Next Article in Journal
Short- and Medium-Term Predictions of Spatiotemporal Distribution of Marine Fishing Efforts Using Deep Learning
Previous Article in Journal
Mapping for Larimichthys crocea Aquaculture Information with Multi-Source Remote Sensing Data Based on Segment Anything Model
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fishes
Volume 10
Issue 10
10.3390/fishes10100478
fishes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Validation of Using Multiplex PCR with Sex Markers SSM4 and ALLWSex2 in Long-Term Stored Blood Samples to Determine Sex of the North American Shortnose Sturgeon (Acipenser brevirostrum)

by
Hajar Sadat Tabatabaei Pozveh
1,
Salar Dorafshan
1,
Tillmann J. Benfey
2,
Jason A. Addison
2 and
Matthew K. Litvak
3,*
1
Department of Natural Resources, Isfahan University of Technology (IUT), Isfahan 84156-83111, Iran
2
Department of Biology, University of New Brunswick, P.O. Box 4400, Fredericton, NB E3B 5A3, Canada
3
Department of Biology, Mount Allison University, 53 York St, Sackville, NB E4L 1C9, Canada
*
Author to whom correspondence should be addressed.
Fishes 2025, 10(10), 478; https://doi.org/10.3390/fishes10100478
Submission received: 13 August 2025 / Revised: 5 September 2025 / Accepted: 15 September 2025 / Published: 25 September 2025
(This article belongs to the Section Genetics and Biotechnology)
Browse Figures
Versions Notes

Abstract

Sex-specific information is crucial for sturgeon culture, conservation, and fisheries management. However, identifying their sex is difficult outside the spawning season. Two recently identified female-specific loci (AllWSex2 and SSM4) are conserved across many Acipenserid species, but they have not been validated for all species within this family. This study aimed to (1) determine whether SSM4 can be used to sex shortnose sturgeon, (2) develop and test a multiplex PCR technique using both ALLWSex2 and SSM4 for sexing shortnose sturgeon, (3) determine if long-term stored blood samples can be used to sex shortnose sturgeon, and (4) test the effect of storage temperature on DNA degradation. DNA was extracted from frozen RBC samples from 36 previously sexed fish. A multiplex PCR was set up using three pairs of primers: AllWSex2 and SSM4, as female-specific loci, and mtDNA, as an internal control. AllWSex2 and SSM4 allowed for perfect discrimination of sex. While long-term storage and storage temperature did cause DNA degradation, the signal was still strong enough after 8 years of cold storage for reliable sex determination. This suggests that researchers now have the ability to re-examine archived/frozen samples to determine the sex of their sturgeon.
Keywords:
sturgeon; sex determination; multiplex PCR; female-specific loci
Key Contribution: Sexing fish, especially on previously collected samples, has numerous advantages for conservation, fisheries management, and aquaculture for conservation and production. Our study validates the use of a multiplex PCR to determine the sex of shortnose sturgeon from frozen blood samples as long as eight years after sample collection.

1. Introduction

Acipenserids, which have existed for over 250 million years [1], are among the most threatened vertebrate group listed by the International Union for Conservation of Nature [2]. All 27 living species of Acipenserids (sturgeon and paddlefish) are currently listed; of these, 17 are in decline, 4 are stable, 3 are of unknown population status and 2 are increasing [2]. Globally, sturgeons are threatened by the combined pressures of overfishing, habitat degradation, river fragmentation, and poaching [3,4]. Sturgeons are the only fish that produce caviar, one of the most highly valued animal products worldwide [3,5]. Wild sturgeons are long-lived, late to mature, and have long reproductive cycles [6,7,8,9], making it difficult to recover naturally from anthropogenic threats [9]. As global populations of wild sturgeon continue to decline, there is an urgent need to understand their population sex ratio and spawning biomass. Identification of sex in wild stocks of sturgeon also allows identification of sex-specific habitat use and migration patterns, all of which informs conservation policy [9]. Early identification of sex is also important for aquaculture as the value of caviar far exceeds that of the meat; it is more profitable to grow only females [5].
Sex determination in sturgeon is made difficult by the lack of easily identifiable external sexual characteristics in both adults and juveniles [10]. Ultrasonography, endoscopy, biopsy, urogenital opening shape, and steroid hormone analysis have all been used, with varying degrees of success for sexing sturgeons [11]. More recently, morphometrics was added as a tool to discriminate between sexes in adult shortnose sturgeon (Acipenser brevirostrum) using head shape [12] and scute structure in sterlet (A. ruthenus) [13]. Research on steroid hormones has been used to try to develop a predictable relationship between steroid hormone levels and sex in numerous species of sturgeon, including Russian sturgeon (A. gueldenstaedtii) [14], stellate sturgeon (A. stellatus) [14,15], Atlantic sturgeon (A. oxyrinchus) [16], lake sturgeon (A. fulvescens) [17], and white sturgeon (A. transmontanus) [18]. Matcshe and Gibbons [19] assessed a variety of hematological, plasma chemistry, and sex hormone approaches in a dam-impeded spawning run of shortnose sturgeon. They found a difference in levels of sex hormones among mature adults. While these approaches can help to delineate sex, except for the highly invasive and time-consuming histological approach on gonad biopsies, none is definitive, and none to date works perfectly on young sturgeon.
More recently, the discovery of genetic markers ALLWSex2 [20] and SSM4 [21] has allowed for the determination of sex with a high degree of accuracy for many species of sturgeon. AllWSex2 has been used to sex North American species, including shortnose sturgeon [22], lake sturgeon [23,24,25], gulf sturgeon (A. oxyrhinchus desotoi) [22], and Atlantic sturgeon [20,22,26]. SSM4 has been used to sex several European sturgeons and Atlantic sturgeon [21], but not shortnose sturgeon. The discovery of these two genetic markers is a great advance and of importance to both sturgeon ecology and aquaculture. The development of these two genetic markers also raises the possibility for a posteriori identification of sex from archived samples allowing examination of wild stock sex ratios, and examination of the effect of sex on movement and habitat use of tagged fish.
Both fin clips and blood samples have been used for the genetic sexing of sturgeons. Fin clips were used as the source of DNA for the ALLWSex2 studies, whereas blood samples were used for the SSM4 study. A number of the fin clip analyses using the ALLWSex2 marker yielded high concordance with known sex; however, researchers noted that their matches were not always perfect [22,23]. This could be a result of issues with the initial sex identification of the fish prior to genetic testing [22,23], potential for intersex [24] or it could be due to contamination. Collecting fin clips is standard practice in fish ecology [27], where they have been used for genetic identification of species and as a source of material for stable isotope analysis [28]. However, there are some potential issues associated with using fin clips for genetic studies. For instance, surgical tools can become contaminated if not cleaned and sterilized properly between samples. There is also potential for contamination through hands, gloves or from the water if multiple fish are held in the same tank prior to sampling. This is less of a concern with blood collection as needles and syringe barrels are clean and sterile. Syringes can be held on ice and then taken back to the lab where whole blood can be frozen or nucleated red blood cells can be obtained by centrifugation prior to freezing. Alternatively, whole blood can be dropped onto an FTA (fast technology for analysis of nucleic acids) card to stabilize DNA prior to processing [29,30].
In North America, shortnose sturgeon have been listed as endangered within the U.S. since 1967 [31] and as a Species of Special Concern in Canada since 1980 [32]. The shortnose sturgeon’s northernmost population occurs in the Wolastoq River (also known as the Saint John River, NB), its only known location in Canada. Like other sturgeons, shortnose sturgeon populations are threatened by river pollution, fragmentation due to damming, angling practices, and bycatch from other commercial and recreational fisheries [32,33,34,35,36,37]. Current assessments of population size, sex ratios, frequency of spawning, and spawning biomass are key to the effective management of this species, especially when creating policies for commercial and recreational fishing [32]. Unfortunately, there has been limited research performed to assess the total river population, reproductive spawning biomass, or sex ratios of shortnose sturgeon in the Wolastoq River since the seminal work by Dadswell [33] in 1979. Clearly, there is a need for accurate and non-invasive techniques to determine sex ratio of this population and for its development for aquaculture in North America.
The goals of this study were to (1) determine whether SSM4 can be used to determine the sex of shortnose sturgeon, (2) develop and test a multiplex PCR technique using both ALLWSex2 and SSM4 for sexing shortnose sturgeon, (3) determine if long-term storage of blood samples can be used to sex shortnose sturgeon, and (4) test the effect of storage temperature on DNA degradation.

