Next Article in Journal
Apricot Rootstocks with Potential in Hungary
Previous Article in Journal
Effect of Oxalic Acid Treatments and Modified Atmosphere Packaging on the Quality Attributes of Rocket Leaves during Different Storage Temperatures
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 9
Issue 6
10.3390/horticulturae9060719
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Field Performance of ‘Valencia’ Sweet Orange Trees Grafted onto Pummelo Interstocks and Swingle Citrumelo Rootstocks under Huanglongbing (HLB) Endemic Conditions

by
Manjul Dutt
*,
Lamiaa M. Mahmoud
and
Jude W. Grosser
Citrus Research and Education Center, Institute of Food and Agricultural Sciences, University of Florida, Lake Alfred, FL 33850, USA
*
Author to whom correspondence should be addressed.
Horticulturae 2023, 9(6), 719; https://doi.org/10.3390/horticulturae9060719
Submission received: 22 May 2023 / Revised: 7 June 2023 / Accepted: 10 June 2023 / Published: 19 June 2023
(This article belongs to the Section Biotic and Abiotic Stress)
Browse Figures
Versions Notes

Abstract

:
Interstocks have been used in fruit tree cultivation to regulate tree size and improve fruit production and quality. In this study, several Huanglongbing (HLB)-tolerant open-pollinated pummelo interstock candidates were evaluated as interstocks between the Swingle rootstock and the ‘Valencia’ scion, with Swingle serving as the control interstock. After 5 years in the field, most trees did not exhibit visual HLB symptoms, although the trees were infected with HLB, and the CaLas Ct values in the ‘Valencia’ leaves of the different interstock treatments ranged between 25.88 and 27.82. Although the foliar chlorophyll content among the interstock treatments was not highly significant (p-value = 0.0313), the foliar starch content was significantly different (p-value = 0.0018). ‘Valencia’ grafted onto 5-1-99-3 and HBJL-4 interstocks (both open pollinated seedlings of the Hirado Buntan pummelo) exhibited the highest total phenolic compound (TPC) levels (46.44 and 46.36 mg gallic acid g−1 FW). Transcripts of CsPR1 and CsPR2, two pathogenesis-related (PR) genes, were upregulated in ‘Valencia’ grafted onto open pollinated seedling selections of the red shaddock pummelo, Liang Ping Yau pummelo, and Hirado Buntan pummelo compared with ‘Valencia’ grafted onto Swingle. All interstocks influenced the tree growth rate and improved canopy volume in the field compared to the control trees without any interstocks (p-value = 0.0085). The 5-4-99-7 (red shaddock pummelo) and 8-1-99-1B (Liang Ping Yau pummelo) interstock trees had the highest canopy volume among all the treatments. We propose, based on our current results, that HLB-tolerant citrus accessions, when judiciously used as interstocks, may enhance plant defense and provide increased HLB tolerance to susceptible scions.

1. Introduction

Huanglongbing (HLB), caused by the phloem-limited bacterium ‘Candidatus Liberibacter asiaticus’ (CaLas), affects citrus production in many countries, including the USA [1,2]. This disease causes massive economic losses and reduces the productivity of most commercially cultivated citrus varieties [3]. Some citrus varieties are more tolerant of CaLas infection than others, indicating the potential to mitigate Huanglongbing disease [4,5,6]. Many strategies have been developed to withstand HLB stress, including conventional breeding of tolerant genotypes [7], generating transgenic germplasm possessing tolerance traits [8,9], application of antimicrobials such as antibiotics [10,11] and antimicrobial peptides [12], nutrition management [13], insect vector management [14], and thermotherapy [15].
All commercially cultivated citrus varieties are propagated by grafting onto selected rootstocks. The selection of these rootstocks depends on specific desirable traits. The most important factors that define successful rootstocks are (1) enhanced nutritional uptake, (2) soil adaptation, (3) tolerance to abiotic and/or biotic stressors, (4) yield improvement, and (5) fruit quality enhancement. In Florida, Swingle and Kuharske/Carrizo have consistently been the most common rootstocks, even though they are HLB susceptible [16]. Under HLB endemic conditions, there is an urgent need to select new methods and germplasm to support scion growth, especially as many commercially important citrus scions are also susceptible to CaLas infection. The interstock, which is a piece of graft-compatible plant tissue inserted between the rootstock and the scion, can be used as a “bridge” between the commercial scion and the rootstock. Interstocks affect tree production and longevity, improve fruit quality, control tree size [17], and enhance abiotic stress tolerance [18]. They are widely used in many fruit crops, such as lemon [19], apple [20,21], plum [22], and sweet cherry [23], to regulate tree size and improve fruit production and quality. Furthermore, the usage of interstock tissues can compensate for incompatibility between scion and rootstock, prevent tree decline following grafting, prevent bulge formation, avoid slow sap flow, and regulate growth. In such trees, owing to the active communication between the scion and the rootstock through the interstock, it is possible that an HLB-tolerant interstock may confer disease tolerance to the scion and the rootstock.
In the present study, we assessed field trees of ‘Valencia’ sweet orange grafted onto pummelo interstock and Swingle rootstock. To gain insights into their performance, we examined the chlorophyll content, starch content, total phenolic compounds, and DPPH radical scavenging activity in each combination of scion–interstock–rootstock. Furthermore, we investigated the differential expression of pathogenesis-related (PR) protein transcripts, specifically CsPR1 and CsPR2. These analyses aimed to provide a comprehensive understanding of scion–interstock–rootstock interactions and their impact on physiological and molecular aspects of ‘Valencia’ sweet orange.

