Next Article in Journal
Cluster Randomized Controlled Trial on the Effects of 12 Months of Combined Exercise Training during Hemodialysis in Patients with Chronic Kidney Disease—Study Protocol of the Dialysis Training Therapy (DiaTT) Trial
Previous Article in Journal
Time Mating Guinea Pigs by Monitoring Changes to the Vaginal Membrane throughout the Estrus Cycle and with Ultrasound Confirmation
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Protocol

A Mating Procedure for Genetic Transfer of Integrative and Conjugative Elements (ICEs) of Streptococci and Enterococci

Laboratory of Molecular Microbiology and Biotechnology, Department of Medical Biotechnologies, University of Siena, 53100 Siena, Italy
*
Author to whom correspondence should be addressed.
Methods Protoc. 2021, 4(3), 59; https://doi.org/10.3390/mps4030059
Submission received: 23 July 2021 / Revised: 21 August 2021 / Accepted: 26 August 2021 / Published: 28 August 2021

Abstract

:
DNA sequencing of whole bacterial genomes has revealed that the entire set of mobile genes (mobilome) represents as much as 25% of the bacterial genome. Despite the huge availability of sequence data, the functional analysis of the mobile genetic elements (MGEs) is rarely reported. Therefore, established laboratory protocols are needed to investigate the biology of this important part of the bacterial genome. Conjugation is a mechanism of horizontal gene transfer which allows the exchange of MGEs among strains of the same or different bacterial species. In streptococci and enterococci, integrative and conjugative elements (ICEs) represent a large part of the mobilome. Here, we describe an efficient and easy-to-perform plate mating protocol for in vitro conjugative transfer of ICEs in streptococci (Streptococcus pneumoniae, Streptococcus agalactiae, Streptococcus gordonii, Streptococcus pyogenes), Enterococcus faecalis, and Bacillus subtilis. Conjugative transfer is carried out on solid media and selection of transconjugants is performed with a multilayer plating. This protocol allows the transfer of large genetic elements with a size up to 81 kb, and a transfer frequency up to 6.7 × 10−3 transconjugants/donor cells.

1. Introduction

The three major mechanisms of horizontal gene transfer in bacteria are conjugation, transformation, and transduction. Mobile genetic elements (MGEs), including conjugative and integrative elements (ICEs) and prophages, shape the bacterial genome and are responsible for genome evolution [1]. Conjugation enables the genetic exchange of MGEs, which provide a major contribution to the spread of antimicrobial resistance and virulence, by recruiting new resistance and virulence genes and facilitating their dissemination [2]. Genome-wide DNA sequencing disclosed the presence of a large number of uncharacterized MGEs, whose open reading frames are often automatically annotated as conserved genes of unknown function [3]. In fact, the nature of the mobile elements and their transfer mechanisms have been clarified only in few cases [4,5,6,7]. ICEs account for the majority of streptococcal and enterococcal MGEs [8]. To elucidate transfer mechanisms and their regulation it is essential to develop an established protocol for efficient conjugal transfer of ICEs also from encapsulated clinical bacterial strains. In this work, we developed a successful plate mating protocol for in vitro transfer of large ICEs with a size up to 81 kb in streptococci (Streptococcus pneumoniae, Streptococcus agalactiae, Streptococcus gordonii, Streptococcus pyogenes), Enterococcus faecalis, and Bacillus subtilis.

2. Materials and Equipment

  • Deionized H2O;
  • Tryptic soy broth (TSB), agar technical (BD, Difco, USA);
  • Defibrinated horse blood (Liofilchem, Italy);
  • Antibiotics, glycerol, ethanol (Sigma-Aldrich, USA);
  • Filter 0.2 µm (Minisart, Sartorius, Germany);
  • Petri dishes, tubes, serological pipets, microtubes, micropipette tips, cotton swabs, toothpicks, syringes (Sarstedt, Germany);
  • Laboratory glassware (Schott, UK);
  • Incubators (KW Apparecchi Scientifici, Italy);
  • Spectronic GENESYS 200 spectrophotometer (Thermo Scientific, USA);
  • Heat block (FALC Instruments, Italy);
  • White light transilluminator;
  • VAPOUR-Line autoclave (VWR Avantor, USA).

3. Methods

A schematic diagram of the plate mating protocol is reported in Figure 1.