2. Materials and Methods

2.1. Sampling and Storage

Shortnose sturgeon samples were obtained from an archive in Litvak’s lab at Mount Allison University (MTA), Sackville, NB, Canada. The males in this study were caught using short-set (<1 h) 12.7 cm stretch gill nets during their spawning run on the Wolastoq River, NB, during May in 2016 and 2022. Eight females sampled in 2016 were selected from MTA’s broodfish held at DFO’s Mactaquac Biodiversity Facility, French Village, NB. All fish were anesthetized with 150 mg/L MS222 buffered with CaCO3 prior to blood sampling, checking for milt and taking ultrasonographic images. An 18-gauge Luer lock 5–10 cc heparinized syringe was used to withdraw blood while fish were in a supine position on a v-trough table. The caudal vein was accessed by inserting the needle posterior to the anal fin at a 45° angle. Blood was withdrawn using the syringe after a flash of blood was observed in the Luer lock. Syringes were then stored on ice prior to centrifugation. Blood samples were then divided into 2 mL vials and spun in a mini centrifuge (Fisher Scientific, Waltham, MA, USA) for a minimum of 2 min at 2000 g to separate red blood cells (RBCs) from the blood plasma. The RBCs were held on ice, then either flash frozen and held in a liquid nitrogen dry shipper or in a mini-fridge freezer in the field until they were transferred to a −20 °C or −80 °C freezer in the lab. All fish were released live after sampling, following the Rapid Mortality Assessment Predictor protocol [38] that we have previously modified for sturgeon [37,39,40,41]; males were released into the Wolastoq River and females back into their tank at the Mactaquac Hatchery.

2.2. Sex Confirmation

Blood samples were taken from spermiating males during the spring spawning runs in 2016 and 2022. Litvak’s lab also has ultrasound images of all fish sampled within their tissue archive, and we selected blood samples from females in this collection that clearly showed eggs in ultrasound images (following [42]; Figure 1). The ultrasound image library was constructed from images taken with either a Sonosite MTurbo or a Sonosite EdgeII ultrasounds equipped with a HFL50 linear probe (Fujifilm Sonosite, Inc. Bothell, WA, USA) (6–15 Mhz).

2.3. DNA Yield and Purity

We used the DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany) to extract DNA from the RBC samples following the manufacturer’s protocol. The concentration of DNA was determined using a NanoVueTM UV/Visible Spectrophotometer (GE Healthcare Bio-Sciences Corp., Piscataway, NJ, USA) in accordance with the manufacturer’s instructions. Each sample was measured twice, and any inconsistent measurements were repeated a third time. The presence of DNA was verified by using a 2% agarose gel stained with Safe stain. Specifically, 5 μL of each DNA sample was mixed with 3 μL of 6× Loading Dye (New England Biolabs #B7024S, Ipswich, MA, USA) and subjected to electrophoresis. The DNA appeared as a smeared band under UV light, and its integrity was recorded.