2. Materials and Methods

2.1. Plant Materials

The interstock candidates utilized in this study consisted of mature open-pollinated pummelo trees that were selected based upon their enhanced field tolerance to HLB. Six-inch interstock sticks were obtained from mature HLB tolerant field trees and grafted onto Swingle citrumelo. The selected pummelo trees used for interstock material were UKP-1 (seedling selection of unknown parentage), HBJL-1, HBJL-4, 5-1-99-2-S5 and 5-1-99-3 (seedling selections of Hirado Buntan pummelo; HBP), 5-4-99-3 and 5-4-99-7 (seedling selections of red shaddock pummelo), 7-2-99-11 (seedling selections of large pink pummelo), and 8-1-99-1B (seedling selections of Liang Ping Yau pummelo). The pummelo trees were selected for interstock use based on their enhanced HLB tolerance under field conditions. In this experiment, there were 10 replications from each scion–interstock–rootstock combination, and trees budded directly onto Swingle were used as the control. The interstock–swingle rootstock trees were subsequently cleft grafted with a field-derived HLB-infected ‘Valencia’ scion (Figure 1). Trees were maintained in the greenhouse and, after one year of successful grafting, trees were planted in the field in a randomized block design format. All trees were subsequently analyzed after 4 years in the field (5-year total age).

2.2. CaLas Assessment in ‘Valencia’ Leaves

CaLas titers in the infected ‘Valencia’ leaves were evaluated from genomic DNA extracted from the leaf petioles and midveins of fully expanded leaf tissues using the GeneJET Plant Genomic DNA Purification Kit (Thermo Fisher Scientific, Waltham, MA, USA) and normalized at 25 ng/µL. qPCR was performed using a StepOnePlus Real-Time PCR System (Thermo Fisher Scientific) using TaqMan Gene Expression Master Mix and CQUL primers (Table 1) to amplify a CaLas rplJ/rplL ribosomal protein gene [24]. The real-time qPCR Ct values ≤ 35 were assigned as positive for CaLas 16 s rRNA infection, whereas real-time qPCR Ct values > 35 indicated negative.

2.3. Physiological and Biochemical Variables

Fifteen mature leaves were harvested from the trees during November, frozen, ground in liquid nitrogen, and kept at −20 °C for use in biochemical assays. Ten biological replicates were sampled from each interstock selection, and three technical replicates were sampled from each tree.

2.3.1. Foliar Photosynthetic Pigments and Starch Quantification

The chlorophyll pigments (chlorophyll a and b and total chlorophyll) were estimated according to Lichtenthaler and Wellburn [25]. Starch content was determined according to Rosales and Burns [26], with some modifications. Fresh tissues (100 mg) were homogenized in 700 μL of distilled water. Leaf samples and standard rice starch samples were boiled in distilled water for 10 min and cooled in a water bath. Samples were centrifuged for 2 min at 6000 rpm, and the supernatant aliquots were collected into clean tubes. A 300 μL aliquot of supernatant was mixed with 900 μL of 100% ethanol, vortexed and centrifuged for 10 min at the maximum speed. One milliliter of distilled water was used to dissolve the pellet, and then fifty microliters of KI:I2 (8 mM:50 mM) was added. The color change was recorded at 594 nm in a spectrophotometer to quantify the starch content and compared with the color change of pure starch (Sigma Aldrich, St. Louis, MO, USA) as a standard.

2.3.2. Total Phenolic Compounds and DPPH Radical Scavenging Activity

Total phenolic compounds were estimated according to Singleton and Rossi [27]. In brief, 100 mg of fresh leaf was extracted in 1 mL of 80% ethanol and then centrifuged for 20 min at 10,000 rpm. The supernatant was incubated overnight at room temperature until evaporation and complete dryness. Distilled water (5 mL) was added to the plate to dissolve the dried gel. Two hundred microliter aliquots were diluted to 3 mL in distilled water. The folin reagent was added at 0.5 mL for 3 min, and then 2 mL of (20%) Na2CO3 solution was added to each tube. The color change was recorded after 60 min at 650 nm. The standard curve of phenol was prepared by measuring 1 mL of a series of ethanolic gallic solutions at different concentrations from 0 to 1.00 mg/mL. The phenol content was expressed as mg gallic acid per 100 g fresh weight tissue.
The DPPH free-radical scavenging activity was measured using the method described by Blois [28]. DPPH (2,2-diphenyl-1-picryl-hydrazyl-hydrate) was prepared fresh at 1 mM solution in methanol. Equal amounts of DPPH solution and leaf extracts were mixed and incubated for 30 min in the dark. The absorbance was measured at 517 nm using a spectrophotometer, and methanol was used as a blank solution. The control solution was DPPH added to the methanol solution instead of the leaf extract. The analysis was performed in triplicate. DPPH inhibition was expressed as a percentage, as shown in the following equation:
%   DPPH   inhibition = A   control − A   sample A   control × 100
where A control is the mixture of methanol and DPPH solution and A sample is the mixture of sample extract and DPPH solution.

2.3.3. Tree Canopy

Canopy volume, expressed as cubic meters, was calculated as described by Vashisth and Grosser [29] using a geometric prolate spheroid formula: [(4/3) (π) (H/2) (ACR)2], where π = 3.14, H = tree height, and ACR = average canopy radius. ACR was calculated by dividing the tree diameter by 2 and calculating the average radius. The tree diameter was measured in two directions: east to west (D1) and north to south (D2). The percentage increase in canopy volume was calculated as the increase in canopy volume from the time of pruning until the end of the experiment.