3.1. Preparation of Media

  • Liquid medium: Dissolve 30 g of TSB dehydrated medium in 1 L of deionized H2O and autoclave at 121 °C for 15 min (see Note 1). Add the appropriate antibiotics at the following concentrations when required: 3 µg mL−1 chloramphenicol, 0.5 µg mL−1 erythromycin, 500 µg mL−1 kanamycin, 10 µg mL−1 novobiocin, 100 µg mL−1 spectinomycin, 500 µg mL−1 streptomycin, 5 µg mL−1 tetracycline, 25 µg mL−1 fusidic acid, 25 µg mL−1 rifampicin.
  • Solid medium: Add 1.5% agar to TSB liquid medium and autoclave at 121 °C for 15 min. Equilibrate TSA (TSB and agar) at 48 °C for 20 min. Add 5% defibrinated horse blood and the appropriate antibiotics at the concentrations reported in step 1 when required. Mix and pour 25 mL in each Petri dish. Leave to solidify for 20 min, dry at 42 °C for 30 min and store at 4 °C.
  • Antibiotics such as kanamycin, novobiocin, spectinomycin, or streptomycin are resuspended in deionized H2O, sterilized by filtration with a 0.2 µm filter; chloramphenicol, erythromycin, tetracycline, and fusidic acid are resuspended in absolute ethanol; rifampicin is resuspended in methanol. Stock solutions are as follows: 10 mg mL−1 chloramphenicol, 2.5 mg mL−1 erythromycin, 100 mg mL−1 kanamycin, 10 mg mL−1 novobiocin, 50 mg mL−1 spectinomycin, 100 mg mL−1 streptomycin, 5 mg mL−1 tetracycline, 5 mg mL−1 fusidic acid, 25 mg mL−1 rifampicin. Antibiotics are stored in 1 mL aliquots at −20 °C (see Note 2).
  • Glycerol is diluted two-fold (50%) in TSB.

3.2. Pre-Mating Preparation of Cells

  • Thaw frozen starter cultures at 37 °C.
  • Pre-warm TSB at 37 °C.
  • Dilute frozen cultures 100 fold in TSB containing antibiotics and incubate at 37 °C.
  • Grow donor and recipient cells separately until late exponential phase.
  • Record the OD590 on a semi-log paper.
  • Draw the growth curve and determine the duplication time.
  • Freeze 2 mL mating starter cells at OD590 = 0.8 (approximately 5 × 108 CFU mL−1) in 10% glycerol (see Note 3).

3.3. Plate Mating

  • Thaw frozen mating starter cultures (see Note 4).
  • Mix 1:10 donor cells (100 µL) and recipient cells (900 µL) in a 1.5 mL microtube (see Note 5).
  • Centrifuge the mixed cells at room temperature for 15 min at 3000 × g.
  • Discard supernatant and resuspend the pelleted cells in 0.1 mL of TSB.
  • Plate mixture on a blood-agar plate and incubate at 37 °C for 4 hours in a 5% CO2 enriched atmosphere.
  • Harvest cells by scraping from the plate with a cotton swab and dissolve in a 1 mL of TSB/Glycerol 10%.
  • Freeze mating samples at −70 °C (see Note 6).

3.4. Multilayer Plating

  • Prepare TSA medium and equilibrate at 48 °C for 20 min.
  • Pour a 17 mL base layer of TSA in Petri dishes and let the medium solidify.
  • Dispense 2 mL of TSB supplemented with 10% horse blood in 5 mL slip-cap tubes.
  • Put 13 mL slip-cap tubes into a heat block at 48 °C and distribute 6 ml of TSA per tube.
  • Add appropriately diluted mating reactions into the 2 mL-TSB-containing tube (see Note 7).
  • Combine 6 ml of TSA with the 2 mL of TSB blood cells, shake, and pour onto plate.
  • Let the medium solidify, incubate at 37 °C for 90 min (phenotypic expression).
  • Add an 8 ml third layer of TSA containing the appropriate antibiotics (see Note 8).
  • Let the medium solidify, then incubate at 37 °C overnight (see Note 9).
  • Score transconjugant cells, calculate conjugation efficiency as transconjugant per donor cells.

