Fast and Efficient Mouse Pluripotency Reprogramming Using a Chemically-Defined Medium
Abstract
:1. Introduction
2. Experimental Design
2.1. Materials
2.2. Reagents
2.3. Medium Recipes
2.4. Primers
2.5. Cell Lines
3. Procedure
3.1. Viral Production through Calcium Phosphate Transfection
- Plate 7.5 × 106 or 4 × 106 Plat-E cells to 100 mm or 60 mm cell culture dishes, respectively, depending on experimental design. The cells were cultured in fibroblast medium.
- Observe the cells one day before performing calcium phosphate transfection and make sure the cells do not overgrow. The optimal confluence would be 70~80%.
- Refresh with 7.5 mL and 2.5 mL media for 100 mm and 60 mm cell culture dishes 2 h before transfection, respectively.
- Mix the following reagents in 1.5 mL or 15 mL tubes to prepare the cell transfection solution.
Storage Con. | Usage Con. | 60 mm Dishes | 100 mm Dishes | |
DNA | 1 μg/μL | / | 8 μg | 25 μg |
H2O | / | / | 429.5 μL | 1068.75 μL |
CaCl2 | 2 M | 125 mM | 62.5 μL | 156.25 μL |
2× HBS | 2× | 1× | 500 μL | 1250 μL |
Total | / | / | 1000 μL | 2500 μL |
- 5.
- Uniformly add the mixed reagents to the cells and move back and forth and then side-to-side 1–3 times to ensure equal distribution. The calcium phosphate precipitation appears as black fine particles and can be observed throughout the dishes under a microscope. Place the cells back in a 37 °C incubator.
- 6.
- Replace the transfection medium with 10 mL or 3.5 mL fresh fibroblast medium for a 100 mm or 60 mm dish, respectively, 12 h after transfection.
- 7.
- Collect the supernatants that contain the viruses for the first transduction 48 h after transfection, and refresh with 10 mL or 3.5 mL fibroblast medium for a 100 mm or 60 mm dish, respectively.
- 8.
- Collect the supernatants with viruses 72 h after transfection for the second transduction.
- 9.
- Filter the virus-containing media with 0.45 μm filter and use the viruses freshly.
3.2. Thawing, Culturing, and Proliferating OG2-MEFs
- Before thawing OG2-MEFs, coat the dish with 0.1% gelatin and incubate in a 37 °C incubator for at least 30 min.Note: OG2-MEFs should be tested for mycoplasma contamination as this will substantially impact the efficiency of iPSC generation.
- Remove the vials from the liquid nitrogen using the appropriate safety equipment.Note: When handling frozen vials, make sure to wear appropriate personal protective equipment including cryo-gloves and eye protection as vials that are stored in liquid nitrogen may explode when warmed.
- Immerse the vial in a 37 °C water bath without submerging the cap and keep swirling the vial gently.Note: The bottom of the vial that contains the OG2-MEFs should be immersed in the water bath; otherwise it would lead to cell death.
- Remove the vial from the water bath when only a small piece of ice crystal is left as it will thaw within seconds due to the remaining heat.
- Ensure that the cap is tight and spray the vial with 75% ethanol to sterilize the surface of the vial. Air-dry the vial in the sterile biosafety cabinet to ensure the absence of residual ethanol.
- Transfer the cells into the bottom of a sterile 15 mL tube gently using a 1-mL pipette tip and add 5 mL fresh fibroblast medium dropwise with a 10 mL pipette.Note: If the medium is not added dropwise to make the cells adapt to the osmotic pressure of the medium, cell survival may be impacted due to the rapid change of the environment.
- Centrifuge the cells at 200× g for 5 min.
- Aspirate the supernatant and resuspend the cells with 1 mL fresh fibroblast medium gently.
- Remove the 0.1% gelatin and slowly add 1 mL of the cell suspension into the 60 mm dish, followed by another 2 mL fresh fibroblast medium. Generally, 1 × 106 OG2-MEFs are sufficient for three 60 mm dishes.