2.4. Application of AllWSex2 and SSM4 Primers for Sex Discrimination

The PCR process was initially carried out separately using two pairs of primers, AllWSex2 and SSM4. In the subsequent step, a mitochondrial primer pair was optimized for use as an internal control. An internal positive control can be employed to detect the presence of PCR inhibitors. This is achieved through a multiplex reaction in which the target sequence is amplified with one primer set, while a control sequence (i.e., the internal positive control) is amplified with a different primer set [20,21].
Multiplex PCR was conducted to evaluate the genotypes of AllWSex2 and SSM4 according described by Kuhl et al. [20] and Ruan et al. [21], respectively. Primer pair sequences for AllW2 (F: 5′TGATCAACCTCTTCAGCAATGTC3′, R: 5′TGAGAGCCACTGTACTAACACA3′) were utilized to amplify a 100 bp fragment, while primer pair sequences for SSM4 (F: 5′TCGGTATCTTAAACTGAACCAA3′, R: 5′AGATGGAGAATTCATTGCCTA3′) were used to amplify a 400 bp fragment. A 300 bp mtDNA fragment served as an internal control (F: 5′CCCTGATCCTAATGTTTTCGGTTGG3′, R: 5′AGATCACGTAGGACTTTAATCGTT3′) [21].
The PCR reaction mixture contained 5 pM of each primer and 25 μL of Qiagen Mastermix at a final volume of 50 μL (Qiagen, Germany). PCR cycling conditions consisted of an initial denaturation step at 95 °C for 10 min, followed by 30 cycles of denaturation at 95 °C for 60 s, annealing at 56 °C for 60 s, and extension at 72 °C for 60 s, with a final extension step at 72 °C. Multilocus genotypes of the PCR products were determined by electrophoresis on a 2% agarose gel. We compared the sex identifications derived from the AllWSex2 and SSM4 loci with phenotypic characteristics for each fish, i.e., sperm release by males and eggs observed in ultrasonographic images of females.

2.5. Experimental Design

The experiment was blinded, removing any possible unconscious bias in sex assignment from gels. Archived RBC samples from Litvak’s lab at MTA were given a new unique ID number prior to shipping on dry ice to the University of New Brunswick (UNB, Fredericton, NB, Canada) for analysis. The team at UNB were not informed of the sex, storage length or type of freezer used for the blood samples they used in the genetic analysis. Thirty-two samples were analyzed: 24 males and 8 females held for either 2 or 8 years and at either −20 °C or −80 °C (Table 1). The UNB team sent the results back to MTA to determine accuracy of the procedure for sexing shortnose sturgeons.
We compared the sex assignment, DNA concentration, and A260/A280 and A260/A230 DNA ratios between the groups. The RBCs from the eight females and eight males caught in 2016 and stored at −80 °C were used to test the efficacy of the Multiplex PCR approach to determine sex of shortnose sturgeon. We also used these fish to determine the effect of sex on DNA concentration and the two DNA ratios. DNA is ideally extracted immediately after sampling or stored at sub-zero temperatures and extracted within 24 h [43]. Unfortunately, this is not always possible in the field. We therefore tested the effect of storage temperature and time on DNA degradation with this dataset.

2.6. Statistical Analysis

Data were tested for normality using the Shapiro–Wilk test and heterogeneity of variances using Bartlett’s test. Data were normal for 15 of 18 data groupings. t-Tests are robust to violations in normality [44]. t-Tests for equal variances or unequal variances (Welch’s) were used to test the differences between the response variables. All statistical analyses (stats package) and plots (ggplot2 package) were conducted using R version 4.4.1 [45].

3. Results

3.1. Simplex Primer Verification

All simplex primer analyses showed expected band patterns. ALLWSex2 primer bands with a size of ~100 bp were observed in female individuals (Figure 2A). Subsequently, the SSM4 primer results were analyzed, and female individuals with a band length of 400 bp were observed (Figure 2B). The mitochondrial primer used exhibited a band length of 300 bp was exhibited in all individuals (Figure 2C). After the simplex primer verification, all three primers were included in a single multiplex PCR reaction (Figure 2D).

3.2. Effect of Sex on DNA Concentration and Ratios

There were no effects of sex on DNA concentration (t-test df = 14, p = 0.81), A260/A280 (Welch’s t-test; df = 8.75, p = 0.95) and A260/A230 DNA (t-test; df = 14, p = 0.85) ratios for RBCs held at −80 °C since 2016 (Figure 3). Since there were no effects of sex on DNA variables, we combined DNA data from males and females held at −80 °C to examine the effect of storage time on DNA degradation.

3.3. Effect of Storage Time on DNA Concentration and Ratios

Not unexpectedly, there were significant effects of length of storage time on DNA concentration (Welch’s t-test; df = 7.13, p = 0.006), A260/A280 (Welch’s t-test; df = 16.12, p = 0.0007) and A260/A230 DNA (Welch’s t-test; df = 17.664, p < 0.0001) ratios for RBCs (Figure 4). Even though we did see significant DNA degradation over the 8 years in storage compared to samples held for 2 years, the multiplex PCR technique was still able to delineate sex perfectly.

3.4. Effect of Storage Temperature on DNA Concentration and Ratios

While we were able to successfully discriminate between sexes using RBCs stored at both −20 °C and −80 °C, there was a significant reduction in DNA concentration (Welch’s t-test; df = 7.13, p = 0.006), A260/A280 (Welch’s t-test; df = 8.58, p = 0.0003) and A260/A230 DNA (t-test; df = 7.46, p = 0.002) ratios for RBCs (Figure 5).