3.5. Genetic Analysis of Transconjugants

  • Fit blood-agar plates on grids of the transilluminator device (see Note 10).
  • Pick single colony isolates from conjugation plates by using sterile toothpicks and transfer to the plates placed on the illuminated grid.
  • Incubate at 37 °C overnight in a 5% CO2 enriched atmosphere.
  • Check the phenotypes of transconjugants (see Note 11).
  • Isolate transconjugants from the genetic analysis plates on new plates containing the appropriate antibiotic.
  • Incubate at 37 °C overnight in a 5% CO2 enriched atmosphere.
  • Grow single colony isolates in TSB containing the appropriate antibiotic.
  • Freeze transconjugant starter cultures (in exponential phase, OD590 = 0.2–0.3) in 10% glycerol at −70 °C.

4. Notes

  • Other media, such as brain heart infusion (BHI) (Oxoid, UK) for streptococci and enterococci can be used. For Bacillus subtilis the Luria–Bertani (LB) medium (BD, Difco) was used.
  • Due to light sensitivity, wrap the microtubes containing novobiocin, tetracycline, and rifampicin antibiotics in aluminum foil. Antibiotics may be stored at −20 °C for extended periods. When preparing antibiotic solutions wear protective clothing, gloves, and eye/face protection.
  • Disposable frozen mating starter cells can be stored at −70°C for extended periods. The use of donor and recipient cells at a concentration of approximately 5 × 108 CFU mL−1 is mandatory
  • Alternatively, fresh donor and recipient cell cultures may be used.
  • Donor cells (100 µL) and recipient cells (900 µL) are also processed separately with the same procedure and included as controls for the conjugation experiment. The 1/10 donor/recipient cell ratio is mandatory.
  • Mating reactions can be frozen at –70 °C and plated later. Comparable numbers of transconjugants can be obtained from fresh or frozen mating reactions.
  • Dilutions are routinely plated as follows: 10−1 and 10−2 of the conjugation mixture for transconjugants selection, 10−6 and 10−7 for donor cells counts, 10−7 and 10−8 for recipient cells counts.
  • We constructed new Streptococcus pneumoniae strains, FP10 and FP11, to be used as standard conjugation recipients to transfer MGEs from the original encapsulated clinical isolates. These strains: (i) lack the capsule, (ii) contain a deletion in the comC gene for competence stimulating peptide (CSP) and are impaired in natural competence for genetic transformation, and (iii) harbor the str-41 (FP10) and the nov-1 (FP11) point mutations conferring resistance to streptomycin and novobiocin, respectively. The absence of the polysaccharide capsule on the bacterial surface increases the efficiency of ICEs conjugal transfer [9]. The impairment in natural competence for genetic transformation allows us to rule out the contribution of transformation to the genetic exchange during conjugation (F. Iannelli and G. Pozzi, unpublished). The availability of two strains with different resistance markers allows transconjugants selection and to transfer the genetic elements from transconjugants again. Plating of the mating reactions includes: (i) plates containing both antibiotics for the resistance marker of the donor genetic element and for the chromosomal resistance marker of recipient strain; (ii) plates containing antibiotic for the resistance marker of the genetic element of the donor strain; and (iii) plates containing antibiotic for the chromosomal resistance marker of recipient strain. Appropriate antibiotics are added to this 8 ml TSA layer at the following concentrations: 5 µg mL-1 chloramphenicol, 1 µg mL−1 erythromycin, 1000 µg mL−1 kanamycin, 10 µg mL−1 novobiocin, 400 µg mL−1 spectinomycin, 1000 µg mL−1 streptomycin, 5 µg mL−1 tetracycline, 25 µg mL−1 fusidic acid, 25 µg mL−1 rifampicin. The multilayer plating allows: (i) a slow diffusion of the antibiotics in the agar layer containing bacteria, (ii) the visualization of the colony’s three-dimensional structure, (iii) a better count of the colonies since the plate is transparent and colonies are generally larger than when spread on a plate, and (iv) the prevention of contact with ambient air favoring the growth of fastidious bacteria.
  • Incubation can be extended to 48 h if required.
  • At this stage, carefully check the phenotype of the colonies in order to exclude isolation of spontaneous mutants or colonies which might grow even in the absence of any genotype conferring resistance. We built a transilluminating box apparatus equipped with an inner white light illuminating an upper plexiglass cover. An overhead transparency plotted with petri dish-size grids overlays the plexiglass. Blood-agar plates can be adjusted over the grids so that each plate is divided into a total of 100 sectors [10]. Plates used for the genetic analysis of transconjugants include: (i) a plate containing both antibiotics for the resistance marker of the donor genetic element and for the chromosomal resistance marker of the recipient strain; (ii) a plate containing the antibiotic for the resistance marker of the donor genetic element; (iii) a plate containing the antibiotic for the chromosomal resistance marker of recipient strain; and (iv) a plate containing no antibiotics. In the absence of a transilluminator device, naked eye observation is possible, constructing a grid using a Petri dish lid.
  • Confirm the phenotypes of transconjugants by PCR genotyping using primers for the amplification of the ICE-chromosome junctions and for ICE internal region such as the resistance genes.