- Feed 3 mL fibroblast medium to cells in one 60 mm dish every three days until ready to be passaged or harvested.
3.3. Passaging, Counting, and Plating OG2-MEFs
- OG2-MEFs are split when they reach 80~90% confluence. Wash the cells with 3 mL DPBS, as the serum in the fibroblast medium contains a massive amount of trypsin inhibitors.
- Aspirate DPBS, then add 0.5 mL pre-warmed 0.25% trypsin-EDTA, and incubate at 37 °C for 2 min.Note: The best working temperature for trypsin is 37 °C. Pre-warmed trypsin can fully disassociate OG2-MEFs in 2 min. Long and short incubation will lead to poor cell vitality and residual cells, respectively.
- When OG2-MEFs are well detached as single cells, add an equal volume of fibroblast medium to terminate the trypsin reaction.
- Transfer the cell suspension to a sterile 15 mL tube. Take 10 µL of the cell suspension for cell counting.
- Centrifuge the cells at 200× g for 5 min at room temperature. Meanwhile, count the cells using a hemocytometer or an automated cell counter.Note: Cell concentrations between 4–6 × 105 would give a more accurate result when using a hemocytometer.
- Aspirate the supernatants and resuspend the cells first with 1 mL medium. Pipette up and down to ensure a single-cell suspension. Then add a proper medium volume to obtain 1.5 × 104 living cells per well in 12-well plates.Note: Gently shake the tube to ensure equal distribution of the cells and an equal number of cells in every well. Normally, 1.5–2 × 104 cells are recommended for OKS reprogramming and 3 × 104 cells are recommended for OK/OS/O reprogramming.
- Gently move the plates back-and-forth to ensure uniform distribution of the cells before placing them back in the incubator.Note: Due to the edge effect of the plate, rotational movement should be avoided to ensure that cells do not aggregate in the middle of the well. Close the incubator gently to avoid disturbance.
- OG2-MEFs will completely adhere to the well in 8 h which is the appropriate window for viral transduction, as poor adhesion of OG2-MEFs will lower the reprogramming efficiency.
3.4. Generation of iPSCs
- Aspirate the spent medium and add 0.5 mL of each virus-containing media, which were collected and filtered from Section 3.1 followed by adding 0.5 mL fibroblast medium containing 4 µg/mL polybrene. Normally, the volume of the virus-containing media depends on the transfection efficiency in Plat-E cells during viral production in Section 3.1. It is recommended to use 0.5 mL virus-containing media if the efficiency achieves 90%, and to use 0.75 mL virus-containing media if the efficiency is 80% or lower.
- Perform the second transduction by repeating step 1 one day after the primary transduction.
- The virus-containing media are removed 24 h after the second transduction and 1 mL of iCD1 is added to the cells. The day on which virus-containing media are removed is denoted as day 0 post-transduction.
- Feed the cells daily with 1 mL fresh medium per well of a 12-well plate, 2 mL at day 5 and hereafter, as the robust proliferation of cells will lead to a deficiency of nutrition during reprogramming.Note: Medium should be pre-warmed at room temperature in the dark before use, as the small molecules in the medium are photolytic. Use the medium freshly (within a week) as it contains reducing substances and many unstable growth factors.
- Oct4-GFP positive and dome-shaped colonies are considered as reprogrammed iPSC colonies.
- The iPSC colonies are picked at day 7 post-transduction based on Oct4-GFP expression and characteristic ESC-like morphology. The picked colonies are subsequently expanded and maintained the same way as ESCs.
3.5. Characterization of iPSCs by Immunostaining (in a Cell Culture Plate)
- Gently remove the medium and wash the cells with 1 mL of DPBS twice.
- Add 1 mL of 4% (wt/vol) PFA to each well of a 12-well plate and let it stand at room temperature for 30 min. Gently replace with 1 mL of DPBS and shake for 5 min at room temperature. Repeat the DPBS wash twice.