4. Discussion

This is the first test of Multiplex PCR used to discriminate between male and female shortnose sturgeon. Multiplex PCR allows multiple assays to be used at the same time saving costs and samples. This is particularly important when determining which sex loci can be use on a sturgeon to determine its sex. We incorporated an internal control, as did Ruan et al. [21], in our Multiplex PCR approach as a safeguard against misinterpretation of males by lack of bands appearing at SSM4 and ALLWSex2 loci.
The purpose of developing and evaluating an internal control is to monitor the entire detection process, from amplification to final interpretation. Internal controls typically involve the use of a separate PCR assay included in the same tube as the target assay [46,47]. An internal control amplifies a nucleic acid target sequence that is invariably present, such as an endogenous housekeeping gene or an exogenous target sequence added with the PCR reagents [48]. If the internal positive control is detected while the target sequence is not, this indicates that the amplification reaction was successful, suggesting that the target sequence is either absent or present at a copy number too low to be detected [49]. The internal control also serves to monitor the efficiency of each reaction, ensuring that both amplification and detection are functioning effectively, with minimal PCR inhibition that could adversely affect the final results [46,47,49].
This study was completely blinded, i.e., the genetic work was performed without knowledge of sturgeon sex, storage temperature or time spent in storage. The Multiplex was 100% successful in determining the sex of all 32 shortnose sturgeon used in this study. Our results clearly show that RBCs provide an excellent platform to sex shortnose sturgeon using DNA markers. We believe that they are a better approach than using fin-clips because they are less likely to be contaminated during sampling and digest faster for PCR analyses.
While ALLWSex2 has been used to sex shortnose sturgeon [22], we showed that SSM4 is also a sex-specific marker for shortnose sturgeon. The presence of the SSM4 marker is not surprising, as shortnose sturgeon has been identified phylogenetically as a member of the Acipenserid Atlantic clade based on both microsatellite DNA [50] and mitochondrial genomes [51]. Presence of the mtDNA marker provides a check on sample integrity as the absence of both sex markers, SSM4 (400 bp) and ALLWSex2 (100 bp), are used to identify males. In our study, mtDNA band occurred in all of our samples confirming sample integrity. The lack of the two sex loci at 100 bp and 400 bp indicates that the fish is a male.
The RBC samples used in this study were duplicates for a stable isotope study on this species conducted at Mount Allison University. These samples were stored in −20 °C and −80 °C freezers from 2 to 8 years. Clearly, storage temperature had an impact on DNA degradation. While flash freezing followed by low temperature storage (−80 °C or liquid nitrogen) are the gold standards for long-term storage of tissues for genetic analysis [52,53] samples stored at −20 °C yielded accurate delineation of sex. This suggests a high degree of sensitivity with this approach and the potential to use it with samples frozen at −20 °C. This is particularly important for fieldwork where we do not often have immediate access to liquid nitrogen Dewars or −80 °C freezers. Samples can be kept on ice and then held for at least 2 years at −20 °C until analyzed in the lab and/or moved to a −80 °C freezer.
We tested the Multiplex PCR protocol using archived samples held for over 8 years at −80 °C to see if this approach was robust in sexing fish samples stored for long periods. As expected, we did see effect of storage length on DNA degradation. However, despite the significant drop in A260/A280 and A260/A230 DNA ratios over time, the loci signals were amplified and allowed for interpretation of the DNA gels. Validation of our approach on these samples now provides confidence to determine sex for archival samples from this collection and others that have not been validated with other sexing techniques. The analysis of archived and recently collected samples will provide important data on sex ratios, spawning biomass and sex differences in distribution of shortnose sturgeon. This information is very important to assessment of population health and to determine the trajectory of shortnose sturgeon populations over time. This advance will also provide sturgeon farmers an opportunity to: (1) detect sex of their fish early in the production cycle so they can focus their efforts on growing females for caviar; and (2) allow conservation aquaculture (living gene banks) an opportunity to ensure that they use their limited space efficiently for re-stocking, augmentation/translocation efforts to rehabilitate wild stocks.

5. Conclusions

The Multiplex PCR approach incorporating both sex markers provides a double check on fish sex. It is a safer alternative, particularly on fish that have not been tested for either biomarker. That said, if the goal is to pick one sex locus and pair it with the internal control we would recommend SSM4. This is for two reasons: reduction in cost (primer, supplies and time) and the potential for primer dimers to interfere with interpretation of the ALLWSex2 locus. That said, this may be different for other sturgeons and labs. If the sturgeon species has not been sexed, we would recommend using the Multiplex approach with all three primers, before one locus can be identified as an accurate biomarker for sex.

Author Contributions

Conceptualization, H.S.T.P., S.D., T.J.B., J.A.A. and M.K.L.; Methodology, H.S.T.P., S.D., T.J.B., J.A.A. and M.K.L.; Validation, H.S.T.P., S.D., T.J.B., J.A.A. and M.K.L.; Formal analysis, H.S.T.P., S.D., T.J.B., J.A.A. and M.K.L.; Resources, H.S.T.P., S.D., T.J.B., J.A.A. and M.K.L.; Data curation, H.S.T.P., S.D., T.J.B., J.A.A. and M.K.L.; Writing—original draft, H.S.T.P., S.D., T.J.B., J.A.A. and M.K.L.; Writing—review & editing, H.S.T.P., S.D., T.J.B., J.A.A. and M.K.L.; Visualization, H.S.T.P., S.D., T.J.B., J.A.A. and M.K.L.; Supervision, S.D.; Funding acquisition, T.J.B., J.A.A. and M.K.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by grants to MKL—NSERC RGPIN-2014-04980/RGPIN-2019-07138, Canada Foundation for Innovation, New Brunswick Innovation Foundation, NB Department of Agriculture, Aquaculture and Fisheries, NB Wildlife Trust Fund, NBIF Research Assistance Initiative and Career Launchers, TB—NSERC RGPIN-2023-04628, JA—NSERC RGPIN-2019-04702.

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki and approved by the Mount Allison Animal Care Committee (AUP 101693/MTA 14-07 [1 May 2015]; AUP 102528 [5 September 2019]; AUP 103376 [11 September 2022]).

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors on request.

