Effects of 1-Methylcyclopropene Treatment on the Quality and Malic Acid Metabolism of ‘Xiangjiao’ Plum under Low-Temperature Storage

Abstract

‘Xiangjiao’ plum (Prunus salicina Lindl.) is a stone fruit that is vulnerable to the chilling injury (CI) that is caused by low-temperature stress. The effects of 1-methylcyclopropene (1-MCP) and ethylene absorbent (EA) treatments on the fruit quality and malic acid metabolism of ‘Xiangjiao’ plum stored at 4 °C were compared in this study. Compared with the control check (CK) and EA treatment, fumigation with 1.0 mg·L⁻¹ of 1-MCP for 24 h could more significantly maintain the sensory and physiological quality of the fruit, increase the activity of antioxidant enzymes, and prolong the storage time of plums. Furthermore, 1-MCP treatment can regulate the high expression of the tonoplast dicarboxylate transporter (tDT) and phosphoenolpyruvate carboxylase (PEPC) gene, regulate the high expression of the NAD-malate dehydrogenase (NAD-MDH) gene at the end of storage, and inhibit the expression of the NADP-malic enzyme (NADP-ME) gene. These changes resulted in increased NAD-MDH enzyme activity and decreased NADP-ME enzyme activity, which inhibited the degradation of malic acid that is caused by CI. As a result, 1-MCP can effectively maintain the storage quality of ‘Xiangjiao’ plum, reduce the loss of pleasant sour taste, and improve the edible flavor and commercial value of the fruit.

1. Introduction

‘Xiangjiao’ plum is a favored variety of cinnabar plum (Prunus salicina Lindl.) that has been cultivated for over 40 years in China. Plum pulp has a soft texture and a mildly acidic taste. Rich in vitamin C and vitamin E, plum is effective at removing free radicals, protecting the skin from ultraviolet damage, promoting skin whitening, and reducing the appearance of spots. Proper consumption of plums can promote human health [1]. Currently, the most important method for prolonging the storage life of plum fruit is low-temperature storage. Plum is a stone fruit and is susceptible to low-temperature stress, which leads to CI [2]. CI usually manifests as physiological and pathological symptoms, such as browning and necrosis of the plum peel, reddening of the pulp, and local water stains [3]. Low-temperature stress will decrease the disease resistance and storage tolerance of plums; reduce the fruit’s sour taste; cause a loss of flavor and continuous deterioration of quality; and ultimately decrease the commodity value [4,5].

Under low-temperature stress, a significant accumulation of reactive oxygen species (ROS) free radicals occurs in plant cells, which leads to increased membrane peroxidation and altered membrane integrity [6]. These changes in the membrane cause increased cell membrane permeability and massive ion leakage, which further lead to abnormal physiological phenomena, loss of metabolic function, and extensive cell death in plant tissues [7,8]. Moreover, low-temperature stress also results in a series of irreversible cell damage, such as cell membrane decomposition, protein degradation, enzyme inactivation, and DNA and RNA strand breakage [9]. However, the antioxidant enzymes that are present in fruit can act as an enzymatic scavenging system for ROS, and they play a crucial role in reducing oxidative damage. For instance, superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) are important antioxidant enzymes in fruit [10].

An adequate acidity level is a crucial factor that determines the sensory properties and palatability of fruit. A previous study has shown that malic acid dominates the content of organic acids in plums [11,12]. Figure 1 shows the main metabolic pathway of malic acid in ‘Xiangjiao’ plum [13]. The synthesis of malic acid is co-regulated by PEPC (EC 4.1.1.31 and NAD-MDH (EC 1.1.1.37), while NADP-ME (EC 1.1.1.40) is involved in the degradation of malic acid [14]. The metabolism of malic acid primarily takes place in the cytoplasm, where phosphoenolpyruvate (PEP) is converted into oxaloacetic acid (OAA) by PEPC, which is then catalyzed and reduced to malic acid by NAD-MDH. Finally, malic acid is broken down to pyruvate by NADP-ME [15]. The transport of malic acid between the vacuoles and cytoplasm is facilitated by tDT [16], which has also been identified in grapes as a homologous gene that is involved in malic acid transportation [17].