5. Results

In this work, we report an established plate mating protocol for the conjugal transfer of large ICEs up to 81 kb in streptococci (Streptococcus pneumoniae, Streptococcus agalactiae, Streptococcus gordonii, Streptococcus pyogenes), Enterococcus faecalis, and Bacillus subtilis (Table 1 and Table 2). With this procedure, the transfer of the following genetic elements in the new S. pneumoniae recipients was obtained: (i) S. pneumoniae ICE Tn5253 (size 65 kb) carrying the cat and tet(M) resistance genes [5,11,12], (ii) S. pneumoniae ICE Tn5251 (size 18 kb) carrying the tet(M) [11], (iii) ICESp23FST81-like of S. pneumoniae type 23F genome strain ATCC 700669 (size 81 kb) (conjugation frequency 2.3 × 10−6 transconjugants per donor), and (iv) ICE Tn5253-like (size 81 kb) of S. pneumoniae type 6 genome strain 670–6B (conjugation frequency 2.7 × 10−7 transconjugants per donor). ICE Tn5253 was successfully transferred from the representative transconjugant FR58 to S. pneumoniae strains with different capsular types, S. pyogenes, S. gordonii, S. agalactiae, and transferred back from representative transconjugants of each bacterial species to S. pneumoniae (conjugation frequency varying from 4.4 × 10−7 to 6.7 × 10−3 to transconjugants per donor). ICE Tn5251 is part of the composite S. pneumoniae ICE Tn5253 and uses its highly efficient conjugation machinery to spread among bacterial strains. This conjugation protocol also allows the detection of rare events such as the autonomous transfer of Tn5251, as an independent ICE, from the S. pneumoniae host to E. faecalis [11]. Finally, we applied this protocol to transfer S. pyogenes ϕ1207.3 phage (size 53 kb, carrying the mef (A)-msr (D) macrolide resistance genes [13]), which moves through a mechanism resembling conjugation [14,15,16]. Conjugal transfer from the original 2812A clinical strain to the FP10 recipient occurred at a frequency of 3.8 × 10−5 transconjugants per donor and from the resulting transconjugant FR119 to S. pyogenes SF370 occurred with a frequency of 4.3 × 10−6 transconjugants per donor.

6. Concluding Remarks

In conclusion, the present conjugation protocol, based on plate mating, represents an efficient, low cost and easy-to-perform procedure to transfer large ICEs with a size up to 81 kb among streptococci and enterococci. This protocol allows compliance with much higher transfer frequencies and the transfer of elements that could not be moved using a classical filter mating protocol. Specifically, we obtained: (i) the autonomous transfer of ICE Tn5251 element from S. pneumoniae to E. faecalis (<1.8 × 10−8 transconjugants per donor with the filter mating protocol [17]), and from here among different gram-positive species; (ii) the transfer of the 81 kb ICESp23FST81 element from the original clinical S. pneumoniae type 23 to pneumococcal conjugation recipients (<3.8 × 10−8 transconjugants per donor with the filter mating protocol); and (iii) S. pyogenes ϕ1207.3 phage lysogenic transfer to the S. pneumoniae FP10 recipient with a 5.4 fold increase compared to that obtained with the filter mating protocol.

