Next Article in Journal
Full Scale Testing of a Concept for Salinity Regulation to Mitigate Sea Lice Infestation in Salmon Farming
Previous Article in Journal
Development of a Multiplex Polymerase Chain Reaction Method for the Simultaneous Identification of Four Species of Genus Lagocephalus (Chordata: Vertebrata)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fishes
Volume 10
Issue 10
10.3390/fishes10100502
fishes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Cloning and Expression Profiling of a Bax-Homologous Gene (EsBax) in the Chinese Mitten Crab (Eriocheir sinensis) Under Exogenous Stimulations

by
Mingqiao Ran
1,2,
Chao Liu
1,2,
Ying Deng
2,
Wenbin Liu
2,
Dingdong Zhang
2,
Hengtong Liu
2 and
Cheng Chi
1,2,3,*
1
Sanya Institute of Nanjing Agricultural University, Nanjing Agricultural University, Yazhou Bay Science and Technology City, Sanya 572025, China
2
Key Laboratory of Aquatic Nutrition and Feed Science of Jiangsu Province, College of Animal Science and Technology, Nanjing Agricultural University, No. 1 Weigang Road, Nanjing 210095, China
3
Heshan Xinde Biological Products Co., Ltd., Heshan 529700, China
*
Author to whom correspondence should be addressed.
Fishes 2025, 10(10), 502; https://doi.org/10.3390/fishes10100502
Submission received: 18 August 2025 / Revised: 28 September 2025 / Accepted: 30 September 2025 / Published: 7 October 2025
(This article belongs to the Special Issue Crustacean Health, Stress and Disease)
Browse Figures
Versions Notes

Abstract

EsBax (bcl-2 Associated X protein), a member of the bcl-2 family involved in the mitochondrial apoptosis pathway, plays a crucial role in immune response and defense in invertebrates. In this study, we successfully cloned the full-length cDNA of EsBax from the Chinese mitten crab (Eriocheir sinensis) and investigated its immune-related functions. The EsBax cDNA is 3374 bp in length, including a 1563 bp open reading frame (ORF) encoding 521 amino acids, a 142 bp 5′ untranslated region (UTR), and a 1699 bp 3′ UTR. The predicted EsBax protein has a molecular weight of 58.0786 kD, a theoretical isoelectric point of 7.28, and contains three conserved BH domains (BH1-BH3), and a transmembrane domain (TM). Amino acid sequence analysis revealed the highest sequence identity (99.42%) with E. sinensis. For the expression analysis, three biological replicates were performed for each tissue and treatment group. Real-time quantitative PCR showed that EsBax mRNA was ubiquitously expressed in all examined tissues, with the highest expression in the hepatopancreas, followed by hemocytes, intestine, gill, and the lowest in muscle. Upon stimulation with lipopolysaccharide (LPS), Aeromonas hydrophila (AH), or cycloheximide (CHX), EsBax expression increased and peaked at 24 h (LPS and CHX) or 48 h (A. hydrophila), then decreased. These results suggest that EsBax expression is dynamically responsive to exogenous stimulants (LPS, A. hydrophila, and CHX) in E. sinensis, implying a potential role of EsBax in the molecular events associated with pathogen-induced apoptosis in this species.
Keywords:
Eriocheir sinensis; EsBax; apoptosis; Exogenous stimulants
Key Contribution: A Bcl-2-Associated X protein gene was cloned and characterized in Eriocheir sinensis.

1. Introduction

The Chinese mitten crab (E. sinensis) is an economically significant aquaculture species in China. As the crab culture continues to expand and intensify, disease has become a major factor restricting their healthy breeding. As invertebrates, Chinese mitten crabs rely primarily on their sophisticated innate immune system, which encompasses specific recognition mechanisms, to defend against pathogens [1,2]. Apoptosis, a genetically determined process whereby cells actively die in response to changes in the internal and external environments [3], plays a crucial role in innate immunity. It helps eliminate harmful, dangerous, damaged, or unnecessary cells without triggering an inflammatory response or causing tissue damage [4].
Members of the bcl-2 family play a critical role in the apoptosis process [5]. The pro-apoptotic gene Bax (bcl-2 Associated X protein), the first gene identified to bind inhibitory bcl-2 within the bcl-2 family, mediates apoptosis by binding to the outer mitochondrial membrane. It alters mitochondrial membrane permeability by forming homodimers and heterodimers with bcl-2 [6,7]. Previous studies have demonstrated that Bax is involved in responses to viral infections [8], antiviral responses [9], pathogenic bacterial infections [10], and heat stress [11]. The research on the Bax gene in Macrobrachium nipponense under hypoxic stress [12] revealed that this stress primarily activated Bax, promoting the release of cytochrome c and triggering the caspase cascade, thereby initiating the mitochondrial apoptosis pathway in M. nipponense. Expression levels of the pro-apoptotic Bax gene have significantly increased in various tissues of aquatic animals under hypoxic conditions, including cardiomyocytes in Hypophthalmichthys molitrixi [13], Larimichthys crocea [14] and brain cells in Gymnocypris przewalskii [15]. Numerous studies indicate that the Bax gene plays a role in the molecular pathway of mitochondrial apoptosis. This gene has been cloned and its expression analyzed in various tissues of species such as grass carp [10], zebrafish [16], heterogeneous silver carp (Carassius auratus gibelio) [17], oblique grouper (Epinephelus coloides) [18], and Apostichopus japonicas [19], as well as in mice (Mus musculus) [20]. However, there has been no report on the Bax gene of the Chinese mitten crab.
To investigate the mRNA expression levels of the Bax gene in the Chinese mitten crab following infection, we selected three different apoptosis inducers: LPS (Lipopolysaccharide), A. hydrophila and CHX (Cycloheximide). LPS is commonly used in medicine to model oxidative stress and liver injury in mammals. Its mechanism involves inducing an inflammatory response that causes mitochondrial damage, thereby triggering oxidative stress and liver injury [21]. LPS has also been successfully applied in aquatic animals to develop models of oxidative stress and hepatocyte apoptosis [22,23]. A. hydrophila, which is prevalent in freshwater, sewage, and soil, exerts its pathogenicity by producing virulence factors such as exotoxins, extracellular proteases, and adhesion factors [24]. It can infect a wide range of animal groups, including fishes, crustaceans, and amphibians. CHX, widely used in agriculture, medical treatment, and molecular biology, is a protein synthesis inhibitor that can induce apoptosis in various cell types by suppressing the synthesis of short-lived anti-apoptotic proteins [25,26].
In order to study the potential role of EsBax gene in E. sinensis, we cloned and characterized a cDNA encoding EsBax gene from the Chinese mitten crab, E. sinensis (designated as EsBax) by using rapid amplification of cDNA ends (RACE) technique. We also examined the tissue-specific expression of the EsBax gene. We hypothesized that EsBax plays a pro-apoptotic role and is involved in the immune response to these apoptotic stimulators (including LPS, A. hydrophila, and CHX), which may cause significant damage to Chinese mitten crabs This study aims to lay the groundwork for further research into the gene expression patterns of EsBax and the immune mechanisms of Chinese mitten crabs to enhance their disease resistance.