1-MCP is an ethylene inhibitor that can effectively reduce the sensitivity of ethylene by blocking the ethylene receptor, thereby inhibiting the ripening effect of ethylene during post-harvest fruit ripening [18]. Compared with the traditional EA treatment, 1-MCP is non-toxic, odorless, and safe for human health, making it a widely recognized and excellent ethylene inhibitor and fruit storage reagent [19]. 1-MCP treatment can reduce the metabolic rate of acid substances in medlar fruit and delay quality deterioration during shelf life [20]. However, few studies have investigated the effects of 1-MCP and EA treatment on the malic acid content and related metabolic enzymes. Therefore, this study aimed to investigate the effects of 1-MCP treatment on the quality and malic acid metabolism of ‘Xiangjiao’ plum under low-temperature stress and explore the molecular mechanism of regulating the malic acid metabolism using 1-MCP treatment in order to maintain good flavor and quality in ‘Xiangjiao’ plums.

2. Materials and Methods

2.1. Fruit Material and Treatments

Approximately 70% ripe ‘Xiangjiao’ plums (having a greenish-yellow color and moderate fruit hardness) were selected for subsequent experiments. The plums were harvested from a farm orchard located in Shenyang, Liaoning, China (geographical coordinates: 41°48′ N, 123°25′ E). The harvested fruit was immediately placed in plastic boxes and transported within 2 h to the laboratory of Shenyang Agricultural University. Upon arrival, the fruit was spread on newspapers and stored at room temperature (20 ± 2 °C) for 2 h to remove field heat. Subsequently, the plums were randomly divided into three groups: (1) fumigated with 1.0 mg·L⁻¹ of 1-MCP for 24 h; (2) treated using EA (the main component of which was potassium permanganate at 10 g per bag); and (3) CK. Approximately 540 fruit in each group were evenly distributed into 27 polyvinyl chloride (PVC) bags (0.3 mm) and stored at 4 °C. Three bags of ‘Xiangjiao’ plums were taken from each treatment every 5 days for indicator determination. Furthermore, each indicator has been repeatedly measured in triplicates.

2.2. Determination of CI Index

Under the influence of CI, the fruit peel shows varying degrees of water-soaked spots and brown spots. In addition, the pulp of the fruit undergoes browning, dehydration, fibrosis, and even internal tissue decay and deterioration. According to previous methods, the degree of fruit damage was divided into 4 levels [21]: Grade 0 means no CI; Grade 1 means the area of CI spots < 1/10 of the fruit and that there is a mild browning of the fruit flesh; Grade 2 means the area of CI spots accounts for 1/10–1/3 of the fruit surface and that there is a moderate browning of the fruit flesh; Grade 3 means the area of CI spots accounts for 1/3–2/3 of the fruit surface and that there is a severe browning of the fruit flesh; and Grade 4 means the area of CI spots > 2/3 of the fruit surface and that there is rotting fruit flesh.

$$\begin{gathered} CI\hspace{0.17em}index\hspace{0.17em}(\%)=\sum \left[\right(CI\hspace{0.17em}grade)\times (number\hspace{0.17em}of\hspace{0.17em}fruit\hspace{0.17em}in\hspace{0.17em}this\hspace{0.17em}grade\left)\right]/(highest\hspace{0.17em}grade \\ \times total\hspace{0.17em}number\hspace{0.17em}of\hspace{0.17em}fruit\hspace{0.17em}in\hspace{0.17em}the\hspace{0.17em}treatment)\times 100. \end{gathered}$$

(1)

2.3. Determination of Sensory and Physiological Quality Indicators

The hardness was measured using a CT3 texture analyzer (Brookfield, WI, USA) and a TA-MTP (Magness–Taylor probe) (Brookfield, WI, USA). For each fruit, we took three vertices of the equilateral triangle on the transverse line as parallel test points for the experimental analysis, and we recorded the test results. The trigger point load was 0.07 N and the test speed was 1 mm/s.

The weight loss rate was measured using the weighing method.

$$Weight\hspace{0.17em}loss\hspace{0.17em}rate\left(\%\right)=(Initial\hspace{0.17em}weight-Plum\hspace{0.17em}weight\hspace{0.17em}in\hspace{0.17em}different\hspace{0.17em}storage\hspace{0.17em}periods)/Initial\hspace{0.17em}weight\times 100$$

(2)

The soluble solids content (SSC) was measured using an ATAGO PAL-1 digital sugar meter (Tokyo, Japan).