Author Contributions

Conceptualization, F.I. and G.P.; investigation, F.I., F.S. and V.F.; methodology, F.I., F.S., V.F. and G.P.; validation, F.I., F.S. and G.P.; writing—original draft preparation, F.I. and G.P.; writing—review and editing, F.I., F.S., V.F. and G.P.; visualization, F.I., F.S., V.F. and G.P.; supervision, F.I. and G.P.; project administration, F.I. and G.P.; resources, F.I. and G.P.; funding acquisition, G.P. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Italian Ministry of Education, University and Research (MIUR-Italy) under grant number 20177J5Y3P (call “Progetti di Ricerca di Rilevante Interesse Nazionale—Bando 2017”).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Burrus, V.; Waldor, M.K. Shaping bacterial genomes with integrative and conjugative elements. Res. Microbiol. 2004, 155, 376–386. [Google Scholar] [CrossRef] [PubMed]
  2. Frost, L.; Leplae, R.; Summers, A.; Toussaint, A. Mobile genetic elements: The agents of open source evolution. Nat. Rev. Genet. 2005, 3, 722–732. [Google Scholar] [CrossRef] [PubMed]
  3. Santoro, F.; Iannelli, F.; Pozzi, G. Genomics and Genetics of Streptococcus pneumoniae. Microbiol. Spectr. 2019, 7. [Google Scholar] [CrossRef] [PubMed]
  4. Johnson, C.M.; Grossman, A.D. Integrative and Conjugative Elements (ICEs): What They Do and How They Work. Annu. Rev. Genet. 2015, 49, 577–601. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Santoro, F.; Romeo, A.; Pozzi, G.; Iannelli, F. Excision and Circularization of Integrative Conjugative Element Tn5253 of Strepto-coccus pneumoniae. Front. Microbiol. 2018, 9, 1779. [Google Scholar] [CrossRef] [PubMed]
  6. Santoro, F.; Vianna, M.E.; Roberts, A.P. Variation on a theme; an overview of the Tn916/Tn1545 family of mobile genetic elements in the oral and nasopharyngeal streptococci. Front. Microbiol. 2014, 5, 535. [Google Scholar] [CrossRef]
  7. Burrus, V.; Marrero, J.; Waldor, M.K. The current ICE age: Biology and evolution of SXT-related integrating conjugative elements. Plasmid 2006, 55, 173–183. [Google Scholar] [CrossRef] [PubMed]
  8. Ambroset, C.; Coluzzi, C.; Guédon, G.; Devignes, M.-D.; Loux, V.; Lacroix, T.; Payot, S.; Leblond-Bourget, N. New Insights into the Classification and Integration Specificity of Streptococcus Integrative Conjugative Elements through Extensive Genome Exploration. Front. Microbiol. 2016, 6, 1483. Available online: http://journal.frontiersin.org/Article/10.3389/fmicb.2015.01483/abstract (accessed on 21 July 2021). [CrossRef] [PubMed] [Green Version]
  9. Dahmane, N.; Robert, E.; Deschamps, J.; Meylheuc, T.; Delorme, C.; Briandet, R.; Leblond-Bourget, N.; Guédon, E.; Payot, S. Impact of Cell Surface Molecules on Conjugative Transfer of the Integrative and Conjugative Element ICE St3 of Streptococcus thermophilus. Appl. Environ. Microbiol. 2018, 84. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  10. Iannelli, F.; Pozzi, G. Method for Introducing Specific and Unmarked Mutations into the Chromosome of Streptococcus pneumoniae. Mol. Biotechnol. 2004, 26, 81–86. [Google Scholar] [CrossRef]
