Next Article in Journal
In Vitro Micropropagation, Rooting and Acclimatization of Two Agastache Species (A. aurantiaca and A. mexicana)
Previous Article in Journal
Wild Malus niedzwetzkyana Dieck ex Koehne as a Genetic Resource for Fire Blight Resistance
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

First Report of Nigrospora Species Causing Leaf Spot on Olive (Olea europaea L.)

1
Institute of Agriculture and Tourism, Karla Huguesa 8, 52440 Poreč, Croatia
2
Faculty of Agrobiotechnical Sciences Osijek, Josip Juraj Strossmayer University of Osijek, Vladimira Preloga 1, 31000 Osijek, Croatia
3
Faculty of Agriculture, University of Zagreb, Svetošimunska cesta 25, 10000 Zagreb, Croatia
*
Author to whom correspondence should be addressed.
Horticulturae 2023, 9(10), 1067; https://doi.org/10.3390/horticulturae9101067
Submission received: 23 August 2023 / Revised: 18 September 2023 / Accepted: 19 September 2023 / Published: 22 September 2023
(This article belongs to the Section Plant Pathology and Disease Management (PPDM))

Abstract

Leaf spot symptoms were spotted in two olive orchards in Istria and in Kvarner Gulf, Croatia. Fungal species from three representative isolates (P13 LECIII, R18 BI, JA20 NP) have been morphologically characterized based on the colony and conidial characteristics. Several techniques were performed for inducing the sporulation of the JA20 NP isolate. Only PDA + banana medium was successful. PCR was conducted for ITS, TUB, and EF1α gene regions. Phylogenetic analyses were performed using internal transcribed spacer, beta-tubulin, and translation elongation factor 1-alpha sequence data. Three types of tests were conducted: a pathogenicity test on detached leaves, on detached and scratched leaves, and on olive seedlings. Ultimately, from the morphological characterizations, DNA sequence analysis of ITS, TUB, and EF1α gene regions, and phylogenetic analysis, these species were identified as Nigrospora gorlenkoana Novobr., Nigrospora osmanthi Mei Wang & L. Cai, and Nigrospora philosophiae-doctoris M. Raza, Qian Chen & L. Cai. This is the first report of Nigrospora species causing leaf spot on olive trees and the first report of Nigrospora philosophiae-doctoris as a plant pathogen. Fungal leaf diseases in conditions that are favorable for infection and disease development can lead to a decrease in the yield and olive oil quality. Therefore, it is necessary to conduct further research and the monitoring of fungal leaf diseases.

1. Introduction

The olive tree, Olea europaea L., is among the world’s most important crops. At present, the approximate production levels per year are 23.0 million tons of olives and 3.0 million tons of oil [1]. The crop is indigenous to the Mediterranean region with a mild, rainy winter and a hot, dry summer [2]. In the Republic of Croatia, the production area includes from the north of the Istrian peninsula, the Kvarner Gulf, and the Dalmatia coastal belt with the islands to the south. In recent years, interest in olive oil production has been rising due to certain socio-economic factors, such as a higher demand for olive oil, the possibility of achieving higher prices, and tourism development.
Among all fungal pathogens affecting olives, Venturia oleaginea (Castagne) Rossman & Crous and Pseudocercospora cladosporioides (Sacc.) U. Braun are two of the most important pathogens causing leaf spots: peacock spot disease (syn. bird’s-eye spot, olive leaf scab, olive leaf spot) and cercosporiosis (syn. cercospora leaf spot) [3]. Olive leaf spots caused by V. oleaginea and P. cladosporioides result in the defoliation of leaves and weakness or death of branches, a reduced fruit set, and a decrease in the oil yield in the following years [4,5,6,7,8].
Other fungal causal agents of leaf spot symptoms on olives are Alternaria alternata (Fr.) Keissl. [9], Colletotrichum acutatum J.H. Simmonds and C. gloeosporioides (Penz.) Penz. & Sacc. [10], Neofabraea kienholzii (Seifert, Spotts & Levesque) Spotts, Levesque & Seifert, and Phylctema vagabunda Desmazières [11].
Leaf spot usually manifests as small, circular-to-elliptical spots on the leaves. Spots are initially green or yellow-green but gradually turn brown or black as the disease progresses. They often have a dark border and may have a yellow halo around them. In severe cases, the spots can merge, leading to significant defoliation. Leaf spot fungi usually thrive in warm and humid conditions. Rain or overhead irrigation can facilitate the spread of the disease by splashing fungal spores onto healthy leaves. The disease exhibits its highest activity during the wetter months of the year. While leaf spot primarily affects the leaves, a severe infection can weaken the tree and reduce its overall vitality. In severe cases, defoliation can expose fruit to direct sunlight, leading to sunburn and reduced fruit quality. Leaf spot diseases also weaken trees by interrupting the process of photosynthesis. This means the tree produces less energy, which can lead to stunted growth and smaller and less flavorful olives. This can be problematic for olive growers who rely on high-quality fruit for oil production or table olives. Leaf spot diseases can also affect the appearance of olive trees, which may be a concern for growers who want their orchard to be visually appealing. Management practices, such as maintaining good tree spacing and air circulation, pruning, avoiding excessive moisture on the leaves, proper disposal of infected leaves and pruning debris, planting resistant cultivars, etc., can help to maintain the health and productivity of olive orchards.
This study focuses on fungal species from the Nigrospora genus, new causal agents of a leaf spot symptom on olives. The Nigrospora genus has been introduced in 1902. for N. panici, which was isolated as an endophyte from leaves of Panicum amphibium in Java, Indonesia [12]. Based on its conidial characteristics, Nigrospora was placed in Dermateaceae (Moniliales) by Barnett and Hunter [13]. Kirk et al. [14] assigned Nigrospora and its Khuskia sexual morph to Trichosphaeriaceae (Trichosphaeriales). Wang et al. [15] placed the Nigrospora species in the family Apiosporaceae based on the phylogenetic analyses of combined ITS, TUB, and EF1-α sequence data of 165 strains from China and Europe [16].
Currently, there are 45 records of Nigrospora species in the MycoBank database, namely Nigrospora aerophila, N. arundinacea, N. aurantiaca, N. bambusae, N. brasiliensis, N. camelliae-sinensis, N. canescens, N. chinensis, N. cooperae, N. covidalis, N. endophytica, N. falsivesicularis, N. gallarum, N. globosa, N. globospora, N. gorlenkoana, N. gorlenkoanum, N. gossypii, N. guangdongensis, N. guilinensis, N. hainanensis, N. javanica, N. lacticolonia, N. macarangae, N. magnoliae, N. manihoticola, N. maydis, N. musae, N. oryzae, N. osmanthi, N. padwickii, N. panici, N. pernambucoensis, N. philosophiae-doctoris, N. pyriformis, N. rubi, N. sacchari, N. sacchari-officinarum, N. saccharicola, N. singularis, N. sphaerica, N. vesicularifera, N. vesicularis, N. vietnamensis, and N. zimmermanii [17].
Until now, only Nigrospora oryzae was isolated from olive trees [18,19], but it was not described as a pathogen on olives.
The aims of this research were to determine the causal agent of leaf spot symptoms on olive trees in Croatia, to morphologically characterize the fungal species from representative isolates, to molecularly identify the isolates of phytopathogenic fungal species using PCR and DNA sequence analysis of ITS, TUB, and EF1α gene regions, and to determine isolate pathogenicity in pathogenicity tests conducted in the laboratory and in a greenhouse experiment.

2. Materials and Methods

2.1. Collection of Plant Materials and Fungal Isolations

During the summer and autumn of 2021, leaf spot symptoms were spotted on olive trees on the coastal belt in Jadranovo, Kvarner Gulf (45°13′46″ N, 14°36′40″ E), and in olive orchards in Vabriga (45°17′14″ N, 13°36′41″ E) and Španidiga (45°03′02.2″ N, 13°42′43.9″ E) in Istria, Croatia (Figure 1).
The symptoms were yellow and brown spots on leaves and defoliation. The samples from symptomatic trees were collected (30 leaves from each tree) in a sterile plastic bag, placed in a portable refrigerator at +4 °C, and immediately brought to the Laboratory for Plant Protection at the Institute of Agriculture and Tourism in Poreč (Croatia) for analysis. Olive varieties on which samples were collected in Istria were ‘Buža’ and ‘Leccino’. The olive variety on which samples were collected in Kvarner Gulfs remains unknown.
Fresh olive leaves were used to isolate the causal agent of yellow and brown spots on leaves. For surface sterilization, leaves were rinsed under tap water for 1 min and transferred to aseptic conditions. Leaves were submerged in 70% ethanol for two minutes, rinsed in sterile distilled water, and placed on a sterile paper sheet in a laminar flow cabinet to surface-dry. Entire leaves were plated on potato dextrose agar (PDA) supplemented with 35 mg/L of penicillin and incubated at 25 °C under dark conditions. After seven days of incubation, the isolates were transferred into the fresh PDA medium for pure culture.