2. Materials and Methods

2.1. Sample Collection

This study was carried out in accordance with the recommendations of the Animal Care and Use Committee of Nanjing Agricultural University, Nanjing, China. The protocol was approved by the Animal Research Committee of Nanjing Agricultural University (permit number: SYXK (Su) 2021-0086).
Healthy Chinese mitten crabs (15.45 ± 0.55 g) were collected from the Aquatic Research and Teaching Experimental Base in Pukou District, Nanjing City. The crabs were acclimated in the laboratory for one week. After randomly selecting 10 individuals and subjecting them to 24 h of starvation, they were anaesthetized by placement on crushed ice (0–4 °C) for 15 min. Anaesthesia was verified by the absence of appendage movement (e.g., no retraction of legs or chelipeds) when gently prodded—ensuring effective sedation to minimize pain. For tissue collection, anaesthetized crabs were further euthanized by rapid decapitation to achieve immediate loss of neural function and avoid additional stress. Tissues, including the hepatopancreas, muscles, intestines, gills, and heart, were harvested. Hemolymph was drawn from the base of the third walking leg using a sterile 1 mL syringe preloaded with 0.1 M EDTA and was immediately centrifuged at 12,000 r/min at 4 °C for 10 min. The samples were then snap-frozen in liquid nitrogen and stored at −80 °C prior to RNA extraction.

2.2. Total RNA Extraction and First-Strand cDNA Synthesis

Total RNA was extracted from E. sinensis tissues using the SteadyPure RNA Extraction Kit (Accurate Biotechnology Co., Ltd., Guangzhou, China) following the manufacturer’s instructions. Subsequently, the extracted RNA was treated with DNase I (RNase-free, Takara Bio Inc., Shiga, Japan) at 37 °C for 30 min to remove genomic DNA, followed by inactivation at 85 °C for 5 min. The RNA was then purified with RNase-Free Water. The integrity of the RNA was assessed by 1% agarose gel electrophoresis. The quality and concentration of the RNA were measured using a Biophotometer (Eppendorf, Hamburg, Germany), and 1 μg of total RNA was used for each reverse transcription reaction. A minus-reverse transcription control was included during cDNA synthesis to rule out genomic DNA contamination.

2.3. Cloning of Full-Length EsBax cDNA

To obtain the full-length cDNA of EsBax from E. sinensis, we used Primer Premier 5.0 to design three gene-specific primers for 5′ and 3′ RACE, aimed at extending its partial cDNA sequences with the PrimeScript II 1st Strand cDNA Synthesis Kit (Takara Bio Inc., Shiga, Japan). The 5′ sequence of EsBax was amplified using semi-nested PCR with the specific primers GSP and SP to confirm the cDNA sequences (Table 1). The PCR products, displaying accurate and clear bands, were sent to Sangon Biotech Co., Ltd. (Shanghai, China) for sequencing. After gel purification, the PCR products were cloned into the pMD18-T vector, transformed into competent cells, and positive clones were sequenced.

2.4. Bioinformatics Analysis of EsBax

The EsBax gene sequences were translated into amino acid sequences using the ORF Finder tool on the NCBI website to identify the open reading frame (ORF). Functional domains within the EsBax amino acid sequence were predicted and analyzed using TMpred (v.2.0, https://bio.tools/TMPred, accessed on 15 September 2025) with default parameters. The molecular masses and theoretical isoelectric points (pI) were calculated with the ExPASy Server (ProtParam tool, https://web.expasy.org/protparam/, accessed on 15 September 2025). Protein secondary structure was predicted using SOPMA (https://npsa-prabi.ibcp.fr/cgi-bin/npsa_automat.pl?page=/NPSA/npsa_sopma.html, accessed on 15 September 2025) with parameters set as: window width = 17, similarity threshold = 8, number of states = 4.
The tertiary structure of EsBax was modeled using SWISS-MODEL (Workspace, 2021 release, https://swissmodel.expasy.org/, accessed on 15 September 2025) with the Scylla paramamosain BAX protein (UniProt ID: A0A1S6K8P5.1) as the template. Sequence alignment revealed that EsBax shared 76.28% amino acid identity with the S. paramamosain BAX template, ensuring high structural conservatism. The quality of the modeled structure was evaluated by SWISS-MODEL’s Global Model Quality Estimation (GMQE), which yielded a score of 0.37. Additionally, the template was derived from AlphaFold DB, a resource with demonstrated accuracy in predicting protein conformations, further supporting the reliability of the EsBax tertiary structure model. The protein domain was predicted with SMART (v9.0, http://smart.embl-heidelberg.de/, accessed on 15 September 2025) using default parameters (E-value cutoff: 1 × 10−5). An unrooted phylogenetic tree was constructed with MEGA11.0 and assessed for reliability.
Amino acid sequences were aligned using DNAMAN6.0. For the multiple sequence alignment, the GONNET protein weight matrix was employed. To ensure the traceability and reproducibility of sequence alignment results, all Bax orthologs used for comparing with EsBax were retrieved from the NCBI database, and their detailed information is summarized in Table 2. These orthologs cover a broad range of taxa, including crustaceans (E. sinensis, S. paramamosain, Portunus trituberculatus, Penaeus vannamei, Daphnia magna), fishes (Cyprinus carpio, Danio rerio), amphibians (Xenopus laevis), and mammals (Bos taurus, Otolemur garnettii, Rattus norvegicus, M. musculus). This taxonomic diversity was selected to evaluate the evolutionary conservation of EsBax across different vertebrate and invertebrate lineages. Each ortholog can be directly accessed via its provided Protein Accession Number in the NCBI database for further verification.

2.5. Real-Time Quantitative PCR Analysis of EsBax

Total RNA was extracted from tissues and hemocytes of E. sinensis, and then reverse transcribed into cDNA using the EVO M-MLV RT Mix Kit. For each reverse transcription reaction, 1 μg of total RNA was used, and RNA concentration was measured using a Nanodrop spectrophotometer beforehand. Real-time PCR was performed on an Applied Biosystems 7500 Real-Time PCR System using SYBR Green chemistry (with 2×SYBR Green Pro Taq HS Premix (ROX plus) as the main reagent). The reaction system was as follows: 10.0 μL of 2×SYBR Green Pro Taq HS Premix (ROX plus), 2.0 μL of template (cDNA), 0.4 μL of forward primer (Primer F), 0.4 μL of reverse primer (Primer R), and 7.2 μL of RNase-free water, with a total volume of 20 μL. The cycling conditions were: an initial denaturation at 95 °C for 30 s (1 cycle); then 40 cycles of denaturation at 95 °C for 5 s and annealing/extension at 60 °C for 30 s; finally, a dissociation stage to generate a melting curve. Three technical replicates were performed for each sample. Real-time PCR data for the EsBax gene from Chinese mitten crabs were analyzed using 2−ΔΔCT method.

2.6. Immune Challenge Assays and Immune-Associated Genes Expression Analysis

A time course experiment was designed to determine the transcriptional changes in mRNA levels in response to immune challenges. Chinese mitten crabs were randomly divided into four groups, each containing three replicates. Each treatment group was injected at the base of the third walking leg with 40 μL of either LPS (0.1 mg/mL), A. hydrophila (1.4 × 106 cfu/mL), or CHX (0.5 mg/mL) [27,28,29] solution using a 1 mL disposable sterile insulin syringe. Crabs injected with an equivalent volume of phosphate-buffered saline (PBS) served as the control. A. hydrophila was provided by Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences (Wuxi, China) and activated following the methods described by Dong and Zhang [30]. During the experimental period, water temperature (28 ± 2 °C), pH (8.5–8.6), and dissolved oxygen (≥5 mg/L) were monitored daily and maintained within the specified ranges. A 10 h light/14 h dark photoperiod was applied, with routine siphoning and water renewal conducted regularly. After injection, hepatopancreas samples were collected at 0, 3, 6, 12, 24, and 48 h. For each time point, three biological replicates were set, with each replicate composed of pooled hepatopancreas tissues from 2 crabs (6 crabs total per time point). All samples were immediately frozen in liquid nitrogen and stored at −80 °C until RNA extraction. The samples underwent total RNA isolation, cDNA synthesis, and quantitative real-time PCR (qRT-PCR) analysis using primers for immune-associated genes.