  11. Santoro, F.; Oggioni, M.R.; Pozzi, G.; Iannelli, F. Nucleotide sequence and functional analysis of the tet (M)-carrying conjugative transposon Tn5251 of Streptococcus pneumoniae: Tn5251 of Streptococcus pneumoniae. FEMS Microbiol. Lett. 2010, 308, 150–158. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Iannelli, F.; Santoro, F.; Oggioni, M.R.; Pozzi, G. Nucleotide sequence analysis of integrative conjugative element Tn5253 of Strep-tococcus pneumoniae. Antimicrob. Agents Chemother. 2014, 58, 1235–1239. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Iannelli, F.; Santoro, F.; Santagati, M.; Docquier, J.-D.; Lazzeri, E.; Pastore, G.; Cassone, M.; Oggioni, M.R.; Rossolini, G.M.; Stefani, S.; et al. Type M Resistance to Macrolides Is Due to a Two-Gene Efflux Transport System of the ATP-Binding Cassette (ABC) Superfamily. Front. Microbiol. 2018, 9, 1670. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Iannelli, F.; Santagati, M.; Santoro, F.; Oggioni, M.R.; Stefani, S.; Pozzi, G. Nucleotide sequence of conjugative prophage Φ1207.3 (formerly Tn1207.3) carrying the mef(A)/msr(D) genes for efflux resistance to macrolides in Streptococcus pyogenes. Front. Microbiol. 2014, 5, 687. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Pozzi, G.; Iannelli, F.; Oggioni, M.R.; Santagati, M.; Stefani, S. Genetic Elements Carrying Macrolide Efflux Genes in Streptococci. Curr. Drug Target Infect. Disord. 2004, 4, 203–206. [Google Scholar] [CrossRef] [PubMed]
  16. Santagati, M.; Iannelli, F.; Cascone, C.; Campanile, F.; Oggioni, M.R.; Stefani, S.; Pozzi, G. The Novel Conjugative Transposon Tn1207.3 Carries the Macrolide Efflux Gene mef(A) in Streptococcus pyogenes. Microb. Drug Resist. 2003, 9, 243–247. [Google Scholar] [CrossRef] [PubMed]
  17. Provvedi, R.; Manganelli, R.; Pozzi, G. Characterization of conjugative transposon Tn5251 of Streptococcus pneumoniae. FEMS Microbiol. Lett. 1996, 135, 231–236. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Schematic representation of the plate mating protocol for ICEs conjugal transfer in streptococci and enterococci.
Figure 1. Schematic representation of the plate mating protocol for ICEs conjugal transfer in streptococci and enterococci.
Mps 04 00059 g001
Table 1. ICEs conjugal transfer frequencies obtained with the plate mating protocol in streptococci and enterococci.
Table 1. ICEs conjugal transfer frequencies obtained with the plate mating protocol in streptococci and enterococci.
Donor Strain
(Properties)
ICE
(Size)
Recipient Strain
(Properties)
Transfer Frequency aGenetic Analysis of Transconjugants(Primer Pairs) bRef.
attL–attTnattR–attTn)tet(M)cat
S. pneumoniae FR22
(FP10 transconjugant derivative, laboratory strain)
Tn5253
(65-kb)
S. pneumoniae FP11
(rough laboratory strain)
1.6 × 10−4 ± 1.6 × 10−5IF325-IF327IF328-IF356IF394-IF564IF353-IF354[11]
S. pneumoniae FP47
(TIGR4 derivative, type 4 clinical strain)
3.6 × 10−5 ± 1.7 × 10−6IF325-IF327IF328-IF356IF394-IF564IF353-IF354[11]
S. agalactiae H36B
(Ib clinical strain)
3.8 × 10−6 ± 5.3 × 10−7IF560-IF327IF328-IF561IF394-IF564IF353-IF354[11]
S. gordonii GP204
(V288 derivative, laboratory strain)
2.5 × 10−5 ± 5.5 × 10−6IF512-IF327IF328-IF513IF394-IF564IF353-IF354[11]
S. pyogenes SF370
(M1 clinical strain)