The titratable acid content was determined by using a sodium hydroxide titration combined with a potentiometric titration of fruit acidity. Diagonal pulp (5 g) was ground into homogenate in an ice bath. The pulp was homogenized and transferred to a 50 mL volumetric flask with ultrapure water. After standing for 30 min, the pulp was filtered using gauze. The filtrate was 20 mL, and 2 drops of phenolphthalein were added to gently shake the filtrate. The solution was titrated using 0.01 mol L⁻¹ of NaOH until reaching a pH of 8.3.

The respiratory intensity was measured using a gas composition analyzer (PBI Dansensor, Ringsted, Denmark). We selected one in every 20 fruit (about 1 kg) and placed them in a 4600 mL lock box, allowing it to stand for 1 h. The CO₂ gas content in the lock box was recorded. The unit of respiratory intensity is mL·kg⁻¹·h⁻¹.

The relative electrical conductivity and malondialdehyde (MDA) were determined according to the previous method [22]. Fruit slices cut into 2 mm were soaked in ultrapure water for about 20 min. The conductivity values before and after boiling them for 20 min were measured and recorded as E₀ and E₁, respectively.

$$Relative\hspace{0.17em}electrical\hspace{0.17em}conductivity(\%)=E_0/E_1\times 100$$

(3)

The fruit (2 g) was mixed with thiobarbituric acid (2 mL) and centrifuged for 10 min. After being subjected to 20 min of thermal treatment, we centrifuged the fruit for 10 min and measured the absorbance at 450 and 532 nm.

$$MDA\left(\mathrm{n}\mathrm{m}\mathrm{o}\mathrm{l}·{\mathrm{g}}^{-1}\right)=6450\times A_{532}-560\times A_{450}$$

(4)

2.4. Determination of Antioxidant Enzyme Activity

The measurement of SOD, POD, and CAT activities was conducted in accordance with a previous method [23]. Fruit (5 g) was ground to a homogenate by grinding with 10 mL of phosphate buffer (25 mM, pH 7.8). The homogenate was washed with 3 mL of phosphate buffer and centrifuged at 4 °C for 20 min. The enzyme solution was stored at 0–4 °C for use.

The SOD reaction mixture consisted of 50 mM of phosphate buffer with a pH of 7.8; 13 mM of methionine (Met); 75 μM of tetrazolium blue (NBT); 10 μM of EDTA-Na₂; 2 μM of riboflavin; and 0.1 mL of enzyme extract. The mixture was exposed to 4000 lux light for 30 min, and the absorbance was then measured at 560 nm and 25 °C. A dark-stored identical solution served as a blank for comparison.

$$SOD\hspace{0.17em}activity\hspace{0.17em}(\mathrm{U}/\mathrm{g}\mathrm{F}\mathrm{W})=(A_{CK}-A_E)\times V/(W\times V_t\times 0.5\times A_{CK}).$$

(5)

In Equation (5), $W$ is the sample fresh weight (g), $A_{CK}$ is the absorbance of the blank control, $A_E$ is the absorbance of the sample, $V$ is the volume of the reaction mixture solution (mL), and $V_t$ is the volume of enzyme solution (mL).

The reaction mixture of POD was composed of 100 mM of pH 6.4 phosphate buffer, 8 mM of guaiacol, and 0.5 mL of enzyme extract. The reaction solution was placed in a pre-adjusted 37 °C water bath for more than 5 min, and we then added 1 mL of H₂O₂ (24 mM). The absorbance was measured at 460 nm every 30 s for 120 s.

$$POD\hspace{0.17em}activity\hspace{0.17em}(\mathrm{U}/\mathrm{g}\mathrm{F}\mathrm{W})=(\mathsf{\Delta }{A}_{470}\times V)/(W\times V_t\times 0.01\times t).$$

(6)

In Equation (6), $\mathsf{\Delta }{A}_{470}$ is the change in absorbance in the reaction time and $t$ is the reaction time (min).