2.4. Gene Expression Assessment

RNA was isolated from 100 mg of finely ground leaf tissues using a Direct-zol RNA Miniprep (Zymo Research, Irvine, CA, USA) kit according to the manufacturer’s protocol. qPCR was performed with a final volume of 20 μL using PowerUp SYBR Green Master Mix (Thermo Fisher Scientific) according to the manufacturer’s instructions. Each sample was tested twice in three replicates, and the data were analyzed using Applied Biosystems software version 3.0.1. The relative expression of the selected gene was calculated by the 2−ΔΔCT method [30]. The actin housekeeping gene was used as an endogenous control. The primer sequences of the genes evaluated in this study are outlined in Table 2.

2.5. Statistical Analysis

Data were analyzed using one-way ANOVA in a completely randomized design with ten replications per treatment. The Tukey–Kramer HSD test was used post hoc to calculate significant differences between treatments. All statistical analyses were performed on JMP Pro version 16 (SAS Institute, Cary, NC, USA). Differences were significantly different when p values were less than 0.05%.

3. Results and Discussion

HLB is an often-fatal disease affecting the citrus industry worldwide. Although many strategies have been studied for HLB mitigation, most of the applied strategies have shown limited success in the field. Thus, breeding and developing tolerant cultivars may provide an effective solution and support long-term citriculture and combat HLB [31]. We selected several open-pollinated and HLB-tolerant pummelo trees that were originally derived from a large-scale screening population of zygotic pummelo seedlings in the late 1990s. The selections were based on their overall growth and vigor, even under endemic HLB conditions. Subsequently, they were used to improve the response to HLB when used as interstocks in this study.

3.1. CaLas Assessment in ‘Valencia’ Leaves

The trees were evaluated for the presence of CaLas using qPCR. As expected, all trees were infected, and the CaLas bacterial titer in ‘Valencia’ leaf petioles ranged between 25.88 and 27.82 in ‘Valencia’ grafted onto pummelo selections and 27.09 in ‘Valencia’ grafted onto Swingle (Table 3). These results indicate that CaLas was able to multiply in all the different combinations, and there were no significant differences between the treatments. When ‘Valencia’ trees have low CaLas Ct values [32], they usually exhibit severe symptoms of citrus greening disease, including stunted growth, yellow shoots, and blotchy mottled leaves. This was not observed in most of our interstock trees, even though they had been in the field for 4 years and were infected to begin with.

3.2. Physiological and Biochemical Variables

3.2.1. Foliar Photosynthetic Pigments and Starch Content

A significant difference in foliar chlorophyll content (p value = 0.0313) was observed when comparing the effects of different selections, as indicated in Table 4. The highest foliar chlorophyll content of ‘Valencia’ was recorded in the graft combinations with HBJL-1 and 8-1-99-1B, with values of 7.70 and 7.78 mg−1 g FW, respectively; however, ‘Valencia’ grafted onto Swingle recorded 6.71 mg−1 g FW. Additionally, a significant difference in foliar starch content (p value = 0.0018) was observed among the selections. A slight difference was observed in the content of foliar starch among the graft combinations. ‘Valencia’ grafted onto HBJL-4 and Swingle displayed the highest foliar starch content, with values of 34.50 and 38.22 µg·mm−2, respectively, whereas the lowest value (16.81 µg·mm−2) was recorded with 5-4-99-7 (Figure 2).
The significant difference in the foliar starch content indicates the importance of using the interstock in the citrus tree structure. Starch accumulation in photosynthetic cells, vascular parenchyma, and phloem elements can be used as an indicator for disorder in carbohydrate metabolism and HLB infection in citrus [33]. It causes phloem blockage and limited sugar export in CaLas-infected tissues [34]. The differences in starch content and other physiological parameters indicated the superiority of pummelo interstocks when compared with trees that were grown without an interstock and grafted directly onto Swingle.

3.2.2. Total Phenolic Compounds and DPPH Radical Scavenging Activity

The ‘Valencia’ scion foliar TPC content was significantly different (p value < 0.0001) when the effect of the different selections was compared (Figure 3A). ‘Valencia’ grafted onto 5-1-99-3 and HBJL-4 interstocks exhibited the highest TPC values (46.44 and 46.362 mg gallic acid g−1 FW), whereas ‘Valencia’ grafted onto Swingle recorded 37.70 mg gallic acid g−1 FW. The DPPH free-radical scavenging activity of ‘Valencia’ leaves showed a significant difference between the selections (p value = 0.0013). ‘Valencia’ grafted onto 5-1-99-2 S5 recorded the highest DPPH content (90.35%) (Figure 3B).
Recently, Weber et al. [6] reported that citrus greening disease (HLB) can be controlled by ROS detoxification via induction of antioxidant pathways. To mitigate the harmful effects of ROS, complex mechanisms have evolved in plants. These mechanisms include scavenging ROS via the accumulation of various enzymatic and nonenzymatic antioxidants [35]. Phenolic compounds are important antioxidants that play essential roles as antimicrobial agents in response to CaLas [36] and Ca. Liberibacter solanacearum [37,38], and in response to abiotic stress [34,39,40].
The levels of phenolic compounds have been found to be affected by rootstocks [36]. Killiny et al. [36] recorded higher quinic acid in ‘Sugar Belle’ grafted onto Carrizo citrange or Swingle citrumelo compared to UFR-15 and higher ferulic acid in ‘Sugar Belle’ grafted onto ‘Swingle’. The same study suggested that Swingle would be the optimal rootstock to enhance disease resistance based on its phenolic content. The current study indicated that using tolerant pummelo interstocks increased the total phenolic compounds in ‘Valencia’ leaves compared with those grafted onto Swingle.
The enhanced DPPH free-radical scavenging activity in ‘Valencia’ leaves indicated the capability of ‘Valencia’ grafted onto pummelo interstocks to mitigate the adverse effect of ROS compared with ‘Valencia’ grafted onto Swingle, but all treatments performed equally well, and there was no significant difference.