- Add 500 μL blocking and permeabilization solution (one volume of 3% GSA and one volume of 0.2% triton mixed together). Incubate for 40 min at 25 °C.
- Wash the well with 1 mL of DPBS, place it on a horizontal shaker at room temperature and shake for 5 min. Repeat the DPBS wash twice.
- Incubate with the Anti-Nanog antibody (1:1000) at 4 °C overnight.
- Wash the cells with DPBS thrice and incubate for 10 min each time at room temperature on a horizontal shaker.
- Incubate with the secondary antibody (1:2000) for 1 h at room temperature and avoid light.
- Wash the cells with DPBS thrice and incubate for 10 min each time at room temperature on a horizontal shaker (avoid light).
- Add 1 mL DPBS into each well and use a fluorescence microscope to capture images.
4. Expected Results
5. Discussion
6. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Martin, G.R. Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc. Natl. Acad. Sci. USA 1981, 78, 7634–7638. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Evans, M.J.; Kaufman, M.H. Establishment in culture of pluripotential cells from mouse embryos. Nature 1981, 292, 154–156. [Google Scholar] [CrossRef] [PubMed]
- Goncalves, N.N.; Ambrosio, C.E.; Piedrahita, J.A. Stem cells and regenerative medicine in domestic and companion animals: A multispecies perspective. Reprod. Domest. Anim. 2014, 49 (Suppl 4), 2–10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wilmut, I.; Schnieke, A.E.; McWhir, J.; Kind, A.J.; Campbell, K.H. Viable offspring derived from fetal and adult mammalian cells. Nature 1997, 385, 810–813. [Google Scholar] [CrossRef]
- Tada, M.; Takahama, Y.; Abe, K.; Nakatsuji, N.; Tada, T. Nuclear reprogramming of somatic cells by in vitro hybridization with ES cells. Curr. Biol. 2001, 11, 1553–1558. [Google Scholar] [CrossRef] [Green Version]
- Cowan, C.A.; Atienza, J.; Melton, D.A.; Eggan, K. Nuclear Reprogramming of Somatic Cells After Fusion with Human Embryonic Stem Cells. Science 2005, 309, 1369–1373. [Google Scholar] [CrossRef] [Green Version]
- Takahashi, K.; Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 2006, 126, 663–676. [Google Scholar] [CrossRef] [Green Version]
- Qin, D.; Li, W.; Zhang, J.; Pei, D. Direct generation of ES-like cells from unmodified mouse embryonic fibroblasts by Oct4/Sox2/Myc/Klf4. Cell Res. 2007, 17, 959–962. [Google Scholar] [CrossRef]
- Wernig, M.; Meissner, A.; Foreman, R.; Brambrink, T.; Ku, M.; Hochedlinger, K.; Bernstein, B.E.; Jaenisch, R. In vitro reprogramming of fibroblasts into a pluripotent ES-cell-like state. Nature 2007, 448, 318–324. [Google Scholar] [CrossRef]
- Okita, K.; Ichisaka, T.; Yamanaka, S. Generation of germline-competent induced pluripotent stem cells. Nature 2007, 448, 313–317. [Google Scholar] [CrossRef]