2.2. Morphological Characterization

After 7 and 30 days of incubation at 28 °C in dark conditions, pure fungal cultures were taken for examination. Fungal species, from three representative isolates (P13 LECIII, R18 BI, JA20 NP), have been characterized based on the colony characteristics (color, form, elevation, margin, surface, and opacity) and conidial characteristics (color, shape, presence or absence of septum, dimensions). A Boeco BM-2000 microscope, Boeco BCAM10 camera, and B-View software (Boeckel + Co (GmbH + Co), Hamburg, Germany) were used to capture conidia and hyphae. Isolate JA20 NP did not sporulate on PDA. Several techniques were performed for inducing the sporulation of the JA20 NP isolate. Pine needle medium was prepared according to Su et al. [20]. The banana peel technique was performed based on Kindo et al. [21]. The PDA + banana medium was prepared based on a technique for the pine needle medium described in Su et al. [20], by putting 100 g of fresh banana peel (instead of pine needle) and 20 g of potatoes into 1 L of distilled water, boiling for 30 min, filtrating, and keeping the volume at 1 L by adding distilled water. After filtration, it was amended with 20 g of agar and autoclaved for 20 min at 121 °C.

2.3. DNA Extraction, Amplification, and Sequencing

Fresh fungal mycelia of fungal isolates grown on PDA for 5 days, at 28 °C, under dark conditions, were scraped with a sterile laboratory needle from the colony margins and used for genomic DNA (deoxyribonucleic acid) extraction. Total DNA from the isolate was extracted using the Extract-N-Amp™ Plant PCR kit (Sigma-Aldrich, Merck, Saint Louis, MO, USA) according to manufacturer’s protocol. The PCR (polymerase chain reaction) amplification process was performed using ITS1/ITS4 [22], ITS5/ITS4 [23], Btub2Fd/Btub4Rd [24], and EF1-728F/EF1-986R [25] pairs of primers (Table 1). The PCR reaction mixture was composed of 12.5 µL of EmeraldAmp® GT PCR Master Mix, 0.5 µL (10 µM) of each primer, 6.5 µL of nuclease-free water, and 5 µL (4.5 ng/µL) of genomic DNA. The PCR was conducted in a SureCycler 8800 Thermal Cycler (Agilent Technologies, Santa Clara, CA, USA) using different PCR conditions for ITS, TUB, and EF1α gene regions (Table 2). In the case of the R18 BI isolate, amplification of the EF1-alpha region was unsuccessful. Therefore, a second PCR was conducted using 1 µL of the initial PCR amplification as the template. Electrophoresis was performed using 1% agarose gel amended with two drops of GelRed® Nucleic Acid Gel Stain (Biotium, Fremont, CA, USA) at 110 V for 30 min in 1x TAE buffer with a BIO-RAD Power Pac 300 electrophoresis power supply (Agilent, Santa Clara, CA, USA). After electrophoresis, the PCR products were visualized using an iBright CL1000 Imaging System (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA). Purification of PCR products was performed with the GenElute™ PCR Clean-Up Kit (Sigma-Aldrich®, Burlington, MA, USA).

2.4. DNA Sequence Assembly and Phylogenetic Analysis

Sequencing of the PCR products was performed by Macrogen Europe (Amsterdam, The Netherlands). Sequences were edited in Sequencher® (Gene Codes Corporation, Ann Arbor, MI, USA) and compared with sequences from GenBank®.
The phylogenetic trees were constructed and the evolutionary history of the isolated fungi was concluded based on the Neighbor-joining method [27]. Phylogenetic analysis was performed using ITS, TUB, and EF1α sequence data from isolates and relevant sequence data of Nigrospora and Botryosphaeria dothidea (outgroup) isolates from GenBank® (a list of isolates used is presented in Table 3). The sequences were aligned using ClustalX2 (UCD Dublin, Dublin, Ireland) software, and a phylogenetic tree was made using MEGA11 software (Pennsylvania State University, State College, PA, USA).

2.5. Pathogenicity Test

Three pathogenicity tests were conducted to determine the isolates’ pathogenicity: pathogenicity test on detached leaves, pathogenicity test on detached and scratched leaves, and pathogenicity test on olive seedlings.

2.5.1. Pathogenicity Test on Detached Leaves and Scratched Detached Leaves

In May 2022, healthy olive leaves of the cultivars Leccino and Buža were collected from a collection orchard at the Institute of Agriculture and Tourism in Poreč (Istria, Croatia). Leaves were washed with tap water, surface-sterilized in 1% sodium hypochlorite solution for three minutes, rinsed with sterilized distilled water for one minute, and placed in a laminar flow cabinet, on sterile paper, until dry. After air-drying, ten leaves of each cultivar (per isolate), scratched with a needle, and ten unscratched leaves of each cultivar (per isolate), were inoculated by placing a 5 mm-diameter mycelium plug, taken from the margins of a five-day-old PDA culture of the isolates. The same numbers of scratched and unscratched leaves inoculated using pure PDA agar plugs were used as controls. Leaves were placed on a sterile filter paper, sprayed with sterile distilled water, in a Petri dish, and protected with parafilm. Two replicates were performed. Leaves were incubated at 28 °C, in dark conditions. After nine days, samples were analyzed.

2.5.2. Pathogenicity Test on Olive Seedlings

For the whole plant assay, the fungus was grown on PDA at 28 °C for five days, and mycelia were collected. Approximately one gram of mycelia was grinded in 10 mL of sterilized distilled water. The grinded mycelia were homogenized by mixing with a vortex mixer. In the greenhouse of the Institute of Agriculture and Tourism, the grinded mycelia were injected into the petiole of the leaves of three-year-old olive seedlings of cultivar Rosinjola. Thirty leaves (ten per isolate) were inoculated with a grinded mycelium. An equal number of control leaves were inoculated with sterile distilled water to serve as a negative control. Two replicates were performed. The inoculated plants were kept in a greenhouse for two weeks. After the incubation period, samples from all tests were collected and, in an effort to adhere to Koch’s postulate, small sections of necrotic tissue from the periphery of lesions were excised and placed on PDA to isolate the inoculated fungus.

3. Results

3.1. Field Survey and Disease Symptoms

Symptoms of leaf spot were observed on mature 10- to 38-year-old trees in Istria, Croatia. Leaves were dry and yellowish to chocolate-brown in color (Figure 2). Some of them had brown spots. Defoliation was observed on leaves with expanded spots, and symptoms affected only part of the trees.

3.2. Molecular Phylogenetic Identification

For molecular identification, consensus sequences of isolates were produced and registered in GenBank®. GenBank® accession numbers for each isolate and its genome region are represent in Table 4.
BLAST analysis of the sequences from the P13 LECIII isolate showed 100% similarity for ITS and TUB and 99.27% similarity for the EF1α gene region to N. gorlenkoana. BLAST analysis of the sequences from the JA20 NP isolate showed 100% similarity for ITS, TUB, and EF1α gene regions to N. osmanthi. BLAST analysis of the sequences from the R18 BI isolate showed 100% similarity for ITS and TUB and 98.64% similarity for the EF1α gene region to N. philosophiae-doctoris. Phylogenetic trees were constructed by aligning ITS, TUB, and EF1α sequences, and the evolutionary history was inferred using the Neighbor-Joining method [27]. Finally, a multilocus tree was created from a combination of ITS, TUB, and EF1α sequence alignments. The optimal trees are displayed in Figure 3, Figure 4, Figure 5 and Figure 6. Beneath the branches are the percentages of replicate trees where related taxa clustered together in the bootstrap test based on 1000 replicates [32]. The Maximum Composite Likelihood method [33] was used to calculate evolutionary distances, expressed in the units of base substitutions per site. The Botryosphaeria dothidea isolate CMW8000 was used as the outgroup. Ambiguous positions were excluded via pairwise detection using MEGA11 software [34].
Ultimately, from the DNA sequence analysis of ITS, TUB, and EF1α gene regions and the phylogenetic analysis, these species were identified as Nigrospora gorlenkoana Novobr., Nigrospora osmanthi Mei Wang & L. Cai, and Nigrospora philosophiae-doctoris M. Raza, Qian Chen & L. Cai.