2.7. Data Analysis

Data were statistically analyzed using Excel and SPSS 25.0. Normality was tested using Shapiro–Wilk test, and variance homogeneity was tested using Levene’s test. Differences in gene expression were analyzed with one-way ANOVA and Waller-Duncan’s multiple range test. For the analysis of the combined effects of two factors (time and treatment) and their interactive effect on gene expression, two-way repeated-measures ANOVA was employed. Results were presented as mean ± standard deviation (SD). Differences were considered statistically significant at p < 0.05 and extremely significant at p < 0.01. The analyzed data were graphed using GraphPad Prism 9.5.0.

3. Results

3.1. EsBax Gene Full Sequence Analysis

As shown in Figure 1, the full-length sequence of EsBax is 3374 bp and includes a 1563 bp open reading frame (ORF) that encodes a 521-amino acid protein (GenBank accession: PX406540). Additionally, it contains a 142 bp 5′ UTR and a 1699 bp 3′ UTR, along with a conserved polyadenylation signal (AATAAA). The molecular weight of the EsBax protein is calculated to be 58.0786 kD with an isoelectric point (pI) of 7.28, as determined using the ExPASy ProtParam tool. The EsBax protein was predicted to contain three conserved homologous domains (BH1, BH2, BH3) and a transmembrane domain (TM), as identified by SMART (Figure 2). The predictions of protein phosphorylation sites was shown in Supplementary Material (Figure S1).

3.2. EsBax Gene Amino Acid Sequence Alignment and Homology Analysis

NCBI BLASTP was used to compare the amino acid sequences of EsBax with those of 12 other species. The results indicated that the amino acid sequences of all species contained the conserved domains BH1 and BH3. Homology analysis revealed that the species with the highest homology to the amino acid sequence of EsBax were E. sinensis, S. paramamosain, and P. trituberculatus, with amino acid sequence identity values of 99.42% (coverage 100%), 74.38% (coverage 54%), and 62.64% (coverage 100%). In contrast, the lowest homology was observed with C. carpio, which had a value of 26.90% (Figure 3).

3.3. EsBax Gene Phylogenetic Tree Analysis

An NJ (Neighbor-Joining) phylogenetic tree was constructed using Molecular Evolutionary Genetics Analysis software (MEGA11.0, Mega Limited, Auckland, New Zealand) to include mammals, amphibians, fish, and crustaceans, as shown in Figure 4. Phylogenetic analysis revealed that the amino acid sequence of EsBax from the Chinese mitten crab first clustered closely with S. paramamosain and P. trituberculatus. These three species formed the most closely related group. Subsequently, they clustered into a larger branch with other crustaceans, including P. vannamei and D. magna. The remaining species were grouped into another major branch. The mRNA sequence accession numbers of BAX genes (and BAX inhibitor genes) used for sequence alignment in this study are as follows: S. paramamosain (KY3487421), P. trituberculatus (MK287993.1), D. magna (XM_032921506.2), P. vannamei (XM_027383277.1), Scophthalmus maximus (MN782169.1), C. carpio (KJ174685.1), Megalobrama amblycephala (MK315043.1), X. laevis (AY437085.1), Xenopus tropicalis (NM_203854.1), B. taurus (NM_173894.1), R. norvegicus (NM_017059.2), M. musculus (NM_007527.4), Canis lupus familiaris (NM_001003011.1), Felis catus (DQ926869.1), and Otolemur gametti (XM_023507893.1).

3.4. EsBax Gene Structure Prediction

The secondary and tertiary structures of the EsBax protein in E. sinensis were predicted using SOPMA and SWISS-MODEL, as shown in Figure 5 and Figure 6. The results indicated that the EsBax protein of the Chinese mitten crab primarily consists of α-helix (Hh), β-sheet (Tt), extended chain (Ee), and random coil (Cc). In terms of the secondary structure of the EsBax protein, these structures accounted for 29.81%, 9.62%, 4.62%, and 55.96%, respectively, with corresponding lengths of 155 residues, 50 residues, 24 residues, and 291 residues in E. sinensis. For the tertiary structure prediction via SWISS-MODEL, the top template used was the AlphaFold DB model of S. paramamosain Bcl-2-associated X protein (gene: BAX, organism: S. paramamosain, Mud crab). The sequence identity between EsBax and this template was 76.28%, the coverage was approximately 60%, and the GMQE (Global Model Quality Estimation) score was 0.37, indicating a reasonably reliable modeling result.

3.5. Tissue-Specific Expression of the EsBax

Quantitative PCR (qPCR) was used to determine the relative mRNA expression levels of the EsBax gene in various tissues, including the hepatopancreas, heart, muscles, intestines, hemolymph, and gills, with the results presented in Figure 7. The data indicated that the EsBax gene was expressed in all examined tissues, with the significantly highest expression in the hepatopancreas compared to all other tissues (p < 0.05). Hemocytes and intestines showed intermediate expression levels and were not statistically different from each other (p > 0.05). The gill, heart, and muscles had the lowest mRNA expression levels, with no significant differences among them (p < 0.05).

3.6. Three Different Induced Expression of EsBax Gene in Hepatopancreas

To determine if EsBax expression could be influenced by these stimuli, healthy E. sinensis were administered LPS, A. hydrophila, and CHX. The relative expression of the EsBax gene in the hepatopancreas under different treatments across various time points is presented in Figure 8. The expression levels in the CON and LPS groups remained low and stable throughout the experimental time course. The AH group exhibited a substantial increase in expression starting at 12 h, reaching its highest level at 48 h. The CHX group showed a sharp transient peak in expression at 24 h, which decreased to near-baseline levels by 48 h.
A two-way ANOVA revealed a statistically significant interaction between time and treatment on the expression of the EsBax gene (F(15, 48) = 49.31, p < 0.001, partial η2 = 0.939). The pattern of gene expression over time was not consistent across the different treatment groups, as visually evidenced by the non-parallel and converging lines in Figure 8. The expression profile of the AH and CHX treatments diverged markedly from the relatively stable profiles of the CON and LPS treatments across the time course.
Post hoc Duncan’s test revealed significant differences in gene expression among both time points and treatments (Table 3). Across the time course, expression at 48 h was significantly higher than at all earlier time points (p < 0.05). Expression at 24 h was also significantly higher than at 0, 3, 6, and 12 h. No significant difference in expression was found among 0 h, 6 h, 12 h, and 3 h. Among the treatments, the AH and CHX groups exhibited significantly higher expression levels than both the CON and LPS groups (p < 0.05). Conversely, no significant difference was found between the CON and LPS groups.