Acknowledgments

We would like to thank Joke Adesola, Alanna MacFarlane and their team at the DFO’s Mactaquac Biodiversity Facility for caring for MTA’s shortnose sturgeon and specifically for the females used in this study and Alex Giroux for database work conducted in MKL’s lab.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Bemis, W.E.; Findeis, E.K.; Grande, L. An Overview of Acipenseriformes. In Sturgeon Biodiversity and Conservation; Birstein, V.J., Waldman, J.R., Bemis, W.E., Eds.; Springer: Dordrecht, The Netherlands, 1997; pp. 25–71. ISBN 978-0-306-46854-4. [Google Scholar]
  2. The IUCN Red List of Threatened Species. Available online: https://www.iucnredlist.org/ja (accessed on 30 August 2024).
  3. Pikitch, E.K.; Doukakis, P.; Lauck, L.; Chakrabarty, P.; Erickson, D.L. Status, Trends and Management of Sturgeon and Paddlefish Fisheries. Fish Fish. 2005, 6, 233–265. [Google Scholar] [CrossRef]
  4. Congiu, L.; Striebel-Greiter, B.; Gessner, J.; Boscari, E.; Boner, M.; Jahrl, J.; Dalle Palle, S.; Ludwig, A. Identification and Tracking of Sturgeons and Paddlefish Products in Trade: Implications for Trade Control and Biodiversity Management. Aquaculture 2023, 574, 739708. [Google Scholar] [CrossRef]
  5. Litvak, M. The Sturgeons (Family: Acipenseridae). In Finfish Aquaculture Diversification; CABI: Wallingford, UK, 2010; pp. 178–199. [Google Scholar] [CrossRef]
  6. Billard, R.; Lecointre, G. Biology and Conservation of Sturgeon and Paddlefish. Rev. Fish Biol. Fish. 2000, 10, 355–392. [Google Scholar] [CrossRef]
  7. Pšenička, M.; Saito, T.; Linhartová, Z.; Gazo, I. Isolation and Transplantation of Sturgeon Early-Stage Germ Cells. Theriogenology 2015, 83, 1085–1092. [Google Scholar] [CrossRef]
  8. Anderson, W.G.; Schreier, A.; Crossman, J.A. Chapter 2—Conservation Aquaculture—A Sturgeon Story. In Fish Physiology; Fangue, N.A., Cooke, S.J., Farrell, A.P., Brauner, C.J., Eliason, E.J., Eds.; Conservation Physiology for the Anthropocene—Issues and Applications; Academic Press: Cambridge, MA, USA, 2022; Volume 39, pp. 39–109. [Google Scholar]
  9. Nelson, T.C.; Doukakis, P.; Lindley, S.T.; Schreier, A.D.; Hightower, J.E.; Hildebrand, L.R.; Whitlock, R.E.; Webb, M.A.H. Research Tools to Investigate Movements, Migrations, and Life History of Sturgeons (Acipenseridae), with an Emphasis on Marine-Oriented Populations. PLoS ONE 2013, 8, e71552. [Google Scholar] [CrossRef] [PubMed]
  10. Webb, M.A.H.; Doroshov, S.I. Importance of Environmental Endocrinology in Fisheries Management and Aquaculture of Sturgeons. Gen. Comp. Endocrinol. 2011, 170, 313–321. [Google Scholar] [CrossRef]
  11. Webb, M.A.H.; Van Eenennaam, J.P.; Crossman, J.A.; Chapman, F.A. A Practical Guide for Assigning Sex and Stage of Maturity in Sturgeons and Paddlefish. J. Appl. Ichthyol. 2019, 35, 169–186. [Google Scholar] [CrossRef]
  12. Balazadeh, K.; Litvak, M.K. Using Geometric Morphometrics for Sex Determination on Adult Shortnose Sturgeon (Acipenser brevirostrum). Aquaculture 2018, 487, 89–96. [Google Scholar] [CrossRef]
  13. Barulin, N.V. Using Machine Learning Algorithms to Analyse the Scute Structure and Sex Identification of Sterlet Acipenser ruthenus (Acipenseridae). Aquac. Res. 2019, 50, 2810–2825. [Google Scholar] [CrossRef]
  14. Barannikova, I.A.; Bayunova, L.V.; Semenkova, T.B. Serum Levels of Testosterone, 11-Ketotestosterone and Oestradiol-17β in Three Species of Sturgeon during Gonadal Development and Final Maturation Induced by Hormonal Treatment. J. Fish Biol. 2004, 64, 1330–1338. [Google Scholar] [CrossRef]
  15. Ceapa, C.; Williot, P.; Le Menn, F.; Davail-Cuisset, B. Plasma Sex Steroids and Vitellogenin Levels in Stellate Sturgeon (Acipenser stellatus Pallas) during Spawning Migration in the Danube River. J. Appl. Ichthyol. 2002, 18, 391–396. [Google Scholar] [CrossRef]
  16. Wheeler, C.R.; Novak, A.J.; Wippelhauser, G.S.; Sulikowski, J.A. Using Circulating Reproductive Hormones for Sex Determination of Atlantic Sturgeon (Acipenser oxyrinchus oxyrinchus) in the Saco River Estuary, Maine. Conserv. Physiol. 2016, 4, cow059. [Google Scholar] [CrossRef]
  17. Craig, J.M.; Papoulias, D.M.; Thomas, M.V.; Annis, M.L.; Boase, J. Sex Assignment of Lake Sturgeon (Acipenser fluvescens) Based on Plasma Sex Hormone and Vitellogenin Levels. J. Appl. Ichthyol. 2009, 25, 60–67. [Google Scholar] [CrossRef]
  18. Feist, G.; Van Eenennaam, J.P.; Doroshov, S.I.; Schreck, C.B.; Schneider, R.P.; Fitzpatrick, M.S. Early Identification of Sex in Cultured White Sturgeon, Acipenser transmontanus, Using Plasma Steroid Levels. Aquaculture 2004, 232, 581–590. [Google Scholar] [CrossRef]
  19. Matsche, M.A.; Gibbons, J. Annual Variation of Hematology and Plasma Chemistry in Shortnose Sturgeon, Acipenser brevirostrum, during a Dam-Impeded Spawning Run. Fish Physiol. Biochem. 2012, 38, 1679–1696. [Google Scholar] [CrossRef] [PubMed]
  20. Kuhl, H.; Guiguen, Y.; Höhne, C.; Kreuz, E.; Du, K.; Klopp, C.; Lopez-Roques, C.; Yebra-Pimentel, E.S.; Ciorpac, M.; Gessner, J.; et al. A 180 Myr-Old Female-Specific Genome Region in Sturgeon Reveals the Oldest Known Vertebrate Sex Determining System with Undifferentiated Sex Chromosomes. Philos. Trans. R. Soc. B Biol. Sci. 2021, 376, 20200089. [Google Scholar] [CrossRef] [PubMed]
  21. Ruan, R.; Feng, T.; Li, Y.; Yue, H.; Ye, H.; Du, H.; Liu, Q.; Ruan, J.; Li, C.; Wei, Q. Screening and Identification of Female-Specific DNA Sequences in Octaploid Sturgeon Using Comparative Genomics with High-Throughput Sequencing. Genomics 2021, 113, 4237–4244. [Google Scholar] [CrossRef] [PubMed]
  22. Sard, N.M.; Kreiser, B.R.; Pendleton, R.M.; Lubinski, B.A.; Johnson, R.L.; Fox, D.A.; Van Eenennaam, J.P.; Kahn, J.E.; Hager, C.; Higgs, A.L.; et al. Validation of a Molecular Sex Marker in Three Sturgeons from Eastern North America. Conserv. Genet. Resour. 2024, 16, 173–177. [Google Scholar] [CrossRef]
  23. Scribner, K.T.; Kanefsky, J. Molecular Sexing of Lake Sturgeon. J. Gt. Lakes Res. 2021, 47, 934–936. [Google Scholar] [CrossRef]