3.3. Tree Canopy

HLB-infected trees generally have poor tree canopy. In our study, all interstocks influenced the growth rate of tree canopy volume in the field (p value = 0.0085; Figure 4). The canopy volume measurements revealed that 5-4-99-7 exhibited the highest volume, reaching 56.97 m3. This was followed by 8-1-99-1B and 5-1-99-2 S5, which recorded volumes of 38.98 and 37.98 m3, respectively. In comparison, ‘Valencia’ grafted onto Swingle controls displayed a canopy volume of 16.39 m3. Interstocks are widely used in fruit tree production. The influence of interstock on the vigor of cultivars depends on several factors. Genetic and agronomic factors are the main effective factors [20]. The decrease in growth induced by interstocks depends on the vigor of the interstock [41] and the selected rootstock and cultivar [42,43]. HLB-tolerant interstocks in this study (5-year-old trees) resulted in vigorous trees, which depended on the interstock used (Figure 5). Interstocks can be used for tree-size control in ‘Minneola’ tangelo and ‘Valencia’ [41]. Dutt et al. [44] reported that the architecture of sweet orange trees is modulated by endogenous hormonal and genetic alterations. Auxins, cytokinins, and gibberellin have a role in the regulation of plant vigor [44,45]. Many studies have reported that rootstocks can control tree size by modulating auxin and gibberellin (GA) signaling [46]. It remains unknown whether older interstock trees will continue to have good canopy density or whether there will be a decline as HLB symptomology increases.

3.4. Gene Expression of Pathogenesis-Related (PR1 and PR2) Genes

CsPR1 and CsPR2 are induced following CaLas infection [7,8,9,35]. The differential expression of these two pathogenesis-related genes (CsPR1 and CsPR2) was investigated in ‘Valencia’ leaves. Our results showed a significant difference in the two tested genes (Figure 6). Five pummelo hybrids showed high expression of CsPR1 and CsPR2. The expression of CsPR1 genes was upregulated in ‘Valencia’ grafted onto 8-1-99-1B, followed by UKP-1, HBJL-4, and 5-4-99-7 (Figure 6A). CsPR2 was upregulated in ‘Valencia’ grafted onto HBJL-4, 8-1-99-1B, UKP-1, 5-4-99-7, and HBJL-1 following CaLas infection (Figure 6B).
Pathogenesis-related (PR) proteins are significant key molecules induced by phytopathogens as well as defense-related innate immune systems, especially systemic acquired resistance (SAR) [47]. Following pathogen attack, plants activate defense signaling pathways involving salicylic acid (SA) and jasmonic acid (JA), which further enhance PR protein accumulation, ultimately minimizing pathogen infection [48]. Dutt et al. [7] observed enhanced expression of CsPR1 and CsPR2 genes in the mesophyll of HLB-tolerant finger lime (Citrus australasica). Weber et al. [35] reported the presence of PR-1 proteins related to a superfamily of secretory proteins rich in cysteine in HLB-tolerant finger lime. In the present study, ‘Valencia’ grafted onto pummelo interstocks was grown under HLB-endemic conditions, and enhanced CsPR1 and CsPR2 gene expression may have played a role in enhanced tolerance to HLB.

4. Conclusions

In this study, we provide evidence that HLB-tolerant pummelo interstocks can be used to produce vigorous trees and result in enhanced tolerance to susceptible scions. Although it was beyond the scope of the current study to understand the detailed biochemical mechanism occurring in the phloem, there was a definite interaction occurring in the phloem. The interstock had a pronounced effect over the Swingle control, although there was no difference in the CaLas bacterial titer among the different treatments. Using an interstock can raise tree production costs and turnaround time but may allow citrus growers with another option to grow a productive tree even under endemic HLB conditions. Apart from the effect of using tolerant interstocks to enhance plant defense, interstocks can also be used to control citrus tree size and lead to either high-density plantings with dwarf trees or vigorous trees with wider spacing in the field.

Author Contributions

Conceptualization, M.D., J.W.G. and L.M.M.; methodology, M.D., J.W.G. and L.M.M.; software, L.M.M.; validation, M.D. and L.M.M.; formal analysis, M.D. and L.M.M.; investigation, M.D. and L.M.M.; resources, M.D. and J.W.G.; data curation, M.D. and L.M.M.; writing—original draft preparation, M.D. and L.M.M.; supervision and project administration, M.D. and J.W.G. All authors have read and agreed to the published version of the manuscript.

Funding

This research received partial funding support from the Citrus Research and Development Foundation through grant number 18-039C.

Data Availability Statement

The data presented in this study are available in the article.