3.3. Morphological Characterization and Fungal Incidence

Regarding sporulation, successful sporulation of the JA20 NP isolate was observed exclusively when it was cultured on a PDA + banana medium, as shown in Table 5.

3.3.1. Nigrospora gorlenkoana

Colonies on PDA had reached a nine-centimeter diagram after two days at 28 °C and on WA after five days and sporulated after three days of incubation on PDA medium. Colonies of N. gorlenkoana developing on PDA (Figure 7a,b) were circular-shaped with aerial, woolly mycelium, entire-margined, opaque, floccose, raised with fuzzy edges, and growing rapidly; at first, they were white, becoming light grey when they matured and the reverse initially white, becoming darker grey when they matured. Conidia of N. gorlenkoana were round-shaped, light-brown-to-black-colored and aseptated, solitary, smooth, and 10.5–13.8 × 13.5–17.3 µm in diameter ( x ¯ = 11.9 × 15.1 µm, n = 30). Hyphae were smooth, septate, hyaline, and yellowish. On WA, colonies were white and growing poorly.

3.3.2. Nigrospora osmanthi

Colonies on PDA had reached a nine-centimeter diagram after three days at 28 °C and on WA after seven days and sporulated after five days of incubation on PDA + banana medium. Colonies of N. osmanthi developing on PDA (Figure 7c,d) were circular-shaped with an aerial, slightly woolly mycelium, entire-margined, opaque, raised a little, filiform, and growing rapidly; they were creamy-white-colored up and the reverse becoming greyish when mature. Conidia of N. osmanthi were round-shaped, black-colored, and aseptated, solitary, smooth, and 11.2–12.8 × 12.7–15.4 in diameter ( x ¯ = 12.5 × 15.3 µm, n = 30). Hyphae were smooth, septate, hyaline, and yellowish. On WA, colonies were white and growing poorly.

3.3.3. Nigrospora philosophiae-doctoris

Colonies on PDA had reached a nine-centimeter diagram after three days at 28 °C and on WA after nine days and sporulated after four days of incubation on PDA medium. Colonies of N. philosophiae-doctoris developing on PDA (Figure 7e,f) were circular-shaped with aerial, woolly mycelium, entire-margined, opaque, floccose, raised with fuzzy edges, and growing rapidly; they were white-to-greyish-colored and reverse initially white, becoming creamy white when mature. Conidia of N. philosophiae-doctoris were round-shaped, brown-to-black-colored, aseptated, solitary, smooth, and 10.8–15.6 × 8.4–14.4 in diameter ( x ¯ =11.6 × 13.2, n = 30). Hyphae were smooth, septate, and hyaline. On WA, colonies were white to greyish and growing poorly.

3.4. Pathogenicity Tests

3.4.1. Pathogenicity Test on Detached Leaves

The symptoms of the disease on olive leaves tested in the laboratory showed similar symptoms as the leaf samples collected from the field survey. All inoculated leaves had yellowish-to-chocolate-brown spots (Figure 8). No symptoms were spotted on the control leaves. The re-isolated fungus from the diseased leaves was identical to the Nigrospora species.

3.4.2. Pathogenicity Test on Olive Seedlings

The first symptoms were observed three days after inoculation. All inoculated leaves had chocolate-brown spots, similar to those observed in the field. The symptoms progressed until the entire leaf surface was covered (Figure 9). No symptoms were observed on the control leaves. The re-isolated fungus from the diseased leaves was identical to the Nigrospora species.