- Takahashi, K.; Tanabe, K.; Ohnuki, M.; Narita, M.; Ichisaka, T.; Tomoda, K.; Yamanaka, S. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 2007, 131, 861–872. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maherali, N.; Hochedlinger, K. Guidelines and techniques for the generation of induced pluripotent stem cells. Cell Stem Cell 2008, 3, 595–605. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Welstead, G.G.; Brambrink, T.; Jaenisch, R. Generating iPS cells from MEFS through forced expression of Sox-2, Oct-4, c-Myc, and Klf4. J. Vis. Exp. 2008. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, J.; Liu, J.; Chen, Y.; Yang, J.; Chen, J.; Liu, H.; Zhao, X.; Mo, K.; Song, H.; Guo, L.; et al. Rational optimization of reprogramming culture conditions for the generation of induced pluripotent stem cells with ultra-high efficiency and fast kinetics. Cell Res. 2011, 21, 884–894. [Google Scholar] [CrossRef] [Green Version]
- Nakagawa, M.; Koyanagi, M.; Tanabe, K.; Takahashi, K.; Ichisaka, T.; Aoi, T.; Okita, K.; Mochiduki, Y.; Takizawa, N.; Yamanaka, S. Generation of induced pluripotent stem cells without Myc from mouse and human fibroblasts. Nat. Biotechnol. 2008, 26, 101–106. [Google Scholar] [CrossRef]
- Wernig, M.; Meissner, A.; Cassady, J.P.; Jaenisch, R. c-Myc is dispensable for direct reprogramming of mouse fibroblasts. Cell Stem Cell 2008, 2, 10–12. [Google Scholar] [CrossRef] [Green Version]
- Warren, L.; Manos, P.D.; Ahfeldt, T.; Loh, Y.H.; Li, H.; Lau, F.; Ebina, W.; Mandal, P.K.; Smith, Z.D.; Meissner, A.; et al. Highly efficient reprogramming to pluripotency and directed differentiation of human cells with synthetic modified mRNA. Cell Stem Cell 2010, 7, 618–630. [Google Scholar] [CrossRef] [Green Version]
- Okita, K.; Nakagawa, M.; Hyenjong, H.; Ichisaka, T.; Yamanaka, S. Generation of mouse induced pluripotent stem cells without viral vectors. Science 2008, 322, 949–953. [Google Scholar] [CrossRef]
- Kim, J.B.; Sebastiano, V.; Wu, G.; Arauzo-Bravo, M.J.; Sasse, P.; Gentile, L.; Ko, K.; Ruau, D.; Ehrich, M.; van den Boom, D.; et al. Oct4-induced pluripotency in adult neural stem cells. Cell 2009, 136, 411–419. [Google Scholar] [CrossRef]
- Stadtfeld, M.; Brennand, K.; Hochedlinger, K. Reprogramming of Pancreatic β Cells into Induced Pluripotent Stem Cells. Curr. Biol. 2008, 18, 890–894. [Google Scholar] [CrossRef] [Green Version]
- Broccoli, V. Reprogramming of somatic cells: iPS and iN cells. Prog. Brain Res. 2017, 230, 53–68. [Google Scholar] [CrossRef] [PubMed]
- Aoi, T.; Yae, K.; Nakagawa, M.; Ichisaka, T.; Okita, K.; Takahashi, K.; Chiba, T.; Yamanaka, S. Generation of Pluripotent Stem Cells from Adult Mouse Liver and Stomach Cells. Science 2008, 321, 699–702. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huangfu, D.; Maehr, R.; Guo, W.; Eijkelenboom, A.; Snitow, M.; Chen, A.E.; Melton, D.A. Induction of pluripotent stem cells by defined factors is greatly improved by small-molecule compounds. Nat. Biotechnol. 2008, 26, 795–797. [Google Scholar] [CrossRef] [PubMed]