  24. Kanefsky, J.; Smith, S.; Scribner, K.T. Real-Time PCR-Based Method for Sex Determination in Lake Sturgeon (Acipenser fulvescens). Diversity 2022, 14, 839. [Google Scholar] [CrossRef]
  25. Sanfilippo, G.E.; Riedy, J.J.; Larson, D.L.; Scribner, K.T. Multi-Year Evidence of Unbiased Sex Ratios in Hatchery and Wild-Reared Age-0 Lake Sturgeon (Acipenser fulvescens). J. Gt. Lakes Res. 2022, 48, 1306–1313. [Google Scholar] [CrossRef]
  26. Daigle, N.J.; White, S.; Lubinski, B.A.; Johnson, R.; Kazyak, D.C.; Verhille, C.E.; Gillis, C.A.; Sacobie, C.F.D. Stock Composition of Cryptic Atlantic Sturgeon (Acipenser oxyrinchus oxyrinchus) in the Restigouche River and Estuary, Canada. Sci. Rep. 2025, 15, 20654. [Google Scholar] [CrossRef] [PubMed]
  27. Allen, P.J.; Baumgartner, W.; Brinkman, E.; DeVries, R.J.; Stewart, H.A.; Aboagye, D.L.; Ramee, S.W.; Ciaramella, M.A.; Culpepper, C.M., III; Petrie-Hanson, L. Fin Healing and Regeneration in Sturgeon. J. Fish Biol. 2018, 93, 917–930. [Google Scholar] [CrossRef]
  28. Smith, A.; Marty, J.; Power, M. Non-Lethal Sampling of Lake Sturgeon for Stable Isotope Analysis: Comparing Pectoral Fin-Clip and Dorsal Muscle for Use in Trophic Studies. J. Gt. Lakes Res. 2015, 41, 292–297. [Google Scholar] [CrossRef]
  29. Smith, L.; Burgoyne, L. Collecting, Archiving and Processing DNA from Wildlife Samples Using FTA® Databasing Paper. BMC Ecol. 2004, 4, 4. [Google Scholar] [CrossRef]
  30. Gui, L.; Li, X.; Lin, S.; Zhao, Y.; Lin, P.; Wang, B.; Tang, R.; Guo, J.; Zu, Y.; Zhou, Y.; et al. Low-Cost and Rapid Method of DNA Extraction from Scaled Fish Blood and Skin Mucus. Viruses 2022, 14, 840. [Google Scholar] [CrossRef]
  31. National Marine Fisheries Service. Recovery Plan for the Shortnose Sturgeon (Acipenser brevirostrum); Prepared by the Shortnose Sturgeon Recovery Team for the National Marine Fisheries Service: Silver Spring, MD, USA, 1998; p. 104. [Google Scholar]
  32. COSEWIC Shortnose Sturgeon (Acipenser brevirostrum): COSEWIC Assessment and Status Report 2015. Available online: https://www.canada.ca/en/environment-climate-change/services/species-risk-public-registry/cosewic-assessments-status-reports/shortnose-sturgeon-2015.html (accessed on 30 August 2024).
  33. Dadswell, M.J. Biology and Population Characteristics of the Shortnose Sturgeon, Acipenser brevirostrum LeSueur 1818 (Osteichthyes: Acipenseridae), in the Saint John River Estuary, New Brunswick, Canada. Can. J. Zool. 1979, 57, 2186–2210. [Google Scholar] [CrossRef]
  34. Kynard, B.; Bolden, S.; Kieffer, M.; Collins, M.; Brundage, H.; Hilton, E.J.; Litvak, M.; Kinnison, M.T.; King, T.; Peterson, D. Life History and Status of Shortnose Sturgeon (Acipenser brevirostrum LeSueur, 1818). J. Appl. Ichthyol. 2016, 32, 208–248. [Google Scholar] [CrossRef]
  35. Bahn, R.A.; Fleming, J.E.; Peterson, D.L. Bycatch of Shortnose Sturgeon in the Commercial American Shad Fishery of the Altamaha River, Georgia. N. Am. J. Fish. Manag. 2012, 32, 557–562. [Google Scholar] [CrossRef]
  36. Chambers, R.C.; Davis, D.D.; Habeck, E.A.; Roy, N.K.; Wirgin, I. Toxic Effects of PCB126 and TCDD on Shortnose Sturgeon and Atlantic Sturgeon. Environ. Toxicol. Chem. 2012, 31, 2324–2337. [Google Scholar] [CrossRef] [PubMed]
  37. Struthers, D.P.; Bower, S.D.; Lennox, R.J.; Gilroy, C.E.; MacDonald, E.C.; Cooke, S.J.; Litvak, M.K. Short-Term Physiological Disruption and Reflex Impairment in Shortnose Sturgeon Exposed to Catch-and-Release Angling. N. Am. J. Fish Manag. 2018, 38, 1075–1084. [Google Scholar] [CrossRef]
  38. Davis, M.W. Fish Stress and Mortality Can Be Predicted Using Reflex Impairment. Fish Fish. 2010, 11, 1–11. [Google Scholar] [CrossRef]
  39. McLean, M.F.; Hanson, K.C.; Cooke, S.J.; Hinch, S.G.; Patterson, D.A.; Nettles, T.L.; Litvak, M.K.; Crossin, G.T. Physiological Stress Response, Reflex Impairment and Delayed Mortality of White Sturgeon Acipenser transmontanus Exposed to Simulated Fisheries Stressors. Conserv. Physiol. 2016, 4, cow031. [Google Scholar] [CrossRef]
  40. McLean, M.F.; Litvak, M.K.; Cooke, S.J.; Hanson, K.C.; Patterson, D.A.; Hinch, S.G.; Crossin, G.T. Immediate Physiological and Behavioural Response from Catch-and-Release of Wild White Sturgeon (Acipenser transmontanus Richardson, 1836). Fish. Res. 2019, 214, 65–75. [Google Scholar] [CrossRef]
  41. McLean, M.F.; Litvak, M.K.; Stoddard, E.M.; Cooke, S.J.; Patterson, D.A.; Hinch, S.G.; Welch, D.W.; Crossin, G.T. Linking Environmental Factors with Reflex Action Mortality Predictors, Physiological Stress, and Post-Release Movement Behaviour to Evaluate the Response of White Sturgeon (Acipenser transmontanus Richardson, 1836) to Catch-and-Release Angling. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2020, 240, 110618. [Google Scholar] [CrossRef]
  42. Balazadeh, K.; Litvak, M.K. Exploring Fractal Dimensions on Ultrasound of Gonadal Images for Sex Determination in Shortnose Sturgeon (Acipenser brevirostrum). bioRxiv 2024. bioRxiv:2024.10.31.621316. [Google Scholar] [CrossRef]
  43. Oosting, T.; Hilario, E.; Wellenreuther, M.; Ritchie, P.A. DNA Degradation in Fish: Practical Solutions and Guidelines to Improve DNA Preservation for Genomic Research. Ecol. Evol. 2020, 10, 8643. [Google Scholar] [CrossRef]
  44. Zar, J.H. Biostatistical Analysis, 5th ed.; Prentice Hall/Pearson: Upper Saddle River, NJ, USA, 1999; p. 07458. [Google Scholar]
  45. R Core Team. _R: A Language and Environment for Statistical Computing_2024; R Foundation for Statistical Computing: Vienna, Austria, 2024; Available online: https://www.R-project.org/ (accessed on 14 September 2025).
  46. Hoorfar, J.; Cook, N.; Malorny, B.; Wagner, M.; De Medici, D.; Abdulmawjood, A.; Fach, P. Diagnostic PCR: Making Internal Amplification Control Mandatory. Lett. Appl. Microbiol. 2004, 38, 79–80. [Google Scholar]