4. Discussion

In this study, three different species of the Nigrospora genus, i.e., N. gorlenkoana, N. osmanthi, and N. philsophiae-doctoris, were detected on olive trees in Croatia. These species were the causal agents of leaf spots on olive trees in Istria and in Kvarner Gulf (Croatia).
Nigrospora species are cosmopolitan, filamentous, dematiaceous taxa distributed on various hosts, including crops with economic importance [15,16]. These species were isolated from different hosts around the world, such as Cirsium setosum, Nelumbo sp., Oryza sativa, Vitis vinifera, etc. [26]. They are known as plant pathogens, endophytes, and saprobes [35,36]. Nigrospora species known as plant pathogens cause many diseases, but the most common disease is leaf spot. A list of reported Nigrospora pathogens, diseases, and distributions is represented in Table 6. Nigrospora sp. are also known as contaminants on farm-stored maize [37] and stored wheat [38] and are the causative agent of the post-harvest rot of ginger rhizomes [39] and post-harvest black rot of kiwifruit [40,41]. There are records of N. oryzae infecting the roots of 21 plant species [42] and N. sphaerica isolated from diseased grapevines [43], but there are no data on the pathogenicity of this fungus on the mentioned plant species.
Based on GenBank® data, N. philosophiae-doctoris was first isolated from the plant species Disporum sessile (Thunb.) D.Don ex Schult. & Schult.f., but there are no reports of this fungus as a plant pathogen. N. philosophiae-doctoris clustered in a well-supported clade closely related to N. sacchari-officinarum and N. gorlenkoana. N. philosophiae-doctoris produces smaller conidiogenous cells, when compared to those in N. sacchari-officinarum and N. gorlenkoana, and smaller conidia than those of N. sacchari-officinarum [28]. The conidial sizes frequently overlap among morphologically similar, but phylogenetically distinct, species of Nigrospora, and identification based on molecular and phylogenetic data for this fungal species is crucial [15]. In this research for molecular identification, consensus sequences were made of ITS1, ITS5, and ITS4 sequence data for the ITS gene region, Btub2Fd, and Btub4Rd sequence data for the TUB gene region and EF-728F and EF-986R sequence data for the EF1α gene region. In our research, Nigrospora species were distinguished based on morphological and molecular data, four phylogenetic trees were made, and they support three separate species.
Sporulation in fungi usually occurs when the growth rate is reduced and is hampered under conditions that favor rapid mycelial growth [44]. Many techniques are used for inducing the sporulation of fungi, such as slide culture [45], low-nutrient media [46], sporulation on host tissue, etc. In our survey, several techniques were performed for inducing the sporulation of the JA20 NP isolate (Table 5) in order to carry out morphological research. Banana peel culture is used for inducing the sporulation of Nigrospora sphaerica [21] but was not effective for the Nigrospora osmanthi JA20 NP isolate. Interestingly, this isolate sporulates only on PDA + banana medium. Spore dispersal in Nigrospora is aided by the wind, rain splashes, and insect vectors [47], so it can be easily spread around the orchard and create defoliation and economical losses. In some cases, an irregular string of a mucilaginous substance (small hyaline drop) was found to be attached to the spore [48]. It has been hypothesized that this substance facilitates adherence to the host substrate or to a vector as a successful spore-dispersal mechanism [26]. The moth Sitotroga cerealella transports the spores of Nigrospora oryzae, which adhere to its body [49]. Alfaro [50] has described how the non-gravid females of the mite Pediculopsis graminum transport the conidia of Nigrospora oryzae in their abdominal sacks. Webster [48] states that the spores can be transmitted while adhered to the body of the mite. A study of airborne fungal spores carried out at nine locations in Nigeria showed that the numbers of Nigrospora spores significantly correlate with the relative humidity, light intensity, and temperature [51]. Research conducted on bananas has shown that with an increase in the temperature, the rotting of bananas caused by Nigrospora species speeds up, with maximum infection recorded at 30 °C [52]. In our survey, out of the four temperatures at which all three isolates were kept on PDA (represented in Table 5), the fastest growth was recorded at 28 °C. Therefore, this temperature was chosen as the incubation temperature for morphological analysis of the isolates.
Regarding protection measures, for N. oryzae, Azoxystrobin (EC50 = 0.0001 mg/L) had the most significant fungal-controlling effect, followed by Prochloraz (copper salt), 15% Difenoconazole + 15% Propiconazole, Difenoconazole, Pyraclostrobin, and Myclobutanil [53]. Lignans, isopicropodophyllone, and dehydropodophyllotoxin, isolated from the leaves of Podophyllum hexandrum (Royle) T. S. Ying of Pakistani origin showed strong antifungal activity against N. oryzae [54]. Bacillus thuringiensis var. israelensis has shown inhibitory effects against Nigrospora sp. [55]. The mushroom species Coprinellus disseminates (isolate 12b), Marasmiellus palmivorus (isolate 42b), Trametes maxima (isolate 56e), and Lentinus sajor-caju (isolate 60a) have potential antagonistic effects on Nigrospora species via the production of secondary metabolites and mycoparasitic interactions [56]. Unfortunately, there are no data about protection measures for these three species identified in this study.
Some Nigrospora species can act as an antagonist against fungal and bacterial plant pathogens [57,58]. Phomalactone from Nigrospora sphaerica exhibits a broad spectrum of antimicrobial activity against human and phytopathogenic bacteria and fungi [59], such as Phytophthora infestans (Mont.) de Bary, which causes tomato late blight [60]. An ethyl acetate extract of Nigrospora sphaerica affects the cell wall in growing methicillin-resistant Staphylococcus aureus Rosenbach and Klebsiella pneumonia (Schroeter 1886) Trevisan [61].
Table 6. A list of reported Nigrospora pathogens, diseases, and distributions.
Table 6. A list of reported Nigrospora pathogens, diseases, and distributions.
SPECIESHOST (Common Name)TAXONOMY IDDISEASE
SYMPTOMS
DISTRIBUTIONREFERENCES
Nigrospora aurantiacaChinese
chestnut
Castanea mollissima BlumeLeaf spotChina[62]
Pandan
rampeh
Pandanus amaryllifolius Roxb.Leaf spotMalaysia[63]
SugarcaneSaccharum officinarum L.Leaf spotChina[30]
TobaccoNicotiana tabacum L.Leaf spotChina[64]
Nigrospora brasiliensisCochineal
cactus
Nopalea cochenillifera (L.) Salm-DyckBrown leaf spotBrazil[31]
Nigrospora camelliae-sinensisBlack teaCamellia sinensis L.Leaf blightChina[65]
SugarcaneSaccharum officinarum L.Leaf spotChina[30]
Nigrospora chiensisTea-oil plantCamellia oleifera C. AbelLeaf blightChina[66]
Nigrospora falsivesicularisSugarcaneSaccharum officinarum L.Leaf spotChina[30]
Nigrospora guiliensisChinese
corktree
Phellodendron chinense C. K. Schneid.Leaf spotChina[67]
Nigrospora hainanensisCochineal
cactus
Nopalea cochenillifera (L.) Salm-DyckBrown spotBrazil[68]
Pink wood sorrelOxalis corymbosa DC.Leaf spotChina[69]
SugarcaneSaccharum officinarum L.Leaf spotChina[30]
Nigrospora lacticoloniaDate palmPhoenix dactylifera L.Leaf spotOman[70]
Dragon fruitHylocereus polyrhizus (F.A.C.Weber) Britton & RoseReddish-brown spotMalaysia[71]
Great BougainvilleaBougainvillea spectabilis Raeusch. Willd.Leaf spotChina[72]
SugarcaneSaccharum officinarum L.Leaf spotChina[30]
Nigrospora oryzaeAloe-veraAloe vera var. chinensis (Haw.) A.BergerLeaf spotChina[73]
Leaf spotPakistan[74]
Leaf spotBangladesh[75]
Asiatic dayflowerCommelina communis L.Leaf spotChina[76]
BayberryMorella rubra Lour.Twig blightChina[53]
BlueberryVaccinium corymbosum L.Leaf spotChina[77]
Chinese
photinia
Photinia serratifolia (Desf.) Kalkman (syn. Photinia serrulata Lindl.)Leaf spotChina[78]
CottonGossypium hirsutum L.Leaf spotChina[79]
Cotton-roseHibiscus mutabilis Mill.Black leaf spotChina[80]
Crepe-gingerHellenia speciosa (J.Koenig) Govaerts (syn. Costus speciosus (J.Koenig) Sm.)Leaf spotChina[36]
Dendrobium (Shi Hu)Dendrobium candidum Wall. ex Lindl.Leaf spotChina[81]
Dove treeDavidia involucrata Baill.Leaf blightChina[82]
Dryland
winter wheat
Triticum L.Crown and rot rootAzerbaijan[83]
Giant redArundo donax L.Foliar and cane rotEurope[84]
GingerZingiber officinale RoscoeLeaf spotChina[85]
Indian lotusNelumbo nucifera Gaertn.Leaf spotChina[86]
Indian
mustard
Brassica juncea (L.) Czern.Stem blightIndia[87]
Kentucky bluegrassPoa pratensis L.Leaf spotOntario[88]
Kidney beanPhaseolus vulgaris L.Leaf spotChina[89]
KiwifruitActinidia deliciosa (A.Chev.) C.F.Liang & A.R.FergusonBrown/black spotChina[90]
Million bellsCalibrachoa hybrid cultivarLeaf spotArgentina[91]
Pearl milletCenchrus americanus (L.) Morrone (syn. Pennisetum americanum (L.) Leeke)Leaf spotIran[92]
PeppermintMentha spicata L.Brown leaf spotIran[93]
PoplarPopulus alba L. × P. berolinensis Dipp. (hybrid poplar)Leaf blightChina[94]
RiceOryza sativa L.Sheaths and grains of sheath rotBangladesh[95]
TobaccoNicotiana tabacum L.Leaf spotChina[96]
WatermelonCitrullus lanatus (Thunb.) Matsum. & NakaiLeaf spotChina[97]
WheatTriticum aestivum Vill.Dark brown to black lesionsKazahstan[98]
Crown and root rotKazahstan[99]
Wild riceOryza rufipogon Griff.Leaf spotChina[100]
Zebra leaf
aloe
Aloe zebrina BakerFlower malformationNamibia[101]
Nigrospora osmanthiFiddle-leaf figFicus pandurata HanceLeaf blightChina[102]
Java teaOrthosiphon stamineus Benth.Leaf blightMalaysia[103]
St. Augustine grassStenotaphrum secundatum (Walter) KuntzeLeaf blightChina[104]
Tartary buckwheatFagopyrum tataricum (L.) Gaertn.Leaf spotChina[105]
Nigrospora paniciBig marigoldTagetes erecta L.Leaf blightBangladesh[106]
French
marigold
Tagetes patula L.Leaf blightBangladesh[106]
Nigrospora pyriformisSugarcaneSaccharum officinarum L.Leaf spotChina[30]
White
goosefoot
Chenopodium album L.Leaf spotChina[107]
Nigrospora sacchari-officinarumSugarcaneSaccharum officinarum L.Leaf spotChina[30]
Nigrospora saccharicolaSugarcaneSaccharum officinarum L.Leaf spotChina[30]
Nigrospora singularisSugarcaneSaccharum officinarum L.Leaf spotChina[30]
Nigrospora sp.Black teaCamellia sinensis L.Blister blight lesionsIndia[108]
Cochineal
cactus
Nopalea cochenillifera (L.) Salm-DyckBrown spotBrazil[68]
MaizeZea mays L.Weight/discoloration/necrosis of grainsBrazil[109]
Nigrospora sphaericaBalloon flowerPlatycodon grandiflorus (Jacq.) A. DC.NecrosisChina[28]
Black teaCamellia sinensis L.Leaf blightIndia[110]
China[111]
BlueberryVaccinium corymbosum L.Leaf spot, twig and shoot blightArgentina[112]
CalabashLagenaria siceraria (Molina) Standl.Leaf spotGeorgia[113]
China firCunninghamia lanceolata (Lamb.) Hook.Leaf blightChina[114]
Chinese
Wisteria
Wisteria sinensis (Sims) DC., 1825Leaf spotTurkey[115]
Cochineal
cactus
Nopalea cochenillifera (L.) Salm-DyckBrown spotBrazil[68]
Corn mintMentha canadensis L.Leaf blightChina[116]
Cowpea Vigna unguiculata (L.) Walp.Leaf spotIndia[117]
CurcumaCurcuma wenyujin Y.H.Chen & C.LingLeaf blightChina[118]
Date palmPhoenix dactylifera L.Not applicableIraq[119]
Root diseaseOman[120]
Leaf spotPakistan[121]
DevilpepperRauvolfia serpentina (L.) Benth. ex KurzLeaf spot and antracnoseBangladesh[122]
Dragon fruitSelenicereus monacanthus (hort. ex Lem.) D.R.Hunt (syn. Hylocereus polyrhizus (F.A.C.Weber) Britton & Rose)Reddish-brown spotMalaysia[71]
Dragon fruit (pitaya)Selenicereus undatus (Haw.) D.R.Hunt (syn. Hylocereus undatus (Haw.) Britton & Rose)Reddish-brown spotPhilippines[123]
Reddish-brown spotChina[124]
Elephant grassCenchrus purpureus (Schumach.) MorroneLeaf blightChina[125]
European nettle treeCeltis australis L., 1753Leaf spotIndia[126]
False DaisyEclipta prostrata (L.) L.Leaf spotChina[127]
Kinnow mandarinhybrid: Citrus nobilis Lour. × Citrus deliciosa Ten.Leaf spotPakistan[128]
KiwifruitActinidia deliciosa (A. Chev.) C.F.Liang & A.R.FergusonLeaf spotChina[129]
LiqouriceGlycyrrhiza glabra L.Leaf spotIndia[130]
MangoMangifera indica L.Leaf spotIndia[131]
Twig dieback and leaf spotEgypt[132]
Moonlight cactusSelenicereus monacanthus (hort. ex Lem.) D.R.Hunt (syn. Hylocereus monacanthus (hort. ex Lem.) Britton & Rose)Reddish-brown spotPhilippines[123]
MulberryMorus alba Hort. ex Loudon LShot hole China[133]
India[134]
Passion fruitPassiflora edulis SimsLeaf blightChina[135]
PeanutArachis hypogaea L.Leaf blightChina[136]
PitayaSelenicereus megalanthus (K.Schum. ex Vaupel) Moran (syn. Hylocereus megalanthus (K.Schum. ex Vaupel) Ralf Bauer)Reddish-brown spotPhilippines[123]
Purging nutJatropha curcas L.Necrosis, chlorosisIndia[137]
Qing qian liuCyclocarya paliurus (Batalin) Iljinsk.Leaf blightChina[138]
SesameSesamum indicum L.Leaf blightChina[139]
Leaf blightPakistan[140]
SugarcaneSaccharum spp.Leaf blightChina[141]
SugarcaneSaccharum officinarum L.Leaf spotChina[30]
Three-leaf
Akebia
Akebia trifoliata (Thunb.) Koidz.Dried-shrink fruitChina[142]
Tea-oil plantCamellia oleifera C. AbelLeaf blightChina[143]
Watermelon (wild melon)Citrullus lanatus (Thunb.) Matsum. & NakaiLeaf spotMalaysia[144]
White mohoHeliocarpus americanus L.Leaf spotBrazil[145]
Nigrospora vesiculariferaSugarcaneSaccharum officinarum L.Leaf spotChina[30]
Nigrospora zimmermaniSugarcaneSaccharum officinarum L.Leaf spotChina[30]