The reaction mixture of CAT was composed of 2 mL of phosphate buffer (50 mM, pH 7.0), 0.5 mL of H₂O₂ (40 mM), and 0.5 mL of enzyme extract. The absorbance was measured at 240 nm and 25 °C.

$$CAT\hspace{0.17em}activity\hspace{0.17em}(\mathrm{U}/\mathrm{g}\mathrm{F}\mathrm{W})=(\mathsf{\Delta }{A}_{240}\times V)/(W\times V_t\times 0.01\times t)$$

(7)

2.5. Determination of Malic Acid Content

The samples were ground and mixed with 6 mL of 80% ethanol. The mixture was centrifuged for 15 min and repeated twice, where it was combined with the all supernatant volume to total 25 mL. The constant volume extract was dried and evaporated to ethanol at 70 °C and then transferred into a colorimetric tube containing 40 μL of phosphoric acid (1 M) at a constant volume of 10 mL. The extracted organic acids were diluted 4 times and filtered with a 0.45 μM filter membrane for HPLC processing. The column used was a Hypersil ODS column with a particle size of 5 μM and the dimensions of 4.0 mm × 250 mm; the column temperature was 25 °C.

2.6. Determination of Enzyme Activity Related to Malic Acid Metabolism

The enzyme activity determination used the method of Kou et al. [24]. The sample (2 g) was mixed with a grinding buffer (3 mL) containing 10 mM of ascorbic acid, 200 mM of Tris-HCl, and 600 mM of pH 8.2 sucrose. The mixture was ground with liquid nitrogen and centrifuged at 4 °C for 20 min. The supernatant was diluted to 5 mL with grinding buffer, and the solution (3 mL) was mixed with 3 mL of extraction buffer (0.1% Triton X-100, 10 mM of ascorbic acid, and 200 mM of pH 8.2 Tris-HCl). The determination system (3 mL) was mixed with the reaction substrate. The absorbance of the mixture was measured using an ultraviolet spectrophotometer (UV-2450) at 340 nm, and the change was recorded. The reading unit was 1 s, and the scanning time was 3 min.

2.7. Determination of Crucial Enzyme Gene Expression in the Malic Acid Metabolism

After the 1-MCP and EA treatments, the gene expression of NAD-MDH, NADP-ME, PEPC, and tDT was measured at 4 °C. The OminiPlant RNA kit (Cowin Biosciences, Beijing, China) was used to extract the total RNA. The cDNA synthesis was performed using a HiFiScript cDNA kit (Beijing ComWin Biotechnology Co., Ltd., Beijing, China), and the reverse transcription cDNA concentration was set to 10 ng·μL⁻¹.

The homology between plum and peach is highly homologous, up to 98% [13]. Therefore, this experiment found the peach trees gene sequence in the NCBI database, Prunus persica NAD-MDH (AF367442.1), Prunus persica NADP-ME (XM007210922.2), Prunus persica PEPC (XM007214924.2), and Prunus persica tDT (XM007211480.2). Among the high homology of the ‘Xiangjiao’ plum, the highly conserved regions of peach trees were designed with degenerate primers using Primer Premier 5.0, as shown in

Table 1. Primer sequence design for the real-time q-PCR of key enzyme genes of the malic acid metabolism.

Gene	Upstream Primer (5′–3′)	Downstream Primer (5′–3′)	Product Length (bp)
NADP-ME	TGCTTGCTTGCCTGTAAC	TCCTGTCCAGTAGCCCTC	102
NAD-MDH	TCCTTGTTACTGGAGCCG	AGAGGGAAAGCAGCATCG	172
PEPC	CACTCCAGCGTTTCACAG	GGACGACTCCCAATGTTC	199
tDT	CTGGCAGTGCTTGTTTGG	TGGATCTCCGCAGAATAG	249
18S	GTTACTTTTAGGACTCCGCCA	ATTCCTTTAAGTTTCAGCCTTG	97

. The known 18S sequences of peach trees were sent to GENEWIZ Biotechnology Co., Ltd. (Plainfield, NJ, USA), to synthesize the primers.

The quantitative fluorescence PCR was analyzed according to an Ultra SYBR Mixture kit (Beijing ComWin Biotechnology Co., Ltd.). The relative gene expression was determined using the 2^−ΔΔCτ method.

2.8. Statistical Analysis

The results were presented as the means ± SD of three independent replicates. The statistical analysis was performed using a one-way analysis of variance (ANOVA) with Duncan’s multiple comparisons test in SPSS 13.0 software (SPSS Inc., Chicago, IL, USA). The results were considered statistically significant at p < 0.05.