- Wang, T.; Chen, K.; Zeng, X.; Yang, J.; Wu, Y.; Shi, X.; Qin, B.; Zeng, L.; Esteban, M.A.; Pan, G.; et al. The histone demethylases Jhdm1a/1b enhance somatic cell reprogramming in a vitamin-C-dependent manner. Cell Stem Cell 2011, 9, 575–587. [Google Scholar] [CrossRef] [Green Version]
- Hou, P.; Li, Y.; Zhang, X.; Liu, C.; Guan, J.; Li, H.; Zhao, T.; Ye, J.; Yang, W.; Liu, K.; et al. Pluripotent Stem Cells Induced from Mouse Somatic Cells by Small-Molecule Compounds. Science 2013, 341, 651–654. [Google Scholar] [CrossRef]
- Cao, S.; Yu, S.; Li, D.; Ye, J.; Yang, X.; Li, C.; Wang, X.; Mai, Y.; Qin, Y.; Wu, J.; et al. Chromatin Accessibility Dynamics during Chemical Induction of Pluripotency. Cell Stem Cell 2018, 22, 529–542. [Google Scholar] [CrossRef] [Green Version]
- Zhao, Y.; Zhao, T.; Guan, J.; Zhang, X.; Fu, Y.; Ye, J.; Zhu, J.; Meng, G.; Ge, J.; Yang, S.; et al. A XEN-like State Bridges Somatic Cells to Pluripotency during Chemical Reprogramming. Cell 2015, 163, 1678–1691. [Google Scholar] [CrossRef] [Green Version]
- Mikkelsen, T.S.; Hanna, J.; Zhang, X.; Ku, M.; Wernig, M.; Schorderet, P.; Bernstein, B.E.; Jaenisch, R.; Lander, E.S.; Meissner, A. Dissecting direct reprogramming through integrative genomic analysis. Nature 2008, 454, 49–55. [Google Scholar] [CrossRef]
- Chen, J.; Liu, J.; Han, Q.; Qin, D.; Xu, J.; Chen, Y.; Yang, J.; Song, H.; Yang, D.; Peng, M.; et al. Towards an Optimized Culture Medium for the Generation of Mouse Induced Pluripotent Stem Cells. J. Biol. Chem. 2010, 285, 31066–31072. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Chen, J.; Hu, J.L.; Wei, X.X.; Qin, D.; Gao, J.; Zhang, L.; Jiang, J.; Li, J.S.; Liu, J.; et al. Reprogramming of mouse and human somatic cells by high-performance engineered factors. EMBO Rep. 2011, 12, 373–378. [Google Scholar] [CrossRef] [Green Version]
- Ying, Q.; Wray, J.; Nichols, J.; Batlle-Morera, L.; Doble, B.; Woodgett, J.; Cohen, P.; Smith, A. The ground state of embryonic stem cell self-renewal. Nature 2008, 453, 519–523. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Szabo, P.E.; Hubner, K.; Scholer, H.; Mann, J.R. Allele-specific expression of imprinted genes in mouse migratory primordial germ cells. Mech Dev. 2002, 115, 157–160. [Google Scholar] [CrossRef]