4. Discussion

The pro-apoptotic gene Bax is the first gene in the bcl-2 family identified to bind inhibitory bcl-2 [8]. Pro-apoptotic proteins such as Bax, BOK, and BAK all contain BH1 and BH2 regions that promote apoptosis by interacting with mitochondrial membranes [31]. The BH3 region is crucial as it controls the activity of pro-apoptotic proteins like Bax and BAK, and has been reported to influence apoptosis through interactions with anti-apoptotic proteins [31]. In our study, the full-length cDNA sequence of EsBax was obtained using gene cloning technology. Amino acid multi-sequence alignment revealed that EsBax possesses a conserved BH domain and shows high similarity to other invertebrates, particularly in studies of P. trituberculatus [32]. Phylogenetic analysis further indicated that EsBax clusters with other aquatic Bax proteins sharing the same conserved structural domains. Given the conserved BH domains and close phylogenetic relationship, EsBax may share similar pro-apoptotic functions with P. trituberculatus Bax, such as mediating mitochondrial membrane permeabilization [32]. Structural analysis of the amino acids showed that EsBax contains three BH domains (BH1, BH2, BH3) and a transmembrane domain (TM), with the BH3 domain featuring an α-helix structure, suggesting that it may promote apoptosis, similar to findings in mammalian Bax gene studies [33]. Although our bioinformatic analyses, including multiple sequence alignment with canonical BH3 motifs from Homo sapiens (Bax and Bak), support the prediction that the EsBax BH3 domain forms an amphipathic α-helix—a structure critical for its pro-apoptotic function—this remains a computational inference. Future studies should include experimental validation, such as circular dichroism (CD) spectroscopy, to directly confirm the secondary structure of the synthesized BH3 peptide.
The hepatopancreas is the central metabolic hub for reactive oxygen species (ROS) in crustaceans. External stimuli disrupt homeostasis and lead to the excessive accumulation of ROS, resulting in oxidative stress and ultimately apoptosis. This process is a crucial component of programmed cell death, essential for normal cell turnover in various cells and tissues [34,35,36]. It has been documented that both anti-apoptotic and pro-apoptotic members of the bcl-2 gene family are widely expressed at key immune sites in invertebrates, including peripheral blood cells and hepatopancreas [32,37,38]. In this study, we found that the EsBax gene was universally expressed across different tissues such as the heart, hepatopancreas, intestine, hemocytes, gills, and muscles, with particularly high expression in the hepatopancreas, as determined by quantitative PCR. This finding aligns with observations by Zhang et al. [32], which indicated predominant Bax expression in the hepatopancreas. Such evidence suggests that the hepatopancreas is not only a critical organ for material metabolism in crustaceans but also an important immune organ that plays a significant role in immune defense and pathogen clearance in Chinese mitten crabs [39]. It is hypothesized that EsBax may be involved in biological processes related to the stress or defense response of E. sinensis, laying a foundation for further exploring its potential role in immune-related pathways.
In our study, we utilized three different apoptosis inducers—LPS, A. hydrophila, and CHX—to explore gene expression. Lipopolysaccharides (LPS), also known as endotoxins, have been successfully applied in aquatic animals to model oxidative stress and hepatocyte apoptosis [23]. In this study, the expression level of the EsBax gene was upregulated from 6 h to 48 h post-LPS injection compared to the control group, peaking at 24 h (p < 0.05). Another study demonstrated that mitochondrial membrane potential decreased following LPS injection, and the expression of the EsBax gene in the hepatopancreas of the Chinese mitten crab was significantly increased [38]. Research on mice cardiomyocyte injury revealed that LPS could enhance the inflammatory response, increase the apoptosis rate in cardiomyocytes, and elevate Bax gene expression [40]. Similarly, Xiang et al. [41] found that endotoxin could induce apoptosis in crucian carp (C. auratus) lymphocytes, a trend consistent with the findings of this experiment. Our results, combined with previous studies [40,42], suggest that LPS may trigger apoptosis via mitochondrial pathways by upregulating EsBax.
A. hydrophila is commonly found in freshwater, sewage, and soil and exerts pathogenicity through a variety of virulence factors such as exotoxins, extracellular proteases, and adhesion factors [24]. It can infect a broad range of animal groups, including fishes, crustaceans, and amphibians. A study on carp (C. carpio) [43], revealed that A. hydrophila caused hemorrhagic sepsis, leading to an enlarged and whitish liver upon dissection. Initially, the expression of the anti-apoptotic gene bcl-2 was significantly increased compared to the control, but it decreased as the infection progressed. This suggests that apoptosis in carp was significantly inhibited during the mid-stage of infection and slightly increased during the late stages. Additionally, it was found that the mRNA expression of the Bax genes in male crabs from the 106 cfu/mL infected group was significantly up-regulated [44]. In this experiment, after inducing apoptosis with A. hydrophila, the expression level of the EsBax gene in the test subjects was up-regulated from 0 h to 48 h, peaking at 48 h (p < 0.05), similar to findings in Procambarus clarki [44,45,46]. This indicates that the EsBax gene participates in the pathogen clearance response following immune stimulation by A. hydrophila. The expression of Bax showed an upward trend, suggesting that apoptosis increases during the first 48 h; it is speculated that the expression level may decrease after this period. On one hand, the EsBax gene may be induced by A. hydrophila, which has a significant toxic effect on the hepatopancreas of the Chinese mitten crab, markedly influencing the expression of apoptosis-related genes. On the other hand, this also suggests that the organism possesses some capacity to regulate and repair damage from pathogenic bacteria. In addition, the earlier peak of EsBax under LPS (24 h) compared to A. hydrophila (48 h) may reflect the difference in stimulus dynamics: LPS acts as an immediate signaling molecule, while A. hydrophila requires time to colonize and secrete virulence factors [24]. Unlike the dynamic change in bcl-2 in carp [43], our study showed a continuous upregulation of EsBax in E. sinensis upon A. hydrophila challenge, which may reflect species-specific apoptotic responses to bacterial infection. However, the exact functions of these interactions require further verification.
Cycloheximide is widely used as a protein synthesis inhibitor in studies of metabolic regulation, including protein expression and apoptosis [47], and has applications in agriculture, medical treatment, and molecular biology. Cycloheximide can either inhibit or induce apoptosis in various cell types [46]. It has been reported that CHX induces apoptosis in rat thymus, spleen, liver, and lymph node lymphocytes [48], and CHX may inhibit the synthesis of anti-apoptotic proteins (e.g., bcl-2), which normally repress Bax activity, thereby releasing EsBax to induce apoptosis [25]. In a study involving mice treated with 2 mg/kg of cycloheximide [49], the apoptosis rate of hepatocytes peaked at 1 h post-treatment. Additionally, CHX was found to decrease bcl-2 expression while increasing Bax expression in astrocytes under ischemic conditions [26]. In the current study, the expression level of the EsBax gene in Chinese mitten crab was upregulated compared to the control group, peaking at 48 h. The expression of the EsBax gene progressively increased with the duration of treatment, indicating that cycloheximide may induce apoptosis in hepatopancreatic cells of Chinese mitten crab. Therefore, it is hypothesized that under normal conditions, apoptosis of hepatopancreatic cells in Chinese mitten crab might be inhibited by a certain factor, and cycloheximide could inhibit the synthesis of this inhibitor, thereby promptly inducing apoptosis in these cells. While our study elucidated the regulatory roles of A. hydrophila, LPS, and CHX in EsBax expression, several limitations should be acknowledged. The present study did not adhere to the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines for qPCR validation. To advance this research, future work will integrate functional assays: in vivo/in vitro knockdown/overexpression of EsBax via RNA interference or transgenic approaches, screening of Bax inhibitors to probe apoptotic cascades, and mitochondrial membrane potential assays to directly link EsBax to mitochondrial dysfunction—an aspect critical for apoptosis but understudied in crustaceans.
In conclusion, EsBax cDNA was successfully cloned from E. sinensis and was found to be expressed in all examined tissues. Expression was highest in the hepatopancreas, followed by hemocytes and intestine, with the lowest levels observed in gill, heat, and muscle. When E. sinensis was challenged with LPS, A. hydrophila, and CHX, the expression of the EsBax gene in the hepatopancreas showed a trend of increasing over time. These expression patterns imply that EsBax may be involved in the biological response of E. sinensis to external stimuli. These findings provide basic data for further exploring the potential role of EsBax in the stress/defense response of E. sinensis, as well as its possible association with apoptotic regulation.

5. Conclusions

This study successfully cloned and characterized the full-length cDNA of the apoptosis-related gene EsBax from the Chinese mitten crab. The EsBax cDNA is 3374 bp in length, containing a 1563 bp open reading frame (ORF) that encodes a 521-amino acid protein. The EsBax protein harbors conserved Bcl-2 family features: three BH domains (BH1–BH3) and a transmembrane domain. It shares the highest amino acid identity (74.38%) with S. paramamosain and clusters with crustacean Bax proteins in the phylogenetic tree, reflecting evolutionary conservation of this gene in crustaceans.
Real-time quantitative PCR analysis revealed that EsBax is ubiquitously expressed in all tested tissues (hepatopancreas, hemocytes, intestine, gill, heart, muscle), with the highest expression in the hepatopancreas, suggesting this tissue may be a key site for EsBax-mediated biological processes. Upon stimulation with A. hydrophila or CHX, EsBax expression was dynamically regulated, peaking at 48 h post-stimulation. These expression patterns indicate that EsBax may be involved in the response of E. sinensis to external stimuli, which fills gaps in research on crustacean Bax genes and provides a molecular foundation for further exploring crab innate immune- and apoptosis-related mechanisms, as well as improving aquaculture disease resistance.
However, the present study focused primarily on EsBax transcriptional regulation. While the upregulation of EsBax mRNA implies potential involvement in apoptotic processes, direct evidence is still lacking. Future studies should validate its functional role by: (1) measuring the ratio of pro- to anti-apoptotic Bcl-2 family members (e.g., Bax/Bcl-2), (2) monitoring cytochrome c release from mitochondria, (3) assessing executive caspase activation, and (4) using TUNEL assays to detect apoptotic DNA fragmentation—these approaches will help clarify the role of EsBax in maintaining apoptotic balance.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/fishes10100502/s1, Figure S1: Prediction of phosphorylation sites of EsBax gene.

Author Contributions

M.R.: Data curation, Writing—original draft, Conceptualization. C.L.: Investigation, Data curation. Y.D.: Data curation, Formal analysis. D.Z.: Funding acquisition, Resources. W.L.: Resources, Validation. H.L.: Resources, Validation. C.C.: Supervision, Program administration. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

This experiment strictly abided by the animal ethics norms and all operating procedures were approved by the Animal Experiment Ethics Committee. The study is approved by Nanjing Agricultural University (SYXK-2021-0086; 2021-12-14).

Informed Consent Statement

Not applicable.

Data Availability Statement

The gene sequence data generated and analyzed in this study have been deposited in the GenBank database under the accession number [GenBank: PX406540]. Additional datasets are available from the corresponding author upon reasonable request.

Acknowledgments

This work was supported by the Heshan Xinde Biological Products Co., Ltd.

Conflicts of Interest

The author Cheng Chi was employed by Heshan Xinde Biological Products Co., Ltd. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  1. Jearaphunt, M.; Noonin, C.; Jiravanichpaisal, P.; Nakamura, S.; Tassanakajon, A.; Söderhäll, I.; Söderhäll, K. Caspase-1-like Regulation of the proPO-System and Role of ppA and Caspase-1-like Cleaved Peptides from proPO in Innate Immunity. PLoS Pathog. 2014, 10, e1004059. [Google Scholar] [CrossRef] [PubMed]
  2. Alnemri, E.S.; Livingston, D.J.; Nicholson, D.W.; Salvesen, G.; Thornberry, N.A.; Wong, W.W.; Yuan, J.Y. Human ICE/CED-3 Protease Nomenclature. Cell 1996, 87, 171. [Google Scholar] [CrossRef] [PubMed]
  3. Bertheloot, D.; Latz, E.; Franklin, B.S. Necroptosis, Pyroptosis and Apoptosis: An Intricate Game of Cell Death. Cell. Mol. Immunol. 2021, 18, 1106–1121. [Google Scholar] [CrossRef] [PubMed]
  4. Mustafa, M.; Ahmad, R.; Tantry, I.Q.; Ahmad, W.; Siddiqui, S.; Alam, M.; Abbas, K.; Moinuddin Hassan, M.I.; Habib, S.; Islam, S. Apoptosis: A comprehensive overview of signaling pathways, morphological changes, and physiological significance and therapeutic implications. Cells 2024, 13, 1838. [Google Scholar] [CrossRef]
  5. Sung, Y.H.; Lee, G.M. Enhanced Human Thrombopoietin Production by Sodium Butyrate Addition to Serum-Free Suspension Culture of bcl-2-Overexpressing CHO Cells. Biotechnol. Prog. 2005, 21, 50–57. [Google Scholar] [CrossRef]
  6. Deyu, H.; Luqing, C.; Xianglian, L.; Pu, G.; Qirong, L.; Xu, W.; Zonghui, Y. Protective Mechanisms Involving Enhanced Mitochondrial Functions and Mitophagy Against T-2 Toxin-Induced Toxicities in GH3 Cells. Toxicol. Lett. 2018, 295, 41–53. [Google Scholar] [CrossRef]
  7. Oltvai, Z.N.; Milliman, C.L.; Korsmeyer, S.J. bcl-2 Heterodimerizes in-vivo with a Conserved Homolog, Bax, that Accelerates Programmed Cell-Death. Cell 1993, 74, 609–619. [Google Scholar] [CrossRef]
  8. Xiang, Z.M.; Qu, F.F.; Wang, F.X.; Xiao, S.; Jun, L.; Zhang, Y.; Yu, Z.N. ChBax/Bak as Key Regulators of the Mitochondrial Apoptotic Pathway: Cloned and Characterized in Crassostrea hongkongensis. Fish Shellfish. Immunol. 2015, 42, 225–232. [Google Scholar] [CrossRef]
  9. Cheng, C.H.; Yang, F.F.; Liao, S.A.; Miao, Y.T.; Ye, C.X.; Wang, A.L.; Tan, J.W.; Chen, X.Y. High Temperature Induces Apoptosis and Oxidative Stress in Pufferfish (Takifugu obscurus) Blood Cells. J. Therm. Biol. 2015, 53, 172–179. [Google Scholar] [CrossRef]
  10. Wang, H.; He, L.B.; Pei, Y.Y.; Chu, P.F.; Huang, R.; Li, Y.M.; Liao, L.J.; Zhu, Z.Y.; Wang, Y.P. Cloning and Characterization of Bax1 and Bax2 Genes of Ctenopharyngodon idellus and Evaluation of Transcript Expression in Response to Grass Carp Reovirus Infection. Fish Physiol. Biochem. 2016, 42, 1369–1382. [Google Scholar] [CrossRef]
  11. Du, Z.Q. Bax, a Novel Cell Pro-apoptotic Protein, Involved in Hemocytes Early Antiviral Immune Response in Fresh Water Crayfish, Procambarus clarkii. Fish Shellfish. Immunol. 2016, 55, 384–392. [Google Scholar] [CrossRef]
  12. Zhao, Q.Q.; Sun, X.C.; Zheng, C.; Xue, C.; Sun, S.M. Cloning of Bax Gene in Macrobrachium nipponense and Its Role in Hypoxia Stress. J. Fish. China 2024, 48, 089606. [Google Scholar]
  13. Ding, C.; Hu, L.; Li, Y.; Xue, Y.; Li, H.; Wu, R.; Liu, E.; Li, X. Effects of Hypoxia Stress on Cardiomyocyte Apoptosis and the Control for Bax, bcl-2 Expressions in Hypophthalmichthys molitrix. Freshw. Fish. 2018, 48, 10–15. [Google Scholar]
  14. Liu, Y.; Wang, J.Q.; Ding, J.; Zhang, Y.B.; Hou, C.C.; Shen, W.L.; Wu, X.F.; Zhu, J.Q. Effects of Hypoxia Stress on Oxidative Stress, Apoptosis and Microorganisms in the Intestine of Large Yellow Croaker (Larimichthys crocea). Aquaculture 2024, 581, 740444. [Google Scholar] [CrossRef]
  15. Chen, F.J.; Fu, S.Y.; Ma, M.; Chang, L.; Li, X.Y. Hypoxia Stress on the Activity of Antioxidant Enzymes, Neuronal Apoptosis and Expression of Related Genes of Telencephalon in Gymnocypris przewalskii. Acta Hydrobiol. Sin. 2023, 47, 572–580. [Google Scholar]
  16. Amores, A.; Force, A.; Yan, Y.L.; Joly, L.; Amemiya, C.; Fritz, A.; Ho, R.K.; Langeland, J.; Prince, V.; Wang, Y.L.; et al. Zebrafish hox Clusters and Vertebrate Genome Evolution. Science 1998, 282, 1711–1714. [Google Scholar] [CrossRef]
  17. Yu, L.; Chen, Q.K.; Chu, X.; Luo, Y.; Feng, Z.Z.; Lu, L.Q.; Zhang, Y.; Xu, D. Expression and Regulation of ccBax by miR-124 in the Caudal Fin Cell of C. Auratus gibelio upon Cyprinid Herpesvirus 2 Infection. J. Fish Dis. 2021, 44, 837–845. [Google Scholar] [CrossRef]
  18. Luo, S.W.; Wang, W.N.; Sun, Z.M.; Xie, F.X.; Kong, J.R.; Liu, Y.; Cheng, C.H. Molecular Cloning, Characterization and Expression Analysis of (B-cell Lymphoma-2 Associated X Protein) Bax in the Orange-spotted Grouper (Epinephelus coioides) after the Vibrio alginolyticus Challenge. Dev. Comp. Immunol. 2016, 60, 66–79. [Google Scholar] [CrossRef] [PubMed]
  19. Guo, M.; Lv, M.; Shao, Y.N.; Zhang, W.W.; Zhao, X.L.; Li, C.H. Bax Functions as Coelomocyte Apoptosis Regulator in the Sea Cucumber Apostichopus japonicus. Dev. Comp. Immunol. 2020, 102, 103490. [Google Scholar] [CrossRef]
  20. Husain, M.A.; Ishqi, H.M.; Sarwar, T.; Rehman, S.U.; Tabish, M. Identification and Expression Analysis of Alternatively Spliced New Transcript Isoform of Bax Gene in Mouse. Gene 2017, 621, 21–31. [Google Scholar] [CrossRef]
  21. Xu, Q.M.; Xu, J.; Zhang, K.F.; Zhong, M.L.; Cao, H.K.; Wei, R.M.; Jin, L.; Gao, Y. Study on the Protective Effect and Mechanism of Dicliptera chinensis (L.) Juss (Acanthaceae) Polysaccharide on Immune Liver Injury Induced by LPS. Biomed. Pharmacother. 2021, 134, 111159. [Google Scholar] [CrossRef]
  22. Liu, J.D.; Liu, W.B.; Zhang, C.Y.; Xu, C.Y.; Zheng, X.C.; Zhang, D.D.; Chi, C. Dietary Glutathione Supplementation Enhances Antioxidant Activity and Protects Against Lipopolysaccharide-Induced Acute Hepatopancreatic Injury and Cell Apoptosis in Chinese Mitten Crab, Eriocheir sinensis. Fish Shellfish. Immunol. 2020, 97, 440–454. [Google Scholar] [CrossRef]
  23. Li, M.Y.; Guo, W.Q.; Guo, G.L.; Zhu, X.M.; Niu, X.T.; Shan, X.F.; Tian, J.X.; Wang, G.Q.; Zhang, D.M. Effects of Dietary Astaxanthin on Lipopolysaccharide-Induced Oxidative Stress, Immune Responses and Glucocorticoid Receptor (GR)-Related Gene Expression in Channa argus. Aquaculture 2020, 517, 734816. [Google Scholar] [CrossRef]
  24. Ayoub, H.F.; Khafagy, A.R.; Esawy, A.M.; El-moaty, N.A.; Alwutayd, K.M.; Mansour, A.T.; Ibrahim, R.A.; Abdel-moneam, D.A.; El-Tarabili, R.M. Phenotypic, Molecular Detection, and Antibiotic Resistance Profile (MDR and XDR) of Aeromonas hydrophila Isolated from Farmed Tilapia zillii and Mugil cephalus. BMC Vet. Res. 2024, 20, 84. [Google Scholar] [CrossRef]
  25. Gunathilaka, T.L.; Kumarasinghe, H.S.; Bandaranayake, U.E.; Athapaththu, M.; Samarakoon, K.W.; Ranasinghe, P.; Peiris, L.D.C. Integration of In Vitro and In-Silico Analysis of Gracilaria edulis on Anti-Cancer Potential and Apoptotic Signaling Pathway Activity. Cell Biochem. Biophys. 2025, 83, 3017–3035. [Google Scholar] [CrossRef]
  26. Adams, K.W.; Cooper, G.M. Rapid Turnover of mcl-1 Couples Translation to Cell Survival and Apoptosis. J. Biol. Chem. 2007, 282, 6301–6309. [Google Scholar] [CrossRef] [PubMed]
  27. Yingsunthonwattana, W.; Sangsuriya, P.; Supungul, P.; Tassanakajon, A. Litopenaeus vannamei Heat Shock Protein 90 (LvHSP90) Interacts with White Spot Syndrome Virus Protein, WSSV322, to Modulate Hemocyte Apoptosis during Viral Infection. Fish Shellfish. Immunol. 2024, 151, 109695. [Google Scholar] [CrossRef] [PubMed]
  28. Collins, R.J.; Harmon, B.V.; Souvlis, T.; Pope, J.H.; Kerr, J.F.R. Effects of Cycloheximide on B-chronic Lymphocytic Leukaemic and Normal Lymphocytes In Vitro: Induction of Apoptosis. Br. J. Cancer 1991, 64, 518–522. [Google Scholar] [CrossRef]
  29. Gong, Y.; Kong, T.; Ren, X.; Chen, J.; Lin, S.; Zhang, Y.; Li, S. Exosome-Mediated Apoptosis Pathway during WSSV Infection in Crustacean Mud Crab. PLoS Pathog. 2020, 16, e1008366. [Google Scholar] [CrossRef]
  30. Dong, D.; Peng, Z. A Putative G Protein-Coupled Receptor Involved in Innate Immune Defense of Procambarus clarkii Against Bacterial Infection. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2012, 161, 95–101. [Google Scholar] [CrossRef] [PubMed]
  31. Chittenden, T. BH3 Domains: Intracellular Death-Ligands Critical for Initiating Apoptosis. Cancer Cell 2002, 2, 165–166. [Google Scholar] [CrossRef]
  32. Zhang, Y.B.; Wang, L.; Xu, Y.; Ren, X.Y.; Liu, P. Identification and Functional Characterization of Two bcl-2 Family Proteins in Swimming Crab, Portunus trituberculatus. Aquaculture 2022, 553, 738086. [Google Scholar] [CrossRef]
  33. Asciolla, J.J.; Renault, T.T.; Chipuk, J.E. Examining bcl-2 Family Function with Large Unilamellar Vesicles. J. Vis. Exp. 2012, 68, e4291. [Google Scholar]
  34. Obara, N.; Lesot, H. Subcellular Localization of β-catenin and Cadherin Expression in the Cap-Stage Enamel Organ of the Mouse Molar. Histochem. Cell Biol. 2004, 121, 351–358. [Google Scholar] [CrossRef]
  35. Duan, Y.; Xiao, M.; Wang, Y.; Huang, J.; Yang, Y.; Li, H. The High Temperature Stress Responses in the Hepatopancreas of Litopenaeus Vannamei: From Immune Dysfunction to Metabolic Remodeling Cascade. Front. Immunol. 2025, 16, 1631655. [Google Scholar] [CrossRef]
  36. Cao, L.; Shao, N.; Du, J.; Zhu, H.; Gao, J.; Li, Q.; Sun, Y.; Hu, J.; Yin, G.; Xu, G. Involvement of Reactive Oxygen Species (ROS) in the Hepatopancreatic Cytotoxicity, Oxidative Stress, and Apoptosis Induced by Microcystin-LR in Eriocheir sinensis. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2024, 276, 109801. [Google Scholar] [CrossRef] [PubMed]
  37. Gu, W.B.; Zhou, Y.L.; Tu, D.D.; Zhou, Z.K.; Zhu, Q.H.; Liu, G.X.; Shu, M.A. Identification and Characterization of Apoptosis Regulator Involved in Air-Exposure Stress of the Mud Crab, Estampador, 1949. Crustaceana 2017, 90, 1373–1390. [Google Scholar] [CrossRef]
  38. Reshi, L.; Wang, H.V.; Hui, C.F.; Su, Y.C.; Hong, J.R. Anti-apoptotic Genes bcl-2 and Bcl-xL Overexpression Can Block Iridovirus Serine/Threonine Kinase-Induced Bax/Mitochondria-Mediated Cell Death in GF-1 Cells. Fish Shellfish. Immunol. 2017, 61, 120–129. [Google Scholar] [CrossRef] [PubMed]
  39. Zheng, X.; Jiang, W.; Zhang, L.; Abasubong, K.P.; Zhang, D.; Li, X.; Jiang, G.; Chi, C.; Liu, W. Protective Effects of Dietary Icariin on Lipopolysaccharide-Induced Acute Oxidative Stress and Hepatopancreas Injury in Chinese Mitten Crab, Eriocheir sinensis. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2022, 251, 109192. [Google Scholar] [CrossRef]
  40. Yuan, Y.; Zhou, H.; Wu, Q.Q.; Li, F.F.; Bian, Z.Y.; Deng, W.; Zhou, M.Q.; Tang, Q.Z. Puerarin Attenuates the Inflammatory Response and Apoptosis in LPS-Stimulated Cardiomyocytes. Exp. Ther. Med. 2016, 11, 415–420. [Google Scholar] [CrossRef]
  41. Xiang, L.X.; Peng, B.; Dong, W.R.; Yang, Z.F.; Shao, J.Z. Lipopolysaccharide Induces Apoptosis in Carassius auratus Lymphocytes, a Possible Role in Pathogenesis of Bacterial Infection in Fish. Dev. Comp. Immunol. 2008, 32, 992–1001. [Google Scholar] [CrossRef]
  42. Roszer, T. The Invertebrate Midintestinal Gland (“Hepatopancreas”) is an Evolutionary Forerunner in the Integration of Immunity and Metabolism. Cell Tissue Res. 2014, 358, 685–695. [Google Scholar] [CrossRef]
  43. Chen, J.; Liu, N.; Zhang, H.; Zhao, Y.; Cao, X. The Effects of Aeromonas hydrophila Infection on Oxidative Stress, Nonspecific Immunity, Autophagy, and Apoptosis in the Common Carp. Dev. Comp. Immunol. 2020, 105, 103587. [Google Scholar] [CrossRef]
  44. Zhai, Y. Effects of Clostridium butyricum on Resistance of Procambarus clarkii to Aeromonas hydrophila Infection. Master’s Thesis, Huazhong Agricultural University, Wuhan, China, 2023. [Google Scholar]
  45. Da Rosa, V.M.; Ariotti, K.; Bressan, C.A.; da Silva, E.G.; Dallaporta, M.; Júnior, G.B.; da Costa, S.T.; de Vargas, A.C.; Baldisserotto, B.; Finamor, I.A.; et al. Dietary Addition of Rutin Impairs Inflammatory Response and Protects Muscle of Silver Catfish (Rhamdia quelen) from Apoptosis and Oxidative Stress in Aeromonas hydrophila-Induced Infection. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2019, 226, 108611. [Google Scholar] [CrossRef]
  46. Guo, H.; Li, Y.; Tao, P.; Yi, H.; Wang, S.; He, W.; Jiang, J.; Li, Z. Antiviral Activities of Cycloheximide and Its Derivatives. Acta Pharm. Sin. 2010, 45, 268–273. [Google Scholar]
  47. Van de Loosdrecht, A.A.; Ossenkoppele, G.J.; Beelen, R.H.; Broekhoven, M.G.; Dräger, A.M.; Langenhuijsen, M.M. Apoptosis in Tumor Necrosis Factor-alpha-Dependent, Monocyte-Mediated Leukemic Cell Death: A Functional, Morphologic, and Flow-Cytometric Analysis. Experimental Hematology. 1993, 21(13), 1628–1639. [Google Scholar] [PubMed]
  48. Ling, C.; Yu, C.; Pan, R.; Huang, X.; Zhang, D. The Effect of Ginsenosides on Apoptosis Genes in Human T-lymphocytic Leukemia Cell Lines. J. Tradit. Chin. Med. 2000, 20(3), 176–177. [Google Scholar]
  49. Li, H.; Leng, S.; Zhang, Z.; Liu, D.; Liu, S.; Deng, J. Experimental Study on Rapid Induction of Hepatocyte Apoptosis in Mouse by Cycloheximide. Hebei Med. J. 2000, 22, 87246222, (Abstract in English). [Google Scholar]
Fishes 10 00502 g001
Figure 1. Full length cDNA sequence and corresponding amino acid sequence of EsBax gene of E. sinensis. Red marks are start codons (ATG) and stop codons (TGA). The underlined sections represent the different domains.
Figure 1. Full length cDNA sequence and corresponding amino acid sequence of EsBax gene of E. sinensis. Red marks are start codons (ATG) and stop codons (TGA). The underlined sections represent the different domains.
Fishes 10 00502 g001
Fishes 10 00502 g002