3. Results

3.1. CI Index

At 15 d, the CK exhibited noticeable CI, while the ‘Xiangjiao’ plum that was subjected to the two treatments remained unaffected (Figure 2). From the period of 15 to 40 d, the CI index of the CK rapidly increased, reaching its peak at 93.48% at 40 d. Notably, the CI index of the treatments were markedly lower than the CK (p < 0.01), and at 40 d, the 1-MCP treatment resulted in a substantially lower CI compared with the EA treatment (p < 0.01). This outcome suggests that the 1-MCP treatment is more effective than EA treatment in alleviating CI.

3.2. Sensory and Physiological Quality Indicators

Throughout the storage period, the plum’s hardness gradually decreased (Figure 3A). The hardness of the plums treated with 1-MCP and EA rapidly decreased from 0 to 5 d, followed by a slower decline; however, it remained at a high level overall. The weight loss of the plums was not substantial at 4 °C (Figure 3B). Compared with the CK, the 1-MCP and EA treatments showed a lower rate of weight loss. When comparing the two treatments, the 1-MCP treatment displayed better water retention and a lower rate of weight loss. The SSC content at 4 °C remained stable with slight fluctuations from 0 to 30 d, increased from 30 to 35 d, and then rapidly decreased. The peak value of SSC in the three groups all appeared at 35 d, which also proved that the plums were basically ripe. The SSC content of ‘Xiangjiao’ plums treated with 1-MCP could reach 13.7% at 35 d, which was significantly higher than the EA and CK conditions. This result indicated that 1-MCP treatment could effectively delay the decrease in the SSC of plums. As shown in Figure 3D, the respiratory intensity of the plum increased overall. The use of 1-MCP maintained a lower level of post-harvest respiration and had a certain inhibitory effect on the respiration peak. Compared with the CK and EA treatment, the 1-MCP treatment significantly delayed the decrease in titratable acid content in the ‘Xiangjiao’ plum and maintained a higher level during the later stages of storage (Figure 3E). The pH of the ‘Xiangjiao’ plum was significantly negatively correlated with its titratable acid content (Figure 3F) (r = −0.87, p < 0.01). From 25 to 40 d, the pH of the ‘Xiangjiao’ plums treated with EA and CK was significantly higher than that of the 1-MCP treatment. The stability of the pH in the fruit cells is critical for maintaining the fruit’s biosynthesis state and normal post-harvest physiological changes. Therefore, it was further demonstrated that the ‘Xiangjiao’ plum treated with 1-MCP performed better in terms of its sensory indicators. A significant amount of electrolyte leakage in plant cells is a crucial sign of membrane system damage, which is reflected by changes in the relative electrical conductivity. Compared with the CK and EA conditions, the relative electrical conductivity of the plum treated with 1-MCP increased more slowly, which indicated that the cell membrane of the plum treated with 1-MCP was more complete (Figure 3G). As shown in Figure 3H, 1-MCP significantly inhibited the accumulation of MDA and effectively alleviated the aggravation of membrane lipid peroxidation, indicating that it can protect the cell membrane and reduce the fruit’s CI symptoms.

3.3. Antioxidant Enzyme Activity

The SOD activity of ‘Xiangjiao’ plums stored at 4 °C exhibited a trend of an increase followed by decrease (Figure 4A). Peak SOD activity was observed at 20 d for both the 1-MCP and EA treatments, with values of 65.57 U·g⁻¹ FW and 60.10 U·g⁻¹ FW, respectively. In contrast, the CK had the highest SOD activity at 15 d with a value of 56.31 U·g⁻¹ FW. The SOD activity of the 1-MCP treatment was higher than the EA treatment (p < 0.05) and the CK (p < 0.01) from 15 to 40 d, which indicates that the 1-MCP treatment maintained SOD activity and alleviated CI better in ‘Xiangjiao’ plums.

The POD activity of ‘Xiangjiao’ plums stored at 4 °C initially exhibited a rising trend followed by a subsequent decrease (Figure 4B). The POD activity initially increased in response to low temperature but rapidly decreased after 15 days, which reduced the capability of active oxygen elimination. From 10 to 40 d, both treatment groups had significantly higher POD activity than the CK (p < 0.01), indicating that both the 1-MCP and EA treatments effectively maintained POD activity; however, the 1-MCP treatment was more effective.

CAT, a well-known enzyme in the antioxidant enzyme protection system, had a similar trend of change to POD (Figure 4C). The CAT activity of the CK was significantly lower than the treatments (p < 0.01), and the 1-MCP treatment was more effective than the EA treatment (p < 0.05) in maintaining the CAT activity. This result suggests that both the 1-MCP and EA treatments can maintain CAT activity, but the 1-MCP treatment is a more effective method for it.