- Chen, J.; Liu, J.; Yang, J.; Chen, Y.; Chen, J.; Ni, S.; Song, H.; Zeng, L.; Ding, K.; Pei, D. BMPs functionally replace Klf4 and support efficient reprogramming of mouse fibroblasts by Oct4 alone. Cell Res. 2011, 21, 205–212. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yu, S.; Zhou, C.; Cao, S.; He, J.; Cai, B.; Wu, K.; Qin, Y.; Huang, X.; Xiao, L.; Ye, J.; et al. BMP4 resets mouse epiblast stem cells to naive pluripotency through ZBTB7A/B-mediated chromatin remodelling. Nat. Cell Biol. 2020, 22, 651–662. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Z.; Yang, X.; He, J.; Liu, J.; Wu, F.; Yu, S.; Liu, Y.; Lin, R.; Liu, H.; Cui, Y.; et al. Kdm2b Regulates Somatic Reprogramming through Variant PRC1 Complex-Dependent Function. Cell Rep. 2017, 21, 2160–2170. [Google Scholar] [CrossRef] [Green Version]
- Li, D.; Liu, J.; Yang, X.; Zhou, C.; Guo, J.; Wu, C.; Qin, Y.; Guo, L.; He, J.; Yu, S.; et al. Chromatin Accessibility Dynamics during iPSC Reprogramming. Cell Stem Cell 2017, 21, 819–833. [Google Scholar] [CrossRef] [Green Version]
Name | Source | Identifier | Location |
---|---|---|---|
Pipette tips 10 μL | Corning | T-300 | Glendale, AZ, USA |
Pipette tips 200 μL | Corning | T-200-Y | Glendale, AZ, USA |
Pipette tips 1 mL | Corning | T-1000-B | Glendale, AZ, USA |
Microtubes | Corning | MCT-150-C | Glendale, AZ, USA |
15 mL tubes | Corning | 430790 | Glendale, AZ, USA |
50 mL tubes | Corning | 430828 | Glendale, AZ, USA |
Cell culture multiwell plate, 6 well | Greiner | 657160 | Kremsmünster, Austria |
Cell culture multiwell plate, 12 well | Greiner | 665180 | Kremsmünster, Austria |
60 mm cell culture dishes | Greiner | 664160 | Kremsmünster, Austria |
100 mm cell culture dishes | Greiner | 628160 | Kremsmünster, Austria |
0.45 μm filter | Millipore | SLHVR33RB | Burlington, MA, USA |
4 °C refrigerator | Haier | HYCD-290 | Guangzhou, China |
−20 °C freezer | Haier | HYCD-290 | Guangzhou, China |
−80 °C freezer | Thermo Fisher Scientific | 995 | Waltham, MA, USA |
Heracell 240i Incubator | Thermo Fisher Scientific | 51026331 | Waltham, MA, USA |
Microscope | ZEISS | Vert.A1 | Oberkochen, Germany |
Low-speed centrifuge | ZONKIA | SC-3612 | Anhui, China |
QuantStudioTM 3 Real-Time PCR Instrument | Applied Biosystems | A28132 | Waltham, MA, USA |
Name | Source | Identifier | Location |
---|---|---|---|
Dulbecco’s Phosphate-Buffer Saline (DPBS) | HyClone | SH30028.02 | Logan, UT, USA |
DMEM High Glucose | Hyclone | SH30022.01 | Logan, UT, USA |
FBS (for mES + Vitamin C medium) | Lonsera | S711-001s | Shanghai, China |
FBS (for fibroblast medium) | NATOCOR | SFBE | Córdoba, Argentina |
GlutaMAX | GIBCO | 35050079 | Waltham, MA, USA |
Non-Essential Amino Acids Solution (NEAA) | GIBCO | 11140076 | Waltham, MA, USA |
Sodium Pyruvate | GIBCO | 11360070 | Waltham, MA, USA |
β-Mercaptoethanol | GIBCO | 21985-023 | Waltham, MA, USA |
Trypsin-EDTA (0.25%) | GIBCO | 25200114 | Waltham, MA, USA |
DAPI | Sigma | D9542 | Burlington, MA, USA |
GSA | ZSGB-BIO | ZLI-9022 | Beijing, China |
Triton x-100 | Sigma | T9284 | Burlington, MA, USA |