Acknowledgments

Ethan Nielsen is thanked for producing these trees. The support from Edward Leotti and Tamiami Citrus LLC during the field trial is also acknowledged.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Zapata, S.D.; Peguero, F.; Sétamou, M.; Alabi, O.J. Economic Implications of Citrus Greening Disease Management Strategies. J. Agric. Resour. Econ. 2022, 47, 300–323. [Google Scholar]
  2. Killiny, N. Made for each other: Vector–pathogen interfaces in the huanglongbing pathosystem. Phytopathology 2022, 112, 26–43. [Google Scholar] [CrossRef]
  3. Trivedi, P.; Duan, Y.; Wang, N. Huanglongbing, a systemic disease, restructures the bacterial community associated with citrus roots. Appl. Environ. Microbiol. 2010, 76, 3427–3436. [Google Scholar] [CrossRef] [Green Version]
  4. Killiny, N.; Jones, S.E.; Nehela, Y.; Hijaz, F.; Dutt, M.; Gmitter, F.G.; Grosser, J.W. All roads lead to Rome: Towards understanding different avenues of tolerance to huanglongbing in citrus cultivars. Plant Physiol. Biochem. 2018, 129, 1–10. [Google Scholar] [CrossRef]
  5. Peng, Z.; Bredeson, J.V.; Wu, G.A.; Shu, S.; Rawat, N.; Du, D.; Parajuli, S.; Yu, Q.; You, Q.; Rokhsar, D.S. A chromosome-scale reference genome of trifoliate orange (Poncirus trifoliata) provides insights into disease resistance, cold tolerance and genome evolution in Citrus. Plant J. 2020, 104, 1215–1232. [Google Scholar] [CrossRef]
  6. Weber, K.; Mahmoud, L.M.; Stanton, D.; Welker, S.; Qiu, W.; Grosser, J.W.; Levy, A.; Dutt, M. Insights Into the Mechanism of Huanglongbing (HLB) Tolerance in the Australian Finger Lime (Citrus australasica). Front. Plant Sci. 2022, 13, 1019295. [Google Scholar] [CrossRef] [PubMed]
  7. Dutt, M.; Mahmoud, L.M.; Chamusco, K.; Stanton, D.; Chase, C.D.; Nielsen, E.; Quirico, M.; Yu, Q.; Gmitter, F.G., Jr.; Grosser, J.W. Utilization of somatic fusion techniques for the development of HLB tolerant breeding resources employing the Australian finger lime (Citrus australasica). PLoS ONE 2021, 16, e0255842. [Google Scholar] [CrossRef] [PubMed]
  8. Qiu, W.; Soares, J.; Pang, Z.; Huang, Y.; Sun, Z.; Wang, N.; Grosser, J.; Dutt, M. Potential mechanisms of AtNPR1 mediated resistance against Huanglongbing (HLB) in citrus. Int. J. Mol. Sci. 2020, 21, 2009. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  9. Soares, J.M.; Weber, K.C.; Qiu, W.; Mahmoud, L.M.; Grosser, J.W.; Dutt, M. Overexpression of the salicylic acid binding protein 2 (SABP2) from tobacco enhances tolerance against Huanglongbing in transgenic citrus. Plant Cell Rep. 2022, 41, 2305–2320. [Google Scholar] [CrossRef]
  10. Killiny, N.; Hijaz, F.; Gonzalez-Blanco, P.; Jones, S.E.; Pierre, M.O.; Vincent, C.I. Effect of adjuvants on oxytetracycline uptake upon foliar application in citrus. Antibiotics 2020, 9, 677. [Google Scholar] [CrossRef]
  11. Killiny, N.; Hijaz, F.; Al-Rimawi, F.; Nehela, Y.; Batuman, O. Translocation of oxytetracycline in citrus plants after root drench and stem delivery. Proc. Fla. State Hort. Soc. 2019, 132, 68–71. [Google Scholar]
  12. Huang, C.-Y.; Araujo, K.; Sánchez, J.N.; Kund, G.; Trumble, J.; Roper, C.; Godfrey, K.E.; Jin, H. A stable antimicrobial peptide with dual functions of treating and preventing citrus Huanglongbing. Proc. Natl. Acad. Sci. USA 2021, 118, e2019628118. [Google Scholar] [CrossRef] [PubMed]
  13. Kwakye, S.; Kadyampakeni, D.M.; Morgan, K.; Vashisth, T.; Wright, A. Effects of Iron Rates on Growth and Development of Young Huanglongbing-affected Citrus Trees in Florida. HortScience 2022, 57, 1092–1098. [Google Scholar] [CrossRef]
  14. Yu, X.; Killiny, N. RNA interference-mediated control of Asian citrus psyllid, the vector of the huanglongbing bacterial pathogen. Trop. Plant Pathol. 2020, 45, 298–305. [Google Scholar] [CrossRef]
  15. Vashisth, T.; Livingston, T. Efficacy of in-field thermotherapy in comparison and combination of defoliation for mitigating Huanglongbing in sweet orange. HortScience 2020, 55, 251–257. [Google Scholar] [CrossRef] [Green Version]
  16. Albrecht, U.; McCollum, G.; Bowman, K.D. Influence of rootstock variety on Huanglongbing disease development in field-grown sweet orange (Citrus sinensis [L.] Osbeck) trees. Sci. Hortic. 2012, 138, 210–220. [Google Scholar] [CrossRef]
  17. Girardi, E.A.; Mourão Filho, F.d.A.A. Production of interstocked ‘Pera’sweet orange nursey trees on ‘Volkamer’ lemon and ‘Swingle’citrumelo rootstocks. Sci. Agric. 2006, 63, 5–10. [Google Scholar] [CrossRef] [Green Version]
  18. Aboutalebi, A.; Hasanzadeh, H. Salinity and citrus rootstocks and interstocks. Int. J. Plant Anim. Environ. Sci. 2014, 4, 654–672. [Google Scholar]