5. Conclusions

This study identified, described and characterized three fungal species that caused leaf spot symptoms on olive trees in Croatia. Nigrospora species can be economically significant as plant pathogens, causing crop loses in agriculture. Early detection can help prevent the spreading, so it is important to identify and manage leaf spot promptly to prevent it from causing damage to olive trees. Over time, repeated infections can weaken the olive tree. Weakened trees are more susceptible to other diseases and environmental stressors, which can lead to a decline in the tree’s overall health and longevity. Also, fungi can spread to other parts of the tree and neighboring trees, which can lead to more widespread infections and increased management challenges for growers. Additionally, the cost of managing and treating leaf spot diseases can add to production expenses. In conclusion, leaf spot diseases on olive trees are important because they can negatively affect the tree’s health, fruit quality, and overall productivity. Olive growers need to monitor for leaf spot diseases and implement effective management strategies to minimize their impact and ensure a healthy and productive orchard. It is also necessary to conduct further research that will include monitoring these fungal diseases and studying the effectiveness of various substances or treatments in inhibiting the growth and reproduction of these fungi.
To our knowledge, this paper is the first report of Nigrospora species causing diseases on olives and the first report of Nigrospora philosophiae-doctoris causing plant disease.

Author Contributions

Conceptualization, E.P. and S.G.; methodology, E.P. and S.G.; investigation, E.P. and S.G., writing—original draft preparation, E.P.; writing—review and editing, S.G., K.V., J.Ć. and E.Đ. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Croatian Science Foundation Installation Research Project “Natural bioactive compounds as a source of potential antimicrobial agents in the control of bacterial and other fungal pathogens of olives”, Anti-Mikrobi-OL (AMO), UIP-2020-02-7413, and “Young Researchers’ Career Development Project” DOK-2021-02-2882.