Nanog Polyclonal Antibody | BETHYL | A300-397 | Montgomery, TX, USA |
Alexa Fluor 568 Goat anti-Rabbit | Invitrogen | A11011 | Waltham, MA, USA |
ChamQTM SYBR qPCR Master Mix kit | Vazyme | Q311 | Nanjing, China |
HiScript II Q RT SuperMix for qPCR kit | Vazyme | R222-01 | Nanjing, China |
TRI Reagent | MRC | TR118-200 | Cincinnati, OH, USA |
CHIR99021 | Sigma | SML1046 | Burlington, MA, USA |
Thiamine hydrochloride | Sigma | T1270 | Burlington, MA, USA |
2-Phospho-L-ascorbic acid trisodium salt (Vitamin C) | Sigma | 49752 | Burlington, MA, USA |
Lithium chloride | Sigma | L4408 | Burlington, MA, USA |
Polybrene | Sigma | TR1003 | Burlington, MA, USA |
Sodium phosphate dibasic | Sigma | S7907 | Burlington, MA, USA |
Potassium chloride | Sigma | P9333 | Burlington, MA, USA |
HEPES | Sigma | H7523 | Burlington, MA, USA |
D-(+)-Glucose | Sigma | G6152 | Burlington, MA, USA |
Sodium chloride | Sigma | S5886 | Burlington, MA, USA |
Mouse leukemia inhibitory factor (LIF) | Millipore | ESGE107 | Burlington, MA, USA |
pMX-Oct4 | Addgene | 13366 | Watertown, MA, USA |
pMX-Sox2 | Addgene | 13367 | Watertown, MA, USA |
pMX-Klf4 | Addgene | 13370 | Watertown, MA, USA |
pMX-DsRed | Laboratory of D. Pei | N/A | Guangzhou, China |
Name | Recipe |
---|---|
2× HBS (500 mL) | NaCl 8.1816 g, KCl 0.8715 g, Na2HPO4 0.10647 g, Glucose 1.08096 g, HEPES 5.95775 g, adjust PH to 6.92–6.95 with NaOH, add ultrapure water to 500 mL |
2 M CaCl2 (500 mL) | CaCl2 147.02 g, add ultrapure water to 500 mL |
Fibroblast medium | DMEM/high glucose 500 mL, FBS (NATOCOR) 10% (56 mL), NEAA 1/100 (5.6 mL), GlutaMAX 1/100 (5.6 mL) |
mES + Vitamin C | Lonsera FBS 7.5 mL, NEAA 500 μL, GlutaMAX 500 μL, Sodium Pyruvate 500 μL, β-Mercaptoethanol (55 mM) 91 μL (Final concentration 0.1 μM), 2-Phospho-L-ascorbic acid trisodium salt (Vitamin C, final concentration 50 μg/mL) 50 μL, Mouse leukemia inhibitory factor (0.1 mg/mL, Final concentration 12.5 ng/mL) 6.25 μL, add DMEM/high glucose to make the volume 50 mL |
iCD1 | The recipe is shown in Table 4 |
3% GSA Blocking Buffer | GSA 1.5 mL, DPBS 48.5 mL |
0.2% Permeabilization Buffer | Triton 0.1 mL, DPBS 49.9 mL |
Substance | mg/L | Substance | mg/L |
---|---|---|---|
L-Arginine·HCl | 8.40 × 101 | Arachidonic adic | 2.00 × 10−2 |
L-Alanine | 8.90 | Cholesterol | 2.20 |
L-Asparagine | 1.32 × 101 | Linoleic acid | 1.00 × 10−1 |
L-Aspartic acid | 1.33 × 101 | Linolenic acid | 1.00 × 10−1 |
L-Cystine·2HCl | 6.30 × 101 | Myristic acid | 1.00 × 10−1 |
L-Glutamic acid | 1.47 × 101 | Oleic acid | 1.00 × 10−1 |
L-Histidine HCl·H20 | 4.20 × 101 | Palmitoleic acid | 1.00 × 10−1 |
L-Isoleucine | 1.05 × 102 | Palmitic acid | 1.00 × 10−1 |
L-Leucine | 1.05 × 102 | Pluronic F-18 | 1.00 × 103 |
L-Lystine HCl | 1.46 × 102 | Stearic acid | 1.00 × 10−1 |
L-Methionine | 3.00 × 101 | Tween 80 | 2.20 × 101 |