  19. Gil-Izquierdo, A.; Riquelme, M.T.; Porras, I.; Ferreres, F. Effect of the rootstock and interstock grafted in lemon tree (Citrus limon (L.) Burm.) on the flavonoid content of lemon juice. J. Agric. Food Chem. 2004, 52, 324–331. [Google Scholar] [CrossRef]
  20. Di Vaio, C.; Cirillo, C.; Buccheri, M.; Limongelli, F. Effect of interstock (M. 9 and M. 27) on vegetative growth and yield of apple trees (cv “Annurca”). Sci. Hortic. 2009, 119, 270–274. [Google Scholar] [CrossRef]
  21. Li, B.; Wang, J.; Ren, X.; Bao, L.; Zhang, L.; Zhang, L.; Han, M.; Zhan, D. Root growth, yield and fruit quality of ‘Red Fuji’apple trees in relation to planting depth of dwarfing interstock on the Loess Plateau. Eur. J. Hortic. Sci. 2015, 80, 109–116. [Google Scholar] [CrossRef]
  22. Popara, G.; Magazin, N.; Keserović, Z.; Milić, B.; Milović, M.; Kalajdžić, J.; Manojlović, M. Rootstock and interstock effects on plum cv.‘Čačanska Lepotica’young tree performance and fruit quality traits. Erwerbs Obstbau 2020, 62, 421–428. [Google Scholar] [CrossRef]
  23. Rozpara, E.; Grzyb, Z. Frutana®—A new Interstock for sweet cherry trees. In I International Symposium on Rootstocks for Deciduous Fruit Tree Species 658; International Society for Horticultural Science: Leuven, Belgium, 2002; pp. 247–250. [Google Scholar]
  24. Wang, Z.; Yin, Y.; Hu, H.; Yuan, Q.; Peng, G.; Xia, Y. Development and application of molecular-based diagnosis for ‘Candidatus Liberibacter asiaticus’, the causal pathogen of citrus huanglongbing. Plant Pathol. 2006, 55, 630–638. [Google Scholar] [CrossRef]
  25. Lichtenthaler, H.K.; Wellburn, A.R. Determinations of Total Carotenoids and Chlorophylls A and B of Leaf Extracts in Different Solvents; Portland Press Ltd.: London, UK, 1983. [Google Scholar]
  26. Rosales, R.; Burns, J.K. Phytohormone changes and carbohydrate status in sweet orange fruit from Huanglongbing-infected trees. J. Plant Growth Regul. 2011, 30, 312–321. [Google Scholar] [CrossRef]
  27. Singleton, V.L.; Rossi, J.A. Colorimetry of total phenolics with phosphomolybdic-phosphotungstic acid reagents. Am. J. Enol. Vitic. 1965, 16, 144–158. [Google Scholar] [CrossRef]
  28. Blois, M.S. Antioxidant determinations by the use of a stable free radical. Nature 1958, 181, 1199–1200. [Google Scholar] [CrossRef]
  29. Vashisth, T.; Grosser, J. Comparison of controlled release fertilizer (CRF) for newly planted sweet orange trees under Huanglongbing prevalent conditions. J. Hortic 2018, 5, 7. [Google Scholar] [CrossRef]
  30. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  31. Bové, J.M. Huanglongbing: A destructive, newly-emerging, century-old disease of citrus. J. Plant Pathol. 2006, 88, 7–37. [Google Scholar]
  32. Vincent, C.; Guha, A.; Killiny, N.; Diepenbrock, L. Understory environment promotes photosynthetic efficiency and mitigates severity and function of an introduced, vectored pathosystem: A study of a feral citrus population in central Florida. Trees 2021, 35, 1711–1725. [Google Scholar] [CrossRef]
  33. Achor, D.; Etxeberria, E.; Wang, N.; Folimonova, S.; Chung, K.; Albrigo, L. Sequence of anatomical symptom observations in citrus affected with huanglongbing disease. Plant Pathol. J. 2010, 9, 56–64. [Google Scholar] [CrossRef] [Green Version]
  34. Mahmoud, L.M.; Huyck, P.J.; Vincent, C.I.; Gmitter, F.G., Jr.; Grosser, J.W.; Dutt, M. Physiological Responses and Gene Expression Patterns in Open-Pollinated Seedlings of a Pummelo-Mandarin Hybrid Rootstock Exposed to Salt Stress and Huanglongbing. Plants 2021, 10, 1439. [Google Scholar] [CrossRef]
  35. Ma, W.; Pang, Z.; Huang, X.; Xu, J.; Pandey, S.S.; Li, J.; Achor, D.S.; Vasconcelos, F.N.; Hendrich, C.; Huang, Y.; et al. Citrus Huanglongbing is a pathogen-triggered immune disease that can be mitigated with antioxidants and gibberellin. Nat. Commun. 2022, 13, 529. [Google Scholar] [CrossRef] [PubMed]
  36. Killiny, N.; Valim, M.F.; Jones, S.E.; Hijaz, F. Effect of different rootstocks on the leaf metabolite profile of ‘Sugar Belle’mandarin hybrid. Plant Signal. Behav. 2018, 13, e1445934. [Google Scholar] [CrossRef]
  37. Plyuta, V.; Zaitseva, J.; Lobakova, E.; Zagoskina, N.; Kuznetsov, A.; Khmel, I. Effect of plant phenolic compounds on biofilm formation by Pseudomonas aeruginosa. Apmis 2013, 121, 1073–1081. [Google Scholar] [CrossRef]
  38. Wallis, C.; Rashed, A.; Chen, J.; Paetzold, L.; Workneh, F.; Rush, C. Effects of potato-psyllid-vectored ‘Candidatus Liberibacter solanacearum’infection on potato leaf and stem physiology. Phytopathology 2015, 105, 189–198. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  39. Mahmoud, L.M.; Dutt, M.; Vincent, C.I.; Grosser, J.W. Salinity-induced physiological responses of three putative salt tolerant citrus rootstocks. Horticulturae 2020, 6, 90. [Google Scholar] [CrossRef]