Data Availability Statement

All sequence data are available in NCBI GenBank in accordance with the accession numbers in the manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. FAO. Food and Agriculture Organization of the United Nations. Crop and Livestock Products. Available online: https://www.fao.org/faostat/en/#data/QCL (accessed on 19 January 2023).
  2. FAO. Food and Agriculture Organization of the United Nations. Land & Water. Available online: https://www.fao.org/land-water/databases-and-software/crop-information/olive/en/ (accessed on 19 January 2023).
  3. Varanda, C.M.R.; Materatski, P.; Landum, M.; Campos, M.D.; Rosário Fėlix, M.D. Fungal communities associated with peacock and cercospora leaf spots in olive. Plants 2019, 8, 169. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Figueres, G. Repilos del Olivo: Ataque en Fruto; Phytoma España: Valencia, Spain, 1991; pp. 31–36. [Google Scholar]
  5. Civantes, M. Olive Pest and Disease Management; IOCC: Towson, MD, USA, 1999. [Google Scholar]
  6. Benitez, Y.; Botella, M.A.; Trapero, A.; Alsalimiya, M.; Caballero, J.L.; Dorado, G.; Muñoz-Blanco, J. Molecular analysis of the interaction between Olea europaea and the biographic fungus Spilocaea oleagina. Mol. Plant Pathol. 2005, 6, 425–438. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Obanor, F.; Jaspers, M.; Jones, E.E.; Walter, M. Greenhouse and field evaluation of fungicides for control of olive leaf spot in New Zealand. Crop Prot. 2008, 27, 1335–1342. [Google Scholar] [CrossRef] [Scilit]
  8. Sanei, S.; Razav, S. Survey of Spilocaea oleagina, causal agent of olive leaf spot, in North of Iran. J. Yeast Fungal Res. 2011, 2, 33–38. [Google Scholar] [CrossRef] [Scilit]
  9. Basim, E.; Basim, H.; Abdulai, M.; Baki, D.; Ozturk, N. Identification and characterization of Alternaria alternata causing leaf spot of olive tree (Olea europaea) in Turkey. Crop Prot. 2017, 92, 79–88. [Google Scholar] [CrossRef] [Scilit]
  10. Sergeeva, V.; Spooner-Hart, R.; Nair, N.G. First report of Colletotrichum acutatum and C. gloeosporioides causing leaf spots of olives (Olea europaea) in Australia. Australas. Plant Dis. Notes 2008, 3, 143–144. [Google Scholar]
  11. Trouillas, F.P.; Nouri, M.T.; Lawrence, D.P.; Moral, J.; Travadon, R.; Aegerter, B.J.; Lightle, D. Identification and Characterization of Neofabraea kienholzii and Phlyctema vagabunda Causing Leaf and Shoot Lesions of Olive in California. Plant Dis. 2019, 103, 3018–3030. [Google Scholar] [CrossRef] [Scilit]
  12. Zimmerman, A. Ueber einige an tropischen Kulturpfianzen beobachtete Pilze III. Zentralblatt Bakteriol. Parasitenkd. 1992, 8, 216–221. [Google Scholar]
  13. Barnett, H.L.; Hunter, B.B. Illustrated Genera of Imperfect Fungi, 4th ed.; APS Press: St. Paul, MN, USA, 1998. [Google Scholar]
  14. Kirk, P.M.; Cannon, P.F.; Minter, D.W.; Stalpers, J.A. Dictionary of the Fungi. Mycol. Res. 2008, 113, 908–910. [Google Scholar]
  15. Wang, M.; Liu, F.; Crous, P.W.; Cai, L. Phylogenetic reassessment of Nigrospora: Ubiquitous endophytes, plant and human pathogens. Persoonia 2017, 39, 118–142. [Google Scholar] [CrossRef] [Scilit]
  16. Hyde, K.D.; Norphanphoun, C.; Maharachchikumbura, S.S.N.; Bhat, D.J.; Jones, E.B.G.; Bundhun, D.; Chen, Y.J.; Bao, D.F.; Boonmee, S.; Calabon, M.S.; et al. Refiend families of Sordariomycetes. Mycosphere 2020, 11, 305–1059. [Google Scholar] [CrossRef] [Scilit]
  17. MycoBank Database. Available online: https://www.mycobank.org/Basic%20names%20search (accessed on 18 September 2023).
  18. Fisher, P.J.; Petrini, O.; Petrini, L.E.; Descals, E. A preliminary study of fungi inhabiting xylem and whole stems of Olea europaea. Sydowia 1992, 44, 117–121. [Google Scholar]
  19. Landum, M.C.; Félix, M.d.R.; Alho, J.; Garcia, R.; Cabrita, M.J.; Rei, F.; Varanda, C.M. Antagonistic activity of fungi of Olea europaea L. against Colletotrichum acutatum. Microbiol. Res. 2016, 183, 100–108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  20. Su, Y.-Y.; Qi, Y.-L.; Cai, L. Induction of sporulation in plant pathogenic fungi. Mycology 2012, 3, 195–200. [Google Scholar]
  21. Kindo, A.J.; Tupaki-Sreepurna, A.; Yuvaraj, M. Banana peel culture as an indigenous medium for easy identification of late-sporulation human fungal pathogens. Indian J. Med. Microbiol. 2016, 34, 457–461. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. White, T.J.; Bruns, T.D.; Lee, S.B.; Taylor, J.W. 38—Amplification and direct sequencing of fungal ribosomal RNA Genes for phylogenetics. In PCR—Protocols and Applications—A Laboratory Manual; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press, Inc.: Cambridge, MA, USA, 1990; pp. 315–322. [Google Scholar]
  23. EPPO. European and Mediterranean Plant Protection Organization. PM 7/129 (1) DNA barcoding as an identification tool for a number of regulated pests. Bull. OEPP 2016, 46, 501–537. [Google Scholar] [CrossRef] [Scilit]
  24. Woudenberg, J.H.C.; Aveskamp, M.M.; de Grutyer, J.; Spiers, A.G.; Crous, P.W. Multiple Didymella teleomorphs are linked to the Phoma clematidina morphotype. Persoonia 2009, 22, 56–62. [Google Scholar] [CrossRef] [Scilit]
  25. Carbone, I.; Kohn, L.M. A Method for Designing Primer Sets for Speciation Studies in Filamentous Ascomycetes. Mycologia 1995, 91, 553–556. [Google Scholar] [CrossRef] [Scilit]
  26. Hao, Y.; Aluthmuhandiram, J.V.S.; Chethana, K.W.T.; Manawasinghe, I.S.; Li, X.; Liu, M.; Hyde, D.K.; Phillips, A.J.L.; Zhang, W. Nigrospora Species Associated with Various Hosts from Shandong Peninsula, China. Mycobiology 2020, 48, 169–183. [Google Scholar] [CrossRef] [Scilit]
  27. Saitou, N.; Nei, M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar]
  28. Chen, Q.; Bakhshi, M.; Balci, Y.; Broders, K.D.; Cheewangkoon, R.; Chen, S.F.; Fan, X.L.; Gramaje, D.; Halleen, F.; Jung, M.H.; et al. Genera of phytopathogenic fungi: GOPHY 4. Stud. Mycol. 2022, 101, 417–564. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  29. Slippers, B.; Crous, P.W.; Denman, S.; Coutinho, T.A.; Wingfield, B.D.; Wingfield, M. Combined multiple gene genealogies and phenotypic characters differentiate several species previously identified as Botryosphaeria dothidea. Mycologia 2004, 96, 83–101. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  30. Raza, M.; Zhang, Z.-F.; Hyde, K.D.; Diao, Y.-Z.; Cai, L. Culturable plant pathogenic fungi associated with sugarcane in southern China. Fungal Diver 2019, 99, 1–104. [Google Scholar] [CrossRef] [Scilit]
  31. Crous, P.W.; Carnegie, A.J.; Wingfield, M.J.; Sharma, R.; Mughini, G.; Noordeloos, M.E.; Santini, A.; Shouche, Y.S.; Bezerra, J.D.P.; Dima, B.; et al. Fungal Planet description sheets: 868–950. Persoonia 2019, 42, 291–473. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Felsenstein, J. Confidence limits on phylogenies: An approach using the bootstrap. Evolution 1985, 39, 783–791. [Google Scholar] [CrossRef] [Scilit]
  33. Tamura, K.; Nei, M.; Kumar, S. Prospects for inferring very large phylogenies by using the neighbor-joining method. Proc. Natl. Acad. Sci. USA 2004, 101, 11030–11035. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Tamura, K.; Stecher, G.; Kumar, S. MEGA 11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [Scilit]
  35. Rashmi, M.; Kushveerm, J.; Sarma, V. A worldwide list of endophytic fungi with notes on ecology and diversity. Mycosphere 2019, 10, 798–1079. [Google Scholar] [CrossRef] [Scilit]
  36. Sun, X.D.; Cai, X.L.; Pang, Q.Q.; Zhou, M.; Zhang, W.; Chen, Y.S.; Bian, Q. First record of leaf spot disease on Costus speciosus caused by Nigrospora oryzae in Hainan, China. Plant Dis. 2021, 105, 506. [Google Scholar] [CrossRef] [Scilit]
  37. Ngoko, Z.; Marasas, W.F.O.; Rheeder, J.P.; Shephard, G.S.; Wingfield, M.J.; Cardwell, K.F. Fungal infection and mycotoxin contamination of maize in the humid forest and the western highlands of Cameroon. Phytoparasitica 2001, 29, 352–360. [Google Scholar] [CrossRef] [Scilit]