Figure 2. EsBax protein domain in E. sinensis. The gray line represents the linear sequence of the EsBax protein. Pink blocks indicate specific motif—related regions. The golden block labeled "BCL" denotes the BCL-2 family—associated domain, which is involved in apoptosis regulation. The blue block represents another functional domain of the EsBax protein.
Figure 2. EsBax protein domain in E. sinensis. The gray line represents the linear sequence of the EsBax protein. Pink blocks indicate specific motif—related regions. The golden block labeled "BCL" denotes the BCL-2 family—associated domain, which is involved in apoptosis regulation. The blue block represents another functional domain of the EsBax protein.
Fishes 10 00502 g002
Fishes 10 00502 g003
Figure 3. Amino acid comparison of EsBax between E. sinensis and 12 other species. Different color markers in the Figure represent different levels of conservation of amino acid sequences, with high similarity marked in black, medium conservation in pink, and low similarity in blue. Predicted conserved domains are marked with red boxes.
Figure 3. Amino acid comparison of EsBax between E. sinensis and 12 other species. Different color markers in the Figure represent different levels of conservation of amino acid sequences, with high similarity marked in black, medium conservation in pink, and low similarity in blue. Predicted conserved domains are marked with red boxes.
Fishes 10 00502 g003
Fishes 10 00502 g004
Figure 4. EsBax phylogenetic tree of E. sinensis.
Figure 4. EsBax phylogenetic tree of E. sinensis.
Fishes 10 00502 g004
Fishes 10 00502 g005
Figure 5. Secondary structure of EsBax protein in E. sinensis. The curves represent the probability of each residue adopting a specific secondary structure: blue—α-helix, green—β-sheet, red—extended chain and purple—random coil.
Figure 5. Secondary structure of EsBax protein in E. sinensis. The curves represent the probability of each residue adopting a specific secondary structure: blue—α-helix, green—β-sheet, red—extended chain and purple—random coil.
Fishes 10 00502 g005
Fishes 10 00502 g006
Figure 6. Tertiary structure of EsBax protein in E. sinensis. The model is displayed with a continuous color gradient to indicate the residue sequence from the N-terminus to the C-terminus. The gradient transitions smoothly from blue (N-terminal) through cyan, green, yellow, and orange to red (C-terminal), reflecting the sequential order of amino acids along the polypeptide chain. The coloration illustrates the directionality of the protein backbone and does not denote secondary structure types.
Figure 6. Tertiary structure of EsBax protein in E. sinensis. The model is displayed with a continuous color gradient to indicate the residue sequence from the N-terminus to the C-terminus. The gradient transitions smoothly from blue (N-terminal) through cyan, green, yellow, and orange to red (C-terminal), reflecting the sequential order of amino acids along the polypeptide chain. The coloration illustrates the directionality of the protein backbone and does not denote secondary structure types.
Fishes 10 00502 g006
Fishes 10 00502 g007
Figure 7. Relative expression of EsBax gene in various tissues of the E. sinensis. Data are presented as mean ± SD (n = 3). Statistical analysis was performed using one-way ANOVA followed by Waller-Duncan’s multiple comparison test (F = 41.724, df-between = 5, df-within = 12, p < 0.001). Different lowercase letters above the bars indicate significant differences among groups (p < 0.05).
Figure 7. Relative expression of EsBax gene in various tissues of the E. sinensis. Data are presented as mean ± SD (n = 3). Statistical analysis was performed using one-way ANOVA followed by Waller-Duncan’s multiple comparison test (F = 41.724, df-between = 5, df-within = 12, p < 0.001). Different lowercase letters above the bars indicate significant differences among groups (p < 0.05).
Fishes 10 00502 g007
Fishes 10 00502 g008
Figure 8. Relative expression of EsBax gene in hepatopancreas at different times. Values represent means ± SD (n = 3). Bars assigned with different superscripts are significantly different.
Figure 8. Relative expression of EsBax gene in hepatopancreas at different times. Values represent means ± SD (n = 3). Bars assigned with different superscripts are significantly different.
Fishes 10 00502 g008
Table 1. Primer sequences.
Table 1. Primer sequences.
GeneSequence (5′–3′)Purpose
EsBax-FGTCAGTGAACCTCAGCTGCATqRT-PCR
EsBax-RCACAGCCACATCACCCACGAAqRT-PCR
β-actin-FCGAAACCTTCAACACTCCCGqRT-PCR
β-actin-RGGGACAGTGTGTGAAACGCCqRT-PCR
GSP1TGTCTTCCAACCTGTG5′ RACE
GSP2CCTAAGGTGCCAGAGTCC5′ RACE
GSP3CTGTGCCGAGTCATCTGC5′ RACE
SP1CGTATTGTGGCATTGTTCACCTTC3′ RACE
SP2CCAAGTAAGGATGAAGGGAGAGGA3′ RACE
Table 2. Information of Bax orthologs used for EsBax sequence alignment.
Table 2. Information of Bax orthologs used for EsBax sequence alignment.
Scientific NameCommon NameProtein Accession No.
Eriocheir sinensisChinese mitten crabWVX84560.1
Scylla paramamosainMud crabAQS99485.1
Portunus trituberculatusSwimming crabQDF82319.1
Penaeus vannameiPacific white shrimpXP_027232112.1
Daphnia magnaWater fleaXP_032777397.2
Cyprinus carpioCommon carpAHV90609.1
Danio rerioZebrafishAAF66960.1
Xenopus laevisAfrican clawed frogAAR84081.1
Bos taurusDomestic cattleNP_776319.1
Otolemur garnettiiGarnett’s bushbabyXP_023363661.1
Rattus norvegicusBrown ratAAA75200.1
Mus musculusHouse mouseNP_001398924.1
Table 3. Effects of time, treatment, and their interaction.
Table 3. Effects of time, treatment, and their interaction.
SourceType III Sum of SquaresF-Valuep-Valueη2
Time42.714107.689<0.0010.918
Treatment36.618153.864<0.0010.906
Time × Treatment58.67749.311<0.0010.939
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ran, M.; Liu, C.; Deng, Y.; Liu, W.; Zhang, D.; Liu, H.; Chi, C. Molecular Cloning and Expression Profiling of a Bax-Homologous Gene (EsBax) in the Chinese Mitten Crab (Eriocheir sinensis) Under Exogenous Stimulations. Fishes 2025, 10, 502. https://doi.org/10.3390/fishes10100502

AMA Style

Ran M, Liu C, Deng Y, Liu W, Zhang D, Liu H, Chi C. Molecular Cloning and Expression Profiling of a Bax-Homologous Gene (EsBax) in the Chinese Mitten Crab (Eriocheir sinensis) Under Exogenous Stimulations. Fishes. 2025; 10(10):502. https://doi.org/10.3390/fishes10100502

Chicago/Turabian Style

Ran, Mingqiao, Chao Liu, Ying Deng, Wenbin Liu, Dingdong Zhang, Hengtong Liu, and Cheng Chi. 2025. "Molecular Cloning and Expression Profiling of a Bax-Homologous Gene (EsBax) in the Chinese Mitten Crab (Eriocheir sinensis) Under Exogenous Stimulations" Fishes 10, no. 10: 502. https://doi.org/10.3390/fishes10100502

APA Style

Ran, M., Liu, C., Deng, Y., Liu, W., Zhang, D., Liu, H., & Chi, C. (2025). Molecular Cloning and Expression Profiling of a Bax-Homologous Gene (EsBax) in the Chinese Mitten Crab (Eriocheir sinensis) Under Exogenous Stimulations. Fishes, 10(10), 502. https://doi.org/10.3390/fishes10100502

Article Metrics

Back to TopTop