  40. Mahmoud, L.M.; Stanton, D.; Amin, B.H.; Grosser, J.W.; Dutt, M. Overexpression of the Arabidopsis NPR1 gene confers enhanced salt tolerance by regulating antioxidant and starch accumulation in citrus. Plant Cell Tissue Organ Cult. PCTOC 2022, 150, 695–707. [Google Scholar] [CrossRef]
  41. Lockard, R.G. Effects of Rootstocks and Length and Type of Interstock on Growth of Apple trees in Sand Culture1. J. Am. Soc. Hortic. Sci. 1974, 99, 321–325. [Google Scholar] [CrossRef]
  42. Tukey, H.; Brase, K. The dwarfing effect of an intermediate stem-piece of Malling IX apple. Proc. Am. Soc. Hortic. Sci. 1943, 42, 357–364. [Google Scholar]
  43. Carlson, R.F. The effects and relationships of intermediate stem sections on growth and behaviour of apple cultivars. Proc. Am. Soc. Hort. Sci. 1965, 87, 21–28. [Google Scholar]
  44. Dutt, M.; Mahmoud, L.M.; Nehela, Y.; Grosser, J.W.; Killiny, N. The Citrus sinensis TILLER ANGLE CONTROL 1 (CsTAC1) gene regulates tree architecture in sweet oranges by modulating the endogenous hormone content. Plant Sci. 2022, 323, 111401. [Google Scholar] [CrossRef] [PubMed]
  45. Qureshi, M.A.; Jaskani, M.J.; Khan, A.S.; Ahmad, R. Influence of endogenous plant hormones on physiological and growth attributes of Kinnow mandarin grafted on nine rootstocks. J. Plant Growth Regul. 2022, 41, 1254–1264. [Google Scholar] [CrossRef]
  46. Liu, X.-Y.; Li, J.; Liu, M.-M.; Yao, Q.; Chen, J.-Z. Transcriptome profiling to understand the effect of citrus rootstocks on the growth of ‘Shatangju’mandarin. PLoS ONE 2017, 12, e0169897. [Google Scholar]
  47. Ali, S.; Ganai, B.A.; Kamili, A.N.; Bhat, A.A.; Mir, Z.A.; Bhat, J.A.; Tyagi, A.; Islam, S.T.; Mushtaq, M.; Yadav, P. Pathogenesis-related proteins and peptides as promising tools for engineering plants with multiple stress tolerance. Microbiol. Res. 2018, 212, 29–37. [Google Scholar] [CrossRef]
  48. van Loon, L.C.; Rep, M.; Pieterse, C.M. Significance of inducible defense-related proteins in infected plants. Annu. Rev. Phytopathol. 2006, 44, 135–162. [Google Scholar] [CrossRef] [Green Version]
Horticulturae 09 00719 g001 550
Figure 1. Schematic representation of the interstock grafting process.
Figure 1. Schematic representation of the interstock grafting process.
Horticulturae 09 00719 g001
Horticulturae 09 00719 g002 550
Figure 2. Foliar starch content of ‘Valencia’ sweet orange grafted into pummelo interstocks and Swingle rootstocks. Means compared using Tukey–Kramer HSD test. Means followed by the same letter were not significantly different at p < 0.05. * Represents significant difference between the means. The error bars indicate standard error (SE; n = 10).
Figure 2. Foliar starch content of ‘Valencia’ sweet orange grafted into pummelo interstocks and Swingle rootstocks. Means compared using Tukey–Kramer HSD test. Means followed by the same letter were not significantly different at p < 0.05. * Represents significant difference between the means. The error bars indicate standard error (SE; n = 10).
Horticulturae 09 00719 g002
Horticulturae 09 00719 g003 550
Figure 3. Foliar total phenolic compounds (A) and DPPH radical scavenging activity (B) of ‘Valencia’ sweet orange grafted into pummelo interstocks and Swingle rootstocks. Means compared using Tukey–Kramer HSD test; means followed by the same letter were not significantly different at p < 0.05. * Represents significant difference between the means. The error bars indicate standard error (SE; n = 10).
Figure 3. Foliar total phenolic compounds (A) and DPPH radical scavenging activity (B) of ‘Valencia’ sweet orange grafted into pummelo interstocks and Swingle rootstocks. Means compared using Tukey–Kramer HSD test; means followed by the same letter were not significantly different at p < 0.05. * Represents significant difference between the means. The error bars indicate standard error (SE; n = 10).
Horticulturae 09 00719 g003
Horticulturae 09 00719 g004 550
Figure 4. Canopy volume of ‘Valencia’ sweet orange grafted onto pummelo interstocks and Swingle rootstocks. Means compared using Tukey–Kramer HSD test; means followed by the same letter were not significantly different at p < 0.05. * Represents significant difference between the means. The error bars indicate standard error (SE; n = 10).
Figure 4. Canopy volume of ‘Valencia’ sweet orange grafted onto pummelo interstocks and Swingle rootstocks. Means compared using Tukey–Kramer HSD test; means followed by the same letter were not significantly different at p < 0.05. * Represents significant difference between the means. The error bars indicate standard error (SE; n = 10).
Horticulturae 09 00719 g004
Horticulturae 09 00719 g005 550