  38. Barkat, E.H.; Hardy, G.E.S.J.; Ren, Y.; Calver, M.; Bayliss, K.L. Fungal contaminants of stored wheat vary between Australian states. Australas. Plant Pathol. 2016, 45, 621–628. [Google Scholar]
  39. Moreira, S.I.; Dutra, D.; Rodrigues, A.; de Oliveira, J.; Dhingra, O.; Pereira, O. Fungi and bacteria associated with post-harvest rot of ginger rhizomes in Espírito Santo, Brazil. Trop. Plant Pathol. 2013, 38, 218–226. [Google Scholar]
  40. Kwon, Y.; Kim, M.; Kwack, Y.-B.; Kwak, Y.-S. First report of Nigrospora sp. causing kiwifruit postharvest black rot. N. Z. J. Crop Hortic. Sci. 2016, 45, 75–79. [Google Scholar] [CrossRef] [Scilit]
  41. Li, L.; Pan, H.; Chen, M.Y.; Zhang, S.J.; Zhong, C.H. First report of Nigrospora oryzae causing brown/black spot disease of kiwifruit in China. Plant Dis. 2018, 102, 243. [Google Scholar] [CrossRef] [Scilit]
  42. Shahzad, S.; Ghaffar, A. New records of soilborne root infecting fungi in Pakistan. Pak. J. Bot. 1995, 27, 209–216. [Google Scholar]
  43. Lucca, A.J.D.; Mich, M.; Boue, S.; Cleveland, T.E.; Sien, T.; Walsh, T.J. Fungicidal activity of plant saponin CAY-i for fungi isolated from diseased vitis fruit and stems. Am. J. Enol. Vitic. 2008, 59, 67–72. [Google Scholar] [CrossRef] [Scilit]
  44. Dahlberg, K.R.; Etten, J. Physiology and biochemistry of fungal sporulation. Annu. Rev. Phytopathol. 1982, 20, 281–301. [Google Scholar] [CrossRef] [Scilit]
  45. Riddell, R.W. Permanent stained mycological preparations obtained by slide culture. Mycologia 1950, 42, 265–270. [Google Scholar] [CrossRef] [Scilit]
  46. Masangkay, R.F.; Paulitz, T.C.; Hallett, S.G.; Watson, A.K. Characterization of sporulation of Alternaria alternata f. sp. sphenocleae. Biocontrol Sci. Technol. 2000, 10, 385–397. [Google Scholar] [CrossRef] [Scilit]
  47. Wu, P.-C.; Tsai, J.-C.; Li, F.-C.; Lung, S.-C.; Su, H.-J. Increased levels of ambient fungal spore in Taiwan are associated with dust events from China. Atmos. Environ. 2004, 38, 4879–4886. [Google Scholar] [CrossRef] [Scilit]
  48. Webster, J. Spore projection in hyphomycete Nigrospora sphaerica. New Phytol. 1952, 51, 229–235. [Google Scholar] [CrossRef] [Scilit]
  49. Savulescu, T.; Rayss, T. Contribution a la connaissance de la hiologie de Nigrospora oryzae (B. et Br.) Petch Parasite du mats. Rec. Trav. Cryptogam. dédiés à Louis Mangin. Muséum Nat. d’Hist. Nat. Paris 1931, 233–240. [Google Scholar]
  50. Alfaro, A. El Ácara Pediculopsis graminum Reut. y el hongo Nigrospora oryzae (Berk, et Br.). Petch en associación parasitaria sobre Tigos arogeneses. Bol. Pathol. Veg. Entomol. Agric. 1946, 16, 321. [Google Scholar]
  51. Njokuocha, R.C.; Agwu, C.O.C.; Okezie, C.E.A. Effects of weather conditions on selected airborne fungal spores in the southern part of the state of Enugu, Nigeria. Grana 2017, 56, 263–272. [Google Scholar] [CrossRef] [Scilit]
  52. Sarkar, S.; Girisham, S.; Reddym, S.M. Influence of temperature and relative humidity on the development of post-harvest rot of banana. Proc. Natl. Acad. Sci. India Sect. 2011, 81, 285–287. [Google Scholar]
  53. Li, W.J.; Hu, M.; Xue, Y.; Li, Z.; Zhang, Y.; Zheng, D.; Lu, G.; Wang, J.; Zhou, J. Five fungal pathogens are responsible for bayberry twig blight and fungicides were screened for disease control. Microorganisms 2020, 8, 689. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Rahman, A.U.; Ashraf, M.; Choudary, M.I.; Rehman, H.U.; Kazmi, M.H. Antifungal aryltetralin lignans from leaves of Podophyllum-hexandrum. Phytochemistry 1995, 40, 427–431. [Google Scholar] [CrossRef] [Scilit]
  55. Reyes-Ramirez, A.; Escudero-Abarca, B.I.; Aguilar-Uscanga, G.; Hayward-Jones, P.M.; Barboza-Corona, J.E. Antifungal activity of Bacillus thuringiensis chitinase and its potential for the biocontrol of phytopathogenic fungi in soybean seeds. J. Food Sci. 2020, 69, M131–M134. [Google Scholar] [CrossRef] [Scilit]
  56. Mohd-Baseri, N.; Anuar, M.S.K.; Shamsuhazli, N.A.S.; Zulkifli, M.A.F.; Wasoh, H.; Yusof, M.T. Antagonistic activity of wild growing mushrooms against various fungal rice pathogen. Int. Microbiol. 2023, 26, 91–98. [Google Scholar] [CrossRef] [Scilit]
  57. Sornakili, A.; Thankappan, S.; Sridharan, A.P.; Nithya, P.; Uthandi, S. Antagonistic fungal endophytes and their metabolite-mediated interactions against phytopathogens in rice. Physiol. Mol. Plant Pathol. 2020, 112, 101525. [Google Scholar] [CrossRef] [Scilit]
  58. Lu, L.; Karunarathna, S.C.; Hyde, K.D.; Suwannarach, N.; Elgorban, A.M.; Stephenson, S.L.; Al-Rejaie, S.; Jayawardena, R.S.; Tibpromma, S. Endophytic fungi associated with coffee leaves in China exhibited in vitro antagonism against fungal and bacterial pathogens. J. Fungi 2022, 8, 698. [Google Scholar] [CrossRef] [Scilit]
  59. Ramesha, K.P.; Mohana, N.C.; Nuthan, B.R.; Rakshith, D.; Satish, S. Antimicrobial metabolite profiling of Nigrospora sphaerica from Adiantum philippense L. J. Genet. Eng. Biotechnol. 2020, 18, 66. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  60. Kim, J.-C.; Choi, G.J.; Park, J.-H.; Kim, H.T.; Cho, K.Y. Activity against plant pathogenic fungi of phomalactone isolated from Nigrospora sphaerica. Pest Manag. Sci. 2001, 57, 554–559. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  61. Ibrahim, D.; Lee, C.C.; Yenn, T.W.; Zakaria, L.; Sheh-Hong, L. Effect of the extract of endophytic fungus, Nigrospora sphaerica CL-OP 30, against the growth of methicillin-resistant Staphylococcus aureus (MRSA) and Klebsiella pneumonia cells. Trop. J. Pharm. Res. 2015, 14, 2091–2097. [Google Scholar] [CrossRef] [Scilit]
  62. Luo, F.; Li, W.; Zhu, T.; Han, S.; Qiao, T.; Li, S. First report of Nigrospora aurantiaca causing leaf spot disease of Castanea mollissima in China. Plant Dis. 2020, 104, 2730. [Google Scholar] [CrossRef] [Scilit]
  63. Khoo, Y.W.; Tan, H.T.; Khaw, Y.S.; Li, S.-F.; Chong, K.P. First report of Nigrospora aurantiaca causing leaf spot on Pandanus amaryllifolius in Malaysia. J. Plant Pathol. 2022, 104, 1205–1206. [Google Scholar] [CrossRef] [Scilit]
  64. Huang, Y.; Li, Z.; Wang, H.-C.; Chen, Q.; Li, W.H. First report of leaf spot caused by Nigrospora aurantiaca in tobacco in China. Plant Dis. 2021, 105, 1569. [Google Scholar] [CrossRef] [Scilit]
  65. Manawasinghe, I.S.; Jayawardena, R.S.; Li, H.L.; Zhou, Y.Y.; Zhang, W.; Phillips, A.J.L.; Wanasinghe, D.N.; Dissanayake, A.J.; Li, X.H.; Li, Y.H.; et al. Microfungi associated with Camellia sinensis: A case study of leaf and shoot necrosis on Tea in Fuijan, China. Mycosphere 2021, 12, 430–518. [Google Scholar] [CrossRef] [Scilit]
  66. Qin, S.; Chen, X.; Zhou, X.; Zhao, J.; Baccelli, I.; Cernava, T. First report of Camellia oleifera leaf blight caused by Nigrospora chiensis. J. Plant Pathol. 2021, 103, 711–712. [Google Scholar] [CrossRef] [Scilit]
  67. Zeng, Y.; Li, L.; Zhu, T.; Han, S.; Li, S. First report of brown leaf spot disease caused by Nigrospora guiliensis on Phellodendron chinense in China. Plant Disease 2020, 104, 2518. [Google Scholar] [CrossRef] [Scilit]
  68. Conforto, C.; Lima, N.B.; Silva, F.J.A.; Câmara, M.P.S.; Macharachchikumbura, S.; Michereeff, S.J. Characterization of fungal species associated with cladode brown spot on Nopalea cochenillifera in Brazil. Eur. J. Plant Pathol. 2019, 155, 1179–1194. [Google Scholar] [CrossRef] [Scilit]
  69. Zheng, T.; Zhao, L.; Huang, M.-G.; Deng, J.-X.; Wang, Y.-H. First report of leaf spot caused by Nigrospora hainanensis on Oxalis corymbose—China. Plant Dis. 2022, 106, 1986. [Google Scholar] [CrossRef] [Scilit]
  70. Al-Nadabi, H.; Maharachchikumbura, S.S.N.; Al-Gahaffi, Z.S.; Al-Hasani, A.S.; Velazhahan, R.; Al-Sadi, A.M. Molecular identification of fungal pathogens associated with leaf spot disease of date palms (Phoenix dactylifera). All Life 2020, 13, 587–597. [Google Scholar] [CrossRef] [Scilit]