3.4. Malic Acid Content

It can be observed in Figure 5A that the primary organic acid in ‘Xiangjiao’ plums was malic acid, followed by oxalic acid, citric acid, and succinic acid; however, their contents were relatively small. The malic acid content of ‘Xiangjiao’ plums gradually decreased at 4 °C (Figure 5B). The malic acid content of ‘Xiangjiao’ plums treated with 1-MCP remained relatively stable from 0 to 25 d and peaked at 2.62 mg·mL⁻¹ at 30 d, which was higher than the levels observed in the EA treatment (p < 0.05) and CK condition (p < 0.01). The CK showed a significant increase in malic acid content at 15 d, which coincided with the occurrence of CI. Compared with the EA treatment, the 1-MCP treatment effectively slowed down the degradation of malic acid and maintained its content.

3.5. Malic Acid Metabolism-Related Enzyme Activity

In Figure 6A, it is evident that the activity of NADP-ME in ‘Xiangjiao’ plums treated with 1-MCP at 4 °C from 5 to 40 d was lower than that of the CK (p < 0.01) and EA conditions (p < 0.05). A strong inverse correlation was found between the malic acid content and the NADP-ME activity during the 1-MCP treatment (r = −0.788, p < 0.01). This result suggested that 1-MCP treatment can effectively prevent the degradation of malic acid by reducing the activity of NADP-ME, thereby maintaining the malic acid level.

Regarding NAD-MDH activity during the peak period, the order was as follows: CK > 1-MCP treatment > EA treatment. The peak appearance time was as follows: CK > EA treatment > 1-MCP treatment (Figure 6B). However, there was no substantial association between the malic acid concentration and the NAD-MDH activity under the 1-MCP treatment based on the correlation analysis (r = 0.325, p > 0.05). This result indicated that the regulation of malic acid content by the 1-MCP treatment is not mainly performed through NAD-MDH.

3.6. Gene Expression of Malic Acid Metabolism-Related Enzyme

The presentation of the NADP-ME gene was up-regulated from 15 to 25 d and down-regulated from 25 to 40 d using the 1-MCP treatment, which was considerably lower than the EA and CK conditions (p < 0.01) (Figure 7A). This result suggested that 1-MCP may more effectively decrease NADP-ME activity by inhibiting NADP-ME gene expression and by postponing the reduction of malic acid content.

The expression of the NAD-MDH gene when treated with 1-MCP was up-regulated at 10 d; the expression level was at the same level from the period of 10 to 25 d, and it was significantly up-regulated at 30 d (Figure 7B). The relative expression reached 7.99, which was substantially higher than the CK (p < 0.05) and EA conditions (p < 0.01). Both the EA and 1-MCP treatments increased the expression of the NAD-MDH gene.

The PEPC gene expression was up-regulated and then down-regulated by using the 1-MCP treatment (Figure 7C). The expression of the PEPC gene at 15 and 25 d was significantly higher than the EA (p < 0.05) and CK (p < 0.01) conditions. The PEPC gene was positively associated with the malic acid content and NAD-MDH activity but negatively associated with the NADP-ME activity. This result indicated that synergistic 1-MCP treatment with a high expression of the PEPC gene under cold stress improved the expression of the NAD-MDH gene, which regulated the synthesis of malic acid and delayed the decline of its content.

In Figure 7D, the tDT gene in the 1-MCP treatment was positively correlated with the PEPC and NAD-MDH genes, whereas it was negatively correlated with NADP-ME. At the end of the storage, the relative expression of genes decreased, which was possibly due to abnormal cell membrane deformation pressure that caused the transportation of protein to deform or fall off at lower temperatures. This outcome showed that 1-MCP treatment could cause a high expression of the tDT gene in ‘Xiangjiao’ plums under cold stress and that the high expression of PEPC and NAD-MDH gene increased the activity of NAD-MDH, which regulated the synthesis of malic acid and delayed the decline in malic acid content.