Figure 5. (A) “Valencia” sweet orange tree on 5-4-99-7 interstock (B) “Valencia” sweet orange tree on Swingle interstock.
Figure 5. (A) “Valencia” sweet orange tree on 5-4-99-7 interstock (B) “Valencia” sweet orange tree on Swingle interstock.
Horticulturae 09 00719 g005
Horticulturae 09 00719 g006 550
Figure 6. The differential expression of CsPR1 (A) and CsPR2 (B) transcripts of ‘Valencia’ sweet orange grafted into pummelo interstocks and Swingle rootstocks. Means compared using Tukey–Kramer HSD test; means followed by the same letter were not significantly different at p < 0.05. * Represents significant difference between the means. The error bars indicate standard error (SE; n = 10).
Figure 6. The differential expression of CsPR1 (A) and CsPR2 (B) transcripts of ‘Valencia’ sweet orange grafted into pummelo interstocks and Swingle rootstocks. Means compared using Tukey–Kramer HSD test; means followed by the same letter were not significantly different at p < 0.05. * Represents significant difference between the means. The error bars indicate standard error (SE; n = 10).
Horticulturae 09 00719 g006
Table
Table 1. Primer sequences used to amplify an 87-bp fragment of the CaLas rplJ/rplL ribosomal protein gene for SYBR Green-based real-time PCR assay.
Table 1. Primer sequences used to amplify an 87-bp fragment of the CaLas rplJ/rplL ribosomal protein gene for SYBR Green-based real-time PCR assay.
Description (Gene Symbol)Forward and Reverse Primer Sequences (5′ to 3′)
CQUL-FTGGAGGTGTAAAAGTTGCCAAA
CQUL-RCCAACGAAAAGATCAGATATTCCTCTA
CQUL-ProbeFAM-ATCGTCTCGTCAAGATTGCTATCCGTGATACTAG-IBFQ
Table
Table 2. List of the primer sequences used in the SYBR Green-based real-time PCR assay.
Table 2. List of the primer sequences used in the SYBR Green-based real-time PCR assay.
Description (Gene Symbol)Forward and Reverse Primer Sequences (5′ to 3′)
CsPR1AACTCGCCTCAAGACTACCT
CTGCAACTGTGTCGTTCCATA
CsPR2ACTTCGCTCAGTACCTTGTTC
GGCAGTGGAAACCTTGATTTG
β-actinGCTGCCTGATGGCCAGATC
AGTTGTAGGTAGTCTCATGAA
Table
Table 3. Quantification of CaLas bacterial titers following qPCR from leaf petiole of ‘Valencia’ sweet orange grafted into pummelo interstocks and Swingle rootstocks.
Table 3. Quantification of CaLas bacterial titers following qPCR from leaf petiole of ‘Valencia’ sweet orange grafted into pummelo interstocks and Swingle rootstocks.
InterstocksCt Values of CaLas
UKP-127.06 ± 0.34 ab1
HBJL-127.09 ± 0.07 ab
HBJL-425.88 ± 0.96 b
7-2-99-1126.87 ± 0.95 ab
5-4-99-326.10 ± 0.20 ab
5-4-99-7 S226.15 ± 0.61 b
5-1-99-227.14 ± 0.12 ab
5-1-99-327.82 ± 0.46 a
8-1-99-1B25.91 ± 0.57 b
Swingle27.06 ± 0.49 ab
p valueNS
1 Tukey–Kramer HSD test was used post hoc to calculate significant differences between treatments. Means followed by the same letter were not significantly different at p < 0.05. NS: not significant.
Table
Table 4. Foliar chlorophyll content of ‘Valencia’ sweet orange grafted into pummelo interstocks and Swingle rootstocks.
Table 4. Foliar chlorophyll content of ‘Valencia’ sweet orange grafted into pummelo interstocks and Swingle rootstocks.
SelectionChlorophyll a
mg−1 g FW		Chlorophyll b
mg−1 g FW		Total Chlorophyll
mg−1 g FW
UKP-13.68 a,12.76 ab6.44 c
HBJL-14.47 a3.22 a7.70 a
HBJL-44.07 a2.57 b6.65 bc
5-1-99-2 S54.19 a3.04 ab7.23 abc
5-1-99-34.09 a3.03 ab7.13 abc
5-4-99-34.61 a2.89 ab7.50 ab
5-4-99-73.90 a2.80 ab6.74 bc
7-2-99-114.44 a3.07 ab7.51 ab
8-1-99-1B4.50 a3.28 a7.78 a
Swingle4.61 a2.84 ab6.71 bc
p valueNS0.0057 *0.0313 *
1 Tukey–Kramer HSD test was used post hoc to calculate significant differences between treatments. Means followed by the same letter were not significantly different at p < 0.05. NS: Not Significant, * Represents significant difference between the means.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Dutt, M.; Mahmoud, L.M.; Grosser, J.W. Field Performance of ‘Valencia’ Sweet Orange Trees Grafted onto Pummelo Interstocks and Swingle Citrumelo Rootstocks under Huanglongbing (HLB) Endemic Conditions. Horticulturae 2023, 9, 719. https://doi.org/10.3390/horticulturae9060719

AMA Style

Dutt M, Mahmoud LM, Grosser JW. Field Performance of ‘Valencia’ Sweet Orange Trees Grafted onto Pummelo Interstocks and Swingle Citrumelo Rootstocks under Huanglongbing (HLB) Endemic Conditions. Horticulturae. 2023; 9(6):719. https://doi.org/10.3390/horticulturae9060719

Chicago/Turabian Style

Dutt, Manjul, Lamiaa M. Mahmoud, and Jude W. Grosser. 2023. "Field Performance of ‘Valencia’ Sweet Orange Trees Grafted onto Pummelo Interstocks and Swingle Citrumelo Rootstocks under Huanglongbing (HLB) Endemic Conditions" Horticulturae 9, no. 6: 719. https://doi.org/10.3390/horticulturae9060719

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop