
Table 4. Effect of black soldier fly oil and glyceryl monolaurate supplementation on the glycogen and hydroxyproline content of muscle in largemouth bass.
Table 4. Effect of black soldier fly oil and glyceryl monolaurate supplementation on the glycogen and hydroxyproline content of muscle in largemouth bass.
ItemsControlBSFO1BSFO2GML0.35GML0.7
Glycogen (mg/g)1.06 ± 0.081.11 ± 0.081.1 ± 0.161.09 ± 0.021.06 ± 0.04
Hydroxyproline (μg/mL)0.56 ± 0.01 b0.6 ± 0.02 b0.76 ± 0.05 a0.41 ± 0.02 c0.41 ± 0.02 c
Control, BSFO1, and BSFO2 represent diets with BSFO inclusion levels of 0%, 1%, and 2%, respectively. GML0.35 and GML0.7 represent diets with GML inclusion levels of 0.35% and 0.7%, respectively. All data are expressed as means ± SEMs (n = 3). Means in the same row with different superscripts are significantly different (p < 0.05, one-way ANOVA followed by Duncan’s multiple-range test).
Table 5. Effect of black soldier fly oil supplementation on the fatty acid composition of whole fish and muscle in largemouth bass (% of total fatty acids).
Table 5. Effect of black soldier fly oil supplementation on the fatty acid composition of whole fish and muscle in largemouth bass (% of total fatty acids).
ItemsBodyMuscle
Fatty acidControlBSFO1BSFO2ControlBSFO1BSFO2
C12:00.18 ± 0.06 c4.47 ± 0.1 b6.23 ± 0.46 a0.14 ± 0 c2.93 ± 0.22 b4.84 ± 0.33 a
C13:00.09 ± 0 a0.09 ± 0 a0.06 ± 0 b0.04 ± 0 a0.03 ± 0 b0.02 ± 0 b
C14:05.43 ± 0.11 b6.59 ± 0.14 a6.36 ± 0.19 a3.24 ± 0.01 c4.07 ± 0.08 b4.42 ± 0.18 a
C15:00.59 ± 0.02 a0.53 ± 0.03 b0.42 ± 0.03 c0.34 ± 0 a0.3 ± 0.01 b0.29 ± 0 b
C16:035.51 ± 0.75 a34 ± 0.5 ab32.64 ± 0.86 b25.71 ± 0.04 a23.72 ± 0.63 b23.62 ± 0.05 b
C17:00.59 ± 0.020.53 ± 0.050.49 ± 0.050.35 ± 0 a0.29 ± 0.01 c0.32 ± 0 b
C18:07.03 ± 0.02 a6.38 ± 0.27 b6.04 ± 0.28 b5.36 ± 0.02 a4.12 ± 0.04 b4.23 ± 0.18 b
C21:00.14 ± 0.03 a0.1 ± 0.02 ab0.07 ± 0.01 b0.48 ± 0.050.41 ± 0.040.43 ± 0.01
C23:00.43 ± 0.03 a0.3 ± 0.04 b0.24 ± 0.04 b0.4 ± 0.06 a0.1 ± 0.01 b0.11 ± 0.01 b
∑SFA50.01 ± 0.73 b53.05 ± 0.22 a52.61 ± 0.77 a36.43 ± 0.03 b36.37 ± 0.43 b38.64 ± 0.34 a
C16:1n-76.9 ± 0.126.96 ± 0.316.67 ± 0.265.37 ± 0 c5.85 ± 0.24 a5.45 ± 0.17 ab
C18:1n-933.97 ± 0.17 ab32.63 ± 1 b34.51 ± 0.72 a29.03 ± 0.1 a26.44 ± 0.92 b27.09 ± 0.2 b
C20:1n-90.39 ± 0.02 a0.31 ± 0.01 b0.25 ± 0.01 c0.28 ± 0.04 a0.19 ± 0.01 b0.18 ± 0 b
C24:1n-90.18 ± 0.030.2 ± 0.10.17 ± 0.035.45 ± 0.03 b7.67 ± 0.25 a7.88 ± 0.29 a
∑MUFA41.5 ± 0.140.19 ± 1.0341.7 ± 0.4640.3 ± 0.1440.34 ± 0.7940.8 ± 0.31
C18:2n-66.18 ± 0.72 a4.95 ± 0.82 ab4.08 ± 0.39 b18.38 ± 0.02 a16.91 ± 0.72 b14.93 ± 0.02 c
C18:3n-60.15 ± 0.020.11 ± 0.040.08 ± 0.021.33 ± 0.03 a1.45 ± 0.1 a1.16 ± 0.01 b
C20:2n-60.06 ± 0.01 a0.04 ± 0 ab0.03 ± 0 b0.04 ± 0.01 a0.04 ± 0 ab0.03 ± 0 b
C20:3n-60.04 ± 00.03 ± 0.010.02 ± 00.2 ± 0.01 b0.35 ± 0.02 a0.44 ± 0.07 a
C20:4n-60.21 ± 0.01 a0.14 ± 0.02 b0.09 ± 0.02 c0.14 ± 0.020.14 ± 0.010.14 ± 0.01
∑n-6 PUFA6.64 ± 0.755.28 ± 0.884.3 ± 0.420.1 ± 0.01 a18.89 ± 0.83 b16.7 ± 0.04 c
C18:3n-31.23 ± 0.06 a1.13 ± 0.03 ab1.06 ± 0.09 b0.97 ± 0.04 a0.78 ± 0.04 b0.91 ± 0.03 a
C20:3n-30.2 ± 0.05 a0.13 ± 0.02 b0.1 ± 0.01 b1.07 ± 0.01 b1.42 ± 0.18 a1.11 ± 0.08 b
C20:5n-3 (EPA)0.16 ± 0.03 a0.07 ± 0.03 b0.1 ± 0.02 ab1.02 ± 0.12 c2.08 ± 0.09 a1.72 ± 0.03 b
C22:6n-3 (DHA)0.26 ± 0.06 a0.14 ± 0 b0.12 ± 0.02 b0.11 ± 0.010.12 ± 0.020.12 ± 0.01
∑n-3 PUFA1.85 ± 0.09 a1.48 ± 0.01 b1.38 ± 0.12 b3.17 ± 0.09 c4.4 ± 0.28 a3.86 ± 0.02 b
∑PUFA8.48 ± 0.81 a6.76 ± 0.88 ab5.69 ± 0.34 b23.27 ± 0.11 a23.29 ± 1.11 a20.56 ± 0.04 b
∑HUFA0.82 ± 0.1 a0.51 ± 0.02 b0.43 ± 0.01 b2.54 ± 0.05 c4.11 ± 0.27 a3.54 ± 0.1 b
n-3/n-6 PUFA0.28 ± 0.020.29 ± 0.050.33 ± 0.050.16 ± 0 b0.23 ± 0 a0.23 ± 0 a
Control, BSFO1, and BSFO2 represent diets with BSFO inclusion levels of 0%, 1%, and 2%, respectively. All data are expressed as means ± SEMs (n = 3). Means in the same row with different superscripts are significantly different (p < 0.05, one-way ANOVA followed by Duncan’s multiple-range test).
Table 6. Effects of black soldier fly oil and glyceryl monolaurate supplementation on the antioxidant capacity of muscle in largemouth bass.
Table 6. Effects of black soldier fly oil and glyceryl monolaurate supplementation on the antioxidant capacity of muscle in largemouth bass.
ItemsControlBSFO1BSFO2GML0.35GML0.7
T-SOD (U/mgprot)33.97 ± 0.8933.67 ± 3.0531.43 ± 1.9433.31 ± 1.8531.34 ± 1.12
T-AOC (U/mgprot)2.63 ± 0.12 a2.7 ± 0.27 a2.95 ± 0.24 a1.76 ± 0.18 b1.94 ± 0.11 b
Control, BSFO1, and BSFO2 represent diets with BSFO inclusion levels of 0%, 1%, and 2%, respectively. GML0.35 and GML0.7 represent diets with GML inclusion levels of 0.35% and 0.7%, respectively. All data are expressed as means ± SEMs (n = 3). Means in the same row with different superscripts are significantly different (p < 0.05, one-way ANOVA followed by Duncan’s multiple-range test).
Table 7. Texture of largemouth bass muscle as a result of partially substituting soybean oil with black soldier fly oil.
Table 7. Texture of largemouth bass muscle as a result of partially substituting soybean oil with black soldier fly oil.
ItemsControlBSFO1BSFO2
Hardness, g218.88 ± 24.03 b448.18 ± 46.62 a351.87 ± 33.88 a
Elasticity, mm0.58 ± 0.01 b0.64 ± 0.01 a0.62 ± 0.01 a
Chewiness, mJ79.55 ± 11.86 b178.73 ± 18.88 a142.16 ± 17.82 a
Gumminess, g135.83 ± 18.11 b276.26 ± 27.27 a226.89 ± 24.68 a
Cohesiveness0.62 ± 0.020.67 ± 0.010.64 ± 0.03
Resilience0.47 ± 0.020.5 ± 0.010.48 ± 0.02
Control, BSFO1, and BSFO2 represent diets with BSFO inclusion levels of 0%, 1%, and 2%, respectively. All data are expressed as means ± SEMs (n = 3). Means in the same row with different superscripts are significantly different (p < 0.05, one-way ANOVA followed by Duncan’s multiple-range test).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, Z.; Cao, Y.; Yang, W.; Wang, Z.; Kuang, Y.; Wu, P.; Cai, C.; Ye, Y. Effects of Dietary Black Soldier Fly (Hermetia illucens) Oil Supplementation on Flesh Quality of Largemouth Bass (Micropterus salmoides). Fishes 2025, 10, 548. https://doi.org/10.3390/fishes10110548

AMA Style

Wang Z, Cao Y, Yang W, Wang Z, Kuang Y, Wu P, Cai C, Ye Y. Effects of Dietary Black Soldier Fly (Hermetia illucens) Oil Supplementation on Flesh Quality of Largemouth Bass (Micropterus salmoides). Fishes. 2025; 10(11):548. https://doi.org/10.3390/fishes10110548

Chicago/Turabian Style

Wang, Zichuan, Yidan Cao, Wei Yang, Zeting Wang, Yang Kuang, Ping Wu, Chunfang Cai, and Yuantu Ye. 2025. "Effects of Dietary Black Soldier Fly (Hermetia illucens) Oil Supplementation on Flesh Quality of Largemouth Bass (Micropterus salmoides)" Fishes 10, no. 11: 548. https://doi.org/10.3390/fishes10110548

APA Style

Wang, Z., Cao, Y., Yang, W., Wang, Z., Kuang, Y., Wu, P., Cai, C., & Ye, Y. (2025). Effects of Dietary Black Soldier Fly (Hermetia illucens) Oil Supplementation on Flesh Quality of Largemouth Bass (Micropterus salmoides). Fishes, 10(11), 548. https://doi.org/10.3390/fishes10110548

Article Metrics

Back to TopTop