4. Discussion

The storage of fresh plums is crucial for their post-harvest life and commercial success. Previous studies have shown that low temperature (5 °C) helps to prolong the storage time of plums but will cause low-temperature stress effects [25]. Similarly, when litchi fruit was stored at 3–5 °C for 20 d, the fruit showed symptoms of CI, such as browning plaques on the peel, and the visual acceptance significantly decreased [26]. To mitigate these effects, 1-MCP treatment has been shown to effectively maintain the sensory and physiological quality of fruit during storage while reducing the incidence of CI. Cheng et al. [27] showed that 1-MCP could reduce the occurrence of CI in jujube fruit and increase the activity of key enzymes in the antioxidant system; it has also been verified in fruit such as green banana [28], kiwifruit [29], sweet persimmon [30], pomegranate [31], apple [32], and peach [33]. In this study, low-temperature stress effects were observed in ‘Xiangjiao’ plums stored at 4 °C at 15 d in the control group (CK). Compared with EA treatment, the 1-MCP treatment was more effective at alleviating CI and maintaining the storage quality of plum. Specifically, 1-MCP treatment significantly reduced the CI index and weight loss rate while maintaining the hardness, soluble solids content, and titratable acid content. Additionally, 1-MCP treatment inhibited the peak of respiration, relative electrical conductivity, and accumulation of MDA at 4 °C. Furthermore, 1-MCP can reduce the degradation of SOD, POD, and CAT; remove reactive oxygen species; and prevent membrane lipid peroxidation.

CI was observed in the CK after 15 days of storage, and the malic acid content rapidly declined after the onset of CI, suggesting a correlation between CI and the rapid degradation of malic acid. This finding is consistent with previous research [34,35]. At the end of the storage, the malic acid content was approximately 1.5 times higher in the 1-MCP treatment group than in the CK group. The degradation trend of malic acid was alleviated, and the occurrence of CI was inhibited by the 1-MCP treatment.

The results demonstrated that the content of malic acid in plum is linked to enzymes such as NADP-ME, NAD-MDH, and PEPC. 1-MCP treatment significantly inhibited the gene expression of NADP-ME, and it surpassed the effect of EA treatment [34]. The expression of NAD-MDH peaked in the late storage period, and the PEPC gene was notably up-regulated at 15 d [36]. Previous studies have shown that the VcPEPC gene is negatively correlated with malic acid content during the early stages of fruit development and positively correlated during the late stages [14]. The cyMdh gene, cloned from apple fruit, has been shown to have a significant role in the synthesis of malic acid, and the fusion protein obtained through prokaryotic expression further confirmed this finding [37]. It can be seen that the NAD-MDH and PEPC genes play a major role in malic acid synthesis [38]. Transporter proteins are essential for the transportation of organic acids inside and outside the tonoplast. The malic acid transporter tDT not only participates in the transfer of malic acid between the vacuoles and cytoplasm but also regulates the cytoplasmic pH balance [39]. Thus, the high expression of the tDT gene that is induced by 1-MCP treatment under CI is crucial for the accumulation of organic acids in fruit. In conclusion, this study proved that 1-MCP treatment can effectively regulate the enzyme activity and gene expression that is associated with the malic acid metabolism under CI, delay the decline in malic acid content, and thus reduce the loss of sour taste in ‘Xiangjiao’ plums. As a result, the treatment improved the fruit’s edible flavor and commercial value.

5. Conclusions

This study demonstrated that treatment with 1-MCP can significantly reduce the CI index and weight loss rate; increase fruit firmness, SSC, and titratable acid content; inhibit respiratory peak, relative electrical conductivity, and MDA accumulation; and maintain the SOD, POD, and CAT activity of ‘Xiangjiao’ plums when stored at 4 °C. Moreover, the fruit treated with 1-MCP were juicy and more palatable, which suggests that 1-MCP is an effective way to maintain fruit quality and prolong storage time.

Additionally, 1-MCP treatment was found to regulate the high expression of tDT and PEPC genes as well as the expression of the NAD-MDH gene at the end of storage while inhibiting the expression of the NADP-ME gene. The treatment resulted in an increase in NAD-MDH enzyme activity and a decrease in NADP-ME enzyme activity, thereby inhibiting the degradation of malic acid in ‘Xiangjiao’ plums that is caused by CI and reducing the loss of pleasant sour taste in the fruit.

In summary, compared with the CK and EA conditions, the 1-MCP treatment was more effective at maintaining the storage quality of ‘Xiangjiao’ plums under low-temperature storage, reducing the degradation of malic acid that is caused by CI, and improving the edible flavor and commercial value of the fruit.