8.2 × 10−6 ± 7.5 × 10−7IF509-IF327IF328-IF510IF394-IF564IF353-IF354[11]
E. faecalis OG1RF
(clinical strain)
5.4 × 10−6 ± 5.5 × 10−7IF532-IF327IF328-IF525IF394-IF564IF353-IF354[11]
E. faecalis JH2-2
(clinical strain)
8.6 × 10−7 ± 8.8 × 10−8IF532-IF327IF328-IF525IF394-IF564IF353-IF354[11]
S. pneumoniae 670-6B
(type 6 clinical strain)
Tn5253-like
(81-kb)
S. pneumoniae FP112.7 × 10−7 ± 8.1 × 10−8IF325-IF327IF328-IF356IF394-IF564IF353-IF354This study
S. pneumoniae ATCC700699
(type 23F clinical strain)
ICESp23FST81
(81-kb)
S. pneumoniae FP112.3 × 10−6 ± 1.0 × 10−6IF345-IF855IF327-IF347IF394-IF564IF353-IF354This study
S. pneumoniae FR58
(FP11 transconjugant derivative)
Tn5253
(65-kb)
S. pneumoniae FP58
(D39 derivative, type 2 clinical strain)
1.9 × 10−5 ± 4.6 × 10−6IF325-IF327IF328-IF356IF394-IF564IF354-IF353[12]
S. pneumoniae HB394
(A66 derivative, type 3 clinical strain)
4.4 × 10−7 ± 3.6 × 10−8IF325-IF327IF328-IF356IF394-IF564IF354-IF353[12]
S. pneumoniae FR55
(SP18-BS74 derivative, type 6 clinical strain)
1.3 × 10−5 ± 2.8 × 10−6IF325-IF327IF328-IF356IF394-IF564IF354-IF353[12]
S. agalactiae FR67
(H36B transconjugant derivative)
Tn5253
(65-kb)
S. pneumoniae FP111.1 × 10−6 ± 3.5 × 10−7IF325-IF327IF328-IF356IF394-IF564IF354-IF353[12]
S. gordonii FR43
(GP204 transconjugant derivative)
Tn5253
(65-kb)
S. pneumoniae FP118.3 × 10−7 ± 2.9 × 10−7IF325-IF327IF328-IF356IF394-IF564IF354-IF353[12]
S. pyogenes FR40
(SF370 transconjugant derivative)
Tn5253
(65-kb)
S. pneumoniae FP116.7 × 10−3 ± 1.0 × 10−3IF325-IF327IF328-IF356IF394-IF564IF354-IF353[12]
S. pneumoniae FR22Tn5151
(18-kb)
S. pneumoniae FP471.5 × 10−6 ± 1.2 × 10−8 IF394-IF564 [11]
E. faecalis OG1RF5.4 × 10−6 ± 5.5 × 10−7 IF394-IF564 [11]
E. faecalis JH2-28.6 × 10−7 ± 8.8 × 10−8 IF394-IF564 [11]
S. gordonii FR70
(GP204 transconjugant derivative)
Tn5151
(18-kb)
S. pneumoniae FP113.1 × 10−7 ± 1.9 × 10−7 IF394-IF564 [11]
S. pyogenes FR71
(SF370 transconjugant derivative)
Tn5151
(18-kb)
S. pneumoniae FP113.3 × 10−5 ± 1.3 × 10−5 IF394-IF564 [11]
E. faecalis FR64
(OG1RF transconjugant derivative)
Tn5151
(18-kb)
S. gordonii GP2044.8 × 10−5 ± 8.5 × 10−6 IF394-IF564 [11]
S. pyogenes SF3709.1 × 10−7 ± 2.8 × 10−7 IF394-IF564 [11]
E. faecalis OG1SS
(clinical strain)
1.3 × 10−6 ± 3.9 × 10−7 IF394-IF564 [11]
B. subtilis 168
(laboratory strain)
1.6 × 10−6 ± 5.1 × 10−7 IF394-IF564 [11]
S. pneumoniae FR73
(FP47 transconjugant derivative)
Tn5151
(18-kb)
S. pneumoniae FP22
(rough D39 derivative )
2.6 × 10−8 ± 8.9 × 10−9 IF394-IF564 [11]
S. pneumoniae FP23
(rough TIGR4 derivative)
1.2 × 10−7 ± 6.1 × 10−8 IF394-IF564 [11]
S. pyogenes 2812A
(clinical strain)
Φ1207.3
(53-kb)
S. pneumoniae FP103.8 × 10−5 ± 7.6 × 10−6IF281-IF127IF162-IF282 This study
S. pneumoniae FR119
(FP10 transconjugant derivative)
Φ1207.3
(53-kb)
S. pyogenes SR300
(SF370 derivative strain)
4.3 × 10−6 ± 1.1 × 10−6IF302-IF127IF162-IF303 This study
a Conjugation frequency is expressed as CFU of transconjugants per CFU of donor. The results are presented as the mean of at least 3 mating experiments. b Transconjugants are selected for acquisition of antibiotic resistance and their genotype characterized by PCR. The presence of the attL–attTn junction, attR–attTn junction, tet(M) and cat was investigated in the transconjugants carrying Tn5253-family elements. Due to the unspecific integration of Tn5251 into the bacterial chromosome, the presence of tet(M) was investigated in the transconjugants carrying the element. Primers sequences are reported in Table 2.