  47. Hoorfar, J.; Wolffs, P.; Rådström, P. Diagnostic PCR: Validation and Sample Preparation Are Two Sides of the Same Coin. APMIS 2004, 112, 808–814. [Google Scholar] [CrossRef]
  48. Espy, M.J.; Uhl, J.R.; Sloan, L.M.; Buckwalter, S.P.; Jones, M.F.; Vetter, E.A.; Yao, J.D.C.; Wengenack, N.L.; Rosenblatt, J.E.; Cockerill, F.R.; et al. Real-Time PCR in Clinical Microbiology: Applications for Routine Laboratory Testing. Clin. Microbiol. Rev. 2006, 19, 165–256. [Google Scholar] [CrossRef]
  49. Rosenstraus, M.; Wang, Z.; Chang, S.-Y.; DeBonville, D.; Spadoro, J.P. An Internal Control for Routine Diagnostic PCR: Design, Properties, and Effect on Clinical Performance. J. Clin. Microbiol. 1998, 36, 191–197. [Google Scholar] [CrossRef] [PubMed]
  50. Robles, F.; de la Herrán, R.; Ludwig, A.; Ruiz Rejón, C.; Ruiz Rejón, M.; Garrido-Ramos, M.A. Evolution of Ancient Satellite DNAs in Sturgeon Genomes. Gene 2004, 338, 133–142. [Google Scholar] [CrossRef] [PubMed]
  51. Shen, Y.; Yang, N.; Liu, Z.; Chen, Q.; Li, Y. Phylogenetic Perspective on the Relationships and Evolutionary History of the Acipenseriformes. Genomics 2020, 112, 3511–3517. [Google Scholar] [CrossRef]
  52. Blom, M.P.K. Opportunities and Challenges for High-Quality Biodiversity Tissue Archives in the Age of Long-Read Sequencing. Mol. Ecol. 2021, 30, 5935–5948. [Google Scholar] [CrossRef]
  53. Dahn, H.A.; Mountcastle, J.; Balacco, J.; Winkler, S.; Bista, I.; Schmitt, A.D.; Pettersson, O.V.; Formenti, G.; Oliver, K.; Smith, M.; et al. Benchmarking Ultra-High Molecular Weight DNA Preservation Methods for Long-Read and Long-Range Sequencing. GigaScience 2022, 11, giac068. [Google Scholar] [CrossRef] [PubMed]
Fishes 10 00478 g001
Figure 1. Ultrasound lateral views of ovaries were conducted to confirm the sex of fish. (A) Lateral transverse image of an ovary. (B) Lateral frontal image of an ovary. Dermis, myospeta and myomeres are identified to provide anatomical reference for the reader. Eggs are seen as small circles/balls within the ovaries. Images were taken with a Sonosite Edge II Ultrasound using a high frequency linear probe (HFL50).
Figure 1. Ultrasound lateral views of ovaries were conducted to confirm the sex of fish. (A) Lateral transverse image of an ovary. (B) Lateral frontal image of an ovary. Dermis, myospeta and myomeres are identified to provide anatomical reference for the reader. Eggs are seen as small circles/balls within the ovaries. Images were taken with a Sonosite Edge II Ultrasound using a high frequency linear probe (HFL50).
Fishes 10 00478 g001
Fishes 10 00478 g002
Figure 2. Female-specific markers in shortnose sturgeon using simplex (A–C) and multiplex PCR (D). (A) Validation of AllWsex2 (100 bp); it was only amplified in females. (B) SSM4 (400 bp); it was only amplified in females. (C) The internal control (mtDNA; 300bp) was amplified in both males and females. (D) Validation of female-specific markers and mtDNA in shortnose sturgeon using multiplex PCR. Ladders are in 100 bp increments.
Figure 2. Female-specific markers in shortnose sturgeon using simplex (A–C) and multiplex PCR (D). (A) Validation of AllWsex2 (100 bp); it was only amplified in females. (B) SSM4 (400 bp); it was only amplified in females. (C) The internal control (mtDNA; 300bp) was amplified in both males and females. (D) Validation of female-specific markers and mtDNA in shortnose sturgeon using multiplex PCR. Ladders are in 100 bp increments.
Fishes 10 00478 g002
Fishes 10 00478 g003
Figure 3. Boxplot jitter plots showing the effect of sex on DNA concentration ng/µL (A), A260/A280 DNA ratio (B), and A260/A230 DNA ratio (C) in shortnose sturgeon red blood cell samples stored at −80 °C for 8 years (n = 8 for each sex). All three t-tests: p > 0.80.
Figure 3. Boxplot jitter plots showing the effect of sex on DNA concentration ng/µL (A), A260/A280 DNA ratio (B), and A260/A230 DNA ratio (C) in shortnose sturgeon red blood cell samples stored at −80 °C for 8 years (n = 8 for each sex). All three t-tests: p > 0.80.
Fishes 10 00478 g003
Fishes 10 00478 g004
Figure 4. Boxplot jitter plots showing the effect of storage duration on DNA concentration ng/µL (A), A260/A280 DNA ratio (B), and A260/A230 DNA ratio (C) in shortnose sturgeon red blood cell samples stored at −80 °C for 2 or 8 years (n = 8 for 2 years in storage; n = 16 for 8 years in storage). All three t-tests, p < 0.006.
Figure 4. Boxplot jitter plots showing the effect of storage duration on DNA concentration ng/µL (A), A260/A280 DNA ratio (B), and A260/A230 DNA ratio (C) in shortnose sturgeon red blood cell samples stored at −80 °C for 2 or 8 years (n = 8 for 2 years in storage; n = 16 for 8 years in storage). All three t-tests, p < 0.006.
Fishes 10 00478 g004
Fishes 10 00478 g005
Figure 5. Boxplot jitter plots showing the effect of storage temperature on DNA concentration ng/µL (A), A260/A280 DNA ratio (B), and A260/A230 DNA ratio (C) in male shortnose sturgeon red blood cell samples stored for 2 years at −20 °C or −80 °C (n = 8 for each temperature). All three t-tests: p < 0.002.
Figure 5. Boxplot jitter plots showing the effect of storage temperature on DNA concentration ng/µL (A), A260/A280 DNA ratio (B), and A260/A230 DNA ratio (C) in male shortnose sturgeon red blood cell samples stored for 2 years at −20 °C or −80 °C (n = 8 for each temperature). All three t-tests: p < 0.002.
Fishes 10 00478 g005
Table 1. Sample year, RBC storage temperature, sex, and number of fish used for analyses.
Table 1. Sample year, RBC storage temperature, sex, and number of fish used for analyses.
YearStorage Temperature (°C)SexNumber
2016−80male8
2016−80female8
2022−80male8
2022−20male8
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Pozveh, H.S.T.; Dorafshan, S.; Benfey, T.J.; Addison, J.A.; Litvak, M.K. Validation of Using Multiplex PCR with Sex Markers SSM4 and ALLWSex2 in Long-Term Stored Blood Samples to Determine Sex of the North American Shortnose Sturgeon (Acipenser brevirostrum). Fishes 2025, 10, 478. https://doi.org/10.3390/fishes10100478