L-Phenylalanine | 6.60 × 101 | 2-Phospho-L-ascorbic acid | 5.00 × 101 |
L-Proline | 1.15 × 101 | D,L-alpha-tocopherol(Vitamin E) | 1.00 |
L-Serine | 6.30 × 101 | D,L-alpha-tocopherol acetatec | 1.00 |
L-Threonine | 9.50 × 101 | Biotin | 1.00 × 10−1 |
L-Tryptophan | 1.60 × 101 | D-Ca pantothenate | 4.00 |
L-Tyrosine·2Na·2H2O | 1.04 × 102 | Choline chloride | 4.00 |
L-Valine | 9.40 × 101 | Folic acid | 4.00 |
Glycine | 4.50 × 101 | i-Inositol | 7.20 |
D-Glucose | 4.50 × 103 | Niacinamide | 4.00 |
Sodium pyruvate | 1.10 × 102 | Pyridoxine HCl | 4.00 |
D(+)-Galactose | 1.50 × 101 | Riboflavin | 4.00 × 10−1 |
Insulin(Bovine, Recombinant) | 5.00 × 101 | Thiamine HCl | 4.00 |
Transferrin(Human) | 1.00 × 102 | Retinol, all trans(Vitamin A) | 1.00 × 10−1 |
Recombinant BSA Fraction V | 1.00 × 103 | Vitamin B12 | 1.40 |
Catalase | 2.50 | Putrescine·2HCl | 3.22 × 101 |
Glutathione(Reduced) | 1.50 | L-Carnitine HCl | 2.00 |
Superoxide dismutase | 2.50 | Ethanolamine HCl | 1.00 |
T-3/Albumin Complex | 2.00 × 10−3 | Lipoic acid | 4.70 × 10−2 |
Corticosterone | 2.00 × 10−2 | Phenol red | 1.50 × 101 |
Progesterone | 1.26 × 10−2 | CHIR99021 | 1.40 |
basic FGF | 5.00 × 10−3 | 2-mercaptoethanol | 8.17 |
Leukemia inhibitory factor | 1.00 × 10−2 | ||
LiCl | 2.12 × 102 | ||
CaCl2(anhyd.) | 2.00 × 102 | ||
Fe(NO3)3·9H20 | 1.00 × 10−1 | ||
KCl | 4.00 × 102 | ||
MgSO4 | 9.77 × 101 | ||
NaCl | 6.40 × 103 | ||
NaHCO3 | 3.70 × 103 | ||
NaH2PO4·H2O | 1.25 × 102 | ||
Sodium selenite | 1.86 × 10−2 |
Name | Sequence (5′ to 3′) |
---|---|
Gapdh-F | AACTTTGGCATTGTGGAAGGGCTCA |
Gapdh-R | TTGGCAGCACCAGTGGATGCAGGGA |
Nanog-F | CTCAAGTCCTGAGGCTGACA |
Nanog-R | TGAAACCTGTCCTTGAGTGC |
Endo-Oct4-F | TAGGTGAGCCGTCTTTCCAC |
Endo-Oct4-R | GCTTAGCCAGGTTCGAGGAT |
Dppa3-F | TGTGGAGAACAAGAGTGA |
Dppa3-R | CTCAATCCGAACAAGTCTT |
Name | Source |
---|---|
Platinum-E (Plat-E) | A gift from The Fourth Military Medical University |
OG2 Mouse Embryonic Fibroblast | E13.5 mouse embryos from crossing male Oct4–GFP transgenic mice (CBA/CaJ XC57BL/6J) to 129Sv/Jae female mice |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huang, J.; Yang, X.; Wang, J.; Wu, H.; Pei, D.; Chen, J. Fast and Efficient Mouse Pluripotency Reprogramming Using a Chemically-Defined Medium. Methods Protoc. 2022, 5, 28. https://doi.org/10.3390/mps5020028
Huang J, Yang X, Wang J, Wu H, Pei D, Chen J. Fast and Efficient Mouse Pluripotency Reprogramming Using a Chemically-Defined Medium. Methods and Protocols. 2022; 5(2):28. https://doi.org/10.3390/mps5020028
Chicago/Turabian StyleHuang, Junju, Xuejie Yang, Jie Wang, Haoyu Wu, Duanqing Pei, and Jiekai Chen. 2022. "Fast and Efficient Mouse Pluripotency Reprogramming Using a Chemically-Defined Medium" Methods and Protocols 5, no. 2: 28. https://doi.org/10.3390/mps5020028