Table 2. PCR oligonucleotide primers for transconjugants genotyping.
Table 2. PCR oligonucleotide primers for transconjugants genotyping.
NameSequence (5′ to 3′)Target (Bacterial Species)Direction
IF327
IF328
CAATATAGCGTGATGATTGTAAT
AGTGAGAATCAAATCAGAGGTT
5’ end of Tn5253, Tn5253-like
3’ end of Tn5253, Tn5253-like
Reverse
Forward
IF325
IF356
ACAAGAACTGTTTGGACATCAT
GACTAGATAGAGGCAAGCGT
Tn5253, Tn5253-like chromosomal integration site (S. pneumoniae)Forward
Reverse
IF560
IF561
AACGAAACCTATCAGCGGAA
TTTGGGTTTGTCTCCGACGA
Tn5253, Tn5253-like chromosomal integration site (S. agalactiae)Forward
Reverse
IF512
IF513
TGCTTTAGGAGATGTTGAGTT
ACCGCAGACTGTTCTTTAGA
Tn5253, Tn5253-like chromosomal integration site (S. gordonii)Forward
Reverse
IF509
IF510
AAGTAGAAATGGCGAAGTGAA
GACTAGAAAGTGGTAAGCGT
Tn5253, Tn5253-like chromosomal integration site (S. pyogenes)Forward
Reverse
IF532
IF525
GCCTATGGGATTGCTACACC
GGTTACGGGAAGAAAGCGGT
Tn5253, Tn5253-like chromosomal integration site (E. faecalis)Forward
Reverse
IF855
IF327
ACCAAATTCCTGCCAGAGTTGA
CAATATAGCGTGATGATTGTAAT
5’ end of ICESp23FST81
3’ end of ICESp23FST81
Reverse
Forward
IF345
IF347
ATGGTAATCATCTAAAAATGTCAC
CACCAGCACTTGTTAAAGAAG
ICESp23FST81chromosomal
integration site (S. pneumoniae)
Forward
Reverse
IF394
IF564
GCTATAGTATAAGCCATACTT
GAAGTGACTTGTGCTCTGCT
Tn5253-family tet (M) resistance geneForward
Reverse
IF354
IF353
CATTCTCTGGTATTTGGACTC
CTCTCCGTCGCTATTGTAAC
Tn5253-family cat resistance geneForward
Reverse
IF127
IF162
TGTTCTTCATCTACTACGACTG
TGATGATTATATAAATTGTGAGTT
5’ end of Φ1207.3
3’ end of Φ1207.3
Reverse
Forward
IF281
IF282
AGGTGGTAAGGCAGAATC
GCACCTTTGTTTGAGTCG
Φ1207.3 chromosomal
integration site (S. pneumoniae)
Forward
Reverse
IF302
IF303
AATAGATGTAGGTGGGCG
AGCTTTGGCAACCACTTC
Φ1207.3 chromosomal
integration site (S. pyogenes)
Forward
Reverse
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Iannelli, F.; Santoro, F.; Fox, V.; Pozzi, G. A Mating Procedure for Genetic Transfer of Integrative and Conjugative Elements (ICEs) of Streptococci and Enterococci. Methods Protoc. 2021, 4, 59. https://doi.org/10.3390/mps4030059

AMA Style

Iannelli F, Santoro F, Fox V, Pozzi G. A Mating Procedure for Genetic Transfer of Integrative and Conjugative Elements (ICEs) of Streptococci and Enterococci. Methods and Protocols. 2021; 4(3):59. https://doi.org/10.3390/mps4030059

Chicago/Turabian Style

Iannelli, Francesco, Francesco Santoro, Valeria Fox, and Gianni Pozzi. 2021. "A Mating Procedure for Genetic Transfer of Integrative and Conjugative Elements (ICEs) of Streptococci and Enterococci" Methods and Protocols 4, no. 3: 59. https://doi.org/10.3390/mps4030059

APA Style

Iannelli, F., Santoro, F., Fox, V., & Pozzi, G. (2021). A Mating Procedure for Genetic Transfer of Integrative and Conjugative Elements (ICEs) of Streptococci and Enterococci. Methods and Protocols, 4(3), 59. https://doi.org/10.3390/mps4030059

Article Metrics

Back to TopTop