AMA Style

Pozveh HST, Dorafshan S, Benfey TJ, Addison JA, Litvak MK. Validation of Using Multiplex PCR with Sex Markers SSM4 and ALLWSex2 in Long-Term Stored Blood Samples to Determine Sex of the North American Shortnose Sturgeon (Acipenser brevirostrum). Fishes. 2025; 10(10):478. https://doi.org/10.3390/fishes10100478

Chicago/Turabian Style

Pozveh, Hajar Sadat Tabatabaei, Salar Dorafshan, Tillmann J. Benfey, Jason A. Addison, and Matthew K. Litvak. 2025. "Validation of Using Multiplex PCR with Sex Markers SSM4 and ALLWSex2 in Long-Term Stored Blood Samples to Determine Sex of the North American Shortnose Sturgeon (Acipenser brevirostrum)" Fishes 10, no. 10: 478. https://doi.org/10.3390/fishes10100478

APA Style

Pozveh, H. S. T., Dorafshan, S., Benfey, T. J., Addison, J. A., & Litvak, M. K. (2025). Validation of Using Multiplex PCR with Sex Markers SSM4 and ALLWSex2 in Long-Term Stored Blood Samples to Determine Sex of the North American Shortnose Sturgeon (Acipenser brevirostrum). Fishes, 10(10), 478. https://doi.org/10.3390/fishes10100478

Article Metrics

Back to TopTop