  71. Kee, Y.J.; Hafifi, A.B.M.; Huda-Shakirah, A.R.; Wong, K.L.; Jin, X.L.; Nordahliawate, M.S.S.; Zakaria, L.; Mohd, M.H. First report of reddish brown spot disease of red-fleshed dragon fruit (Hypocereus polyrhizus) caused by Nigrospora lacticolonia and Nigrospora sphaerica in Malaysia. Crop Prot. 2019, 122, 165–170. [Google Scholar] [CrossRef] [Scilit]
  72. Li, M.; Gao, Z.; Wang, Y.; Zhang, W.; Yang, J.; Gong, D.; Ma, Y.; Li, Y.; Hu, M. First report of Nigrospora lacticolonia causing leaf spot of Bougainvillea spectabilis in China. Can. J. Plant Pathol. 2022, 44, 695–701. [Google Scholar] [CrossRef] [Scilit]
  73. Zhai, L.F.; Liu, J.; Zhang, M.X.; Hong, N.; Wang, G.P.; Wang, L.P. The first report of leaf spot in Aloe vera caused by Nigrospora oryzae in China. Plant Dis. 2013, 97, 1256. [Google Scholar] [CrossRef] [Scilit]
  74. Alam, M.W.; Rehman, A.; Saira, M.; Khan, N.A.; Aslam, S.; Fiaz, M.; Muhammad, S. First report of leaf spots in Aloe vera caused by Nigrospora oryzae in Pakistan. Plant Dis. 2017, 101, 841. [Google Scholar] [CrossRef] [Scilit]
  75. Begum, M.; Hamza, A.; Tanny, T.; Das, K.C.; Mahmud, M.T.; Salimullah, M.; Alam, I. First report of leaf spot disease in Aloe vera caused by Nigrospora oryzae in Bangladesh. Plant Dis. 2018, 102, 1461. [Google Scholar] [CrossRef] [Scilit]
  76. Qiu, C.; Zhu, W.; Niu, T.; Liu, Z. Nigrospora oryzae causing leaf spot on asiatic dayflower on Chongqing, China. Plant Dis. 2022, 106, 763. [Google Scholar] [CrossRef] [Scilit]
  77. Zhang, L.Q.; Jiang, S.; Meng, J.J.; An, H.S.; Zhang, X.Y. First report of leaf spot caused by Nigrospora oryzae on blueberry in Shangai, China. Plant Dis. 2019, 103, 2473. [Google Scholar] [CrossRef] [Scilit]
  78. He, B.Y.; Cernava, T.; He, H.D.; Li, H.X.; Chen, X.Y.L.; Yang, H. First report of leaf spon on Photinia serrulata caused by Nigrospora oryzae in China. Plant Dis. 2019, 103, 2480. [Google Scholar] [CrossRef] [Scilit]
  79. Zhang, L.X.; Li, S.S.; Tan, G.J.; Shen, J.T.; He, T. First report of Nigrospora oryzae causing leaf spot on cotton in China. Plant Dis. 2012, 96, 1379. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  80. Han, S.; Yu, S.T.; Zhu, T.; Li, S.; Qiao, T.; Liu, Y.; Lin, T.; Yang, C. Nigrospora oryzae causing black leaf spot disease of Hibiscus mutabilis in China. Plant Dis. 2021, 105, 2255. [Google Scholar] [CrossRef] [Scilit]
  81. Wu, J.B.; Zhang, C.L.; Mao, P.P.; Qian, Y.S.; Wang, H.Z. First report of leaf spot caused by Nigrospora oryzae on Dendrobium candidum in China. Plant Dis. 2014, 98, 996. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  82. Yang, H.L.; Du, C.M.; Liang, L.Y.; Qin, Q.Y.; Wang, C.; Cui, D.X.; Wu, Q.G.; Zou, L. First report of Davida involucrata leaf blight caused by Nigrospora oryzae in Sichuan, China. Plant Dis. 2022, 106, 2520. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  83. Özer, G.; Paulitz, T.C.; Imren, M.; Alkan, M.; Muminjanov, H.; Dababat, A.A. Identity and pathogenicity of fungi associated with crown and root rot of dryland winter wheat in Azerbaijan. Plant Dis. 2020, 104, 2149–2157. [Google Scholar] [CrossRef] [Scilit]
  84. Widmer, T.; Kirk, A.; Kirk, G.; Guermache, F. Foliar and cane rot of Arundo donax caused by Nigrospora oryzae in Europe. Plant Dis. 2006, 90, 1107. [Google Scholar] [CrossRef] [Scilit]
  85. Liu, Z.; Zhou, S.; Qi, L.; Wang, X.; Song, J.; Li, D.; Chen, T.; Wang, Q. First report of Nigrospora oryzae causing leaf spot on ginger in China. Plant Dis. 2022, 106, 316. [Google Scholar] [CrossRef] [Scilit]
  86. Zhang, Q.H.; Huang, L.L.; Liu, Y.J.; Ai, Y.; Pend, D.H. First report of leaf spot of lotus (Nelumbo nucifera) caused by Nigrospora oryzae in China. Plant Dis. 2018, 102, 1038. [Google Scholar] [CrossRef] [Scilit]
  87. Sharma, P.; Meena, P.D.; Chauhan, J.S. First report of Nigrospora oryzae (Berk. & Broome) petch causing stem blight on Brassica juncea in India. J. Plant Pathol. 2013, 161, 439–441. [Google Scholar]
  88. Zheng, L.; Shi, F.; Kelly, D.; Hsiang, T. First report of leaf spot of Kentucky bluegrass (Poa pratensis) caused by Nigrospora oryzae in Ontario. Plant Dis. 2012, 96, 909. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  89. Luo, M.-Y.; Jiang, Y.-L. First report of leaf spot on kidney bean caused by Nigrospora oryzae in China. Plant Dis. 2022, 106, 1064. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  90. Li, L.; Pan, H.; Liu, Y.F.; Li, D.W.; Zhang, Q.; Deng, L.; Chen, M.Y.; Zhong, C.H. First report of Nigrospora sphaerica causing kiwifruit postharvest rot disease in China. Plant Dis. 2018, 102, 1666. [Google Scholar] [CrossRef] [Scilit]
  91. Borrelli, N.P.; Stancanelli, S.; Papone, M.L.; Moreno, M.V.; Stenglein, S.; Wright, E.R.; Hagiwara, J.C.; Rivera, M.C. Leaf spots on calibrachoa caused by Nigrospora oryzae. Ornam. Hortic. 2020, 26, 591–597. [Google Scholar] [CrossRef] [Scilit]
  92. Kalati, T.H.; Jahani, M.; Zare, R.; Mirzaee, M. First report of Nigrospora leaf spot on Pennisetum americanum in Iran. J. Plant Pathol. 2014, 96, 606. [Google Scholar]
  93. Farid, K.; Zafari, D.; Soleimani, M.J.; Bagherabadi, S. First report of Nigrospora oryzae causing brown leaf spot on Mentha spicata. J. Plant Pathol. 2020, 102, 1281. [Google Scholar] [CrossRef] [Scilit]
  94. Zhang, H.; Kong, N.; Ji, S.; Liu, B.; Tian, Z.; Qi, J.; Liu, Z. First report of leaf blight caused by Nigrospora oryzae on Poplar in China. Plant Dis. 2022, 106, 1063. [Google Scholar] [CrossRef] [Scilit]
  95. Shamsi, S.; Khan, A.; Shahjahan, A.K.M.; Miah, S.A. Fungal species associated with sheaths and grains of sheath rot affected rice varietes from Bangladesh. Bangladesh J. Bot. 2003, 32, 17–22. [Google Scholar]
  96. Wang, D.; Li, Y.; Sun, G.; Ai, Y.F.; Wang, F.; Wang, X. First report of leaf spot disease caused by Nigrospora oryzae on Nicotiana tabacum in China. Plant Dis. 2022, 106, 2526. [Google Scholar] [CrossRef] [Scilit]
  97. Chen, X.; Wang, N.; Yang, M.F.; Li, H.-X. First report of Nigrospora leaf spot caused by Nigrospora oryzae on watermelon in China. Plant Dis. 2019, 103, 1019. [Google Scholar] [CrossRef] [Scilit]
  98. Eken, C.; Spanbayev, A.; Tulegenova, Z.; Yechshzhanov, T. First report of Nigrospora oryzae on wheat iz Kazahstan. Plant Dis. 2016, 100, 861. [Google Scholar] [CrossRef] [Scilit]
  99. Bozoğlu, T.; Dervis, S.; Imren, M.; Amer, M.; Özdemir, F.; Paulitz, T.C.; Morgounov, A.; Dababat, A.A.; Özer, G. Fungal pathogens associated with crown and root rot of wheat in Central, Eastern, and Southeastern Kazahstan. J. Fungi 2022, 8, 417. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  100. Liu, Y.L.; Tang, J.R.; Li, Y.; Zhou, H.K. First report of leaf spot caused by Nigrospora oryzae in wild rice in China. Plant Dis. 2021, 105, 3293. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  101. Kido, L.R.; Uzabakirihno, J.D.; Chimwamourombe, P.M. Isolation and identification of pathogenic fungi associated with Aloe zebrina flower malformation—First report. J. Pure Appl. Microbiol. 2012, 6, 125–129. [Google Scholar]
  102. Liu, J.; Yang, L.; Miao, P.; Wu, D.; Cai, G.; Li, X.; Lu, J. First report of leaf blight on Ficus pinduara caused by Nigrospora osmanthi in China. Plant Dis. 2019, 103, 2685. [Google Scholar] [CrossRef] [Scilit]
  103. Ismail, S.I.; Norzaki, N.A.M.; Ya’acob, M.E.; Jamian, S. First report of Nigrospora osmanthi causing leaf blight on Orthosiphon stamineus in Malaysia. Plant Dis. 2022, 106, 770. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  104. Mei, S.S.; Wang, Z.Y.; Zhang, J.; Rong, W. First report of leaf blight on Stenotaphrum secundatum caused by Nigrospora osmanthi in China. Plant Dis. 2019, 103, 1783. [Google Scholar] [CrossRef] [Scilit]
  105. Shen, Q.; Peng, X.; He, F.; Li, S.; Xiao, Z.; Wang, H.; Tang, X.; Zhou, M. First report of Nigrospora osmanthi causing leaf spot on Tartary buckwheat in China. Plant Dis. 2021, 105, 1227. [Google Scholar] [CrossRef] [Scilit]
  106. Aktar, M.; Shamsi, S. Mycloflora associated with infected plant parts of Tagetes erecta L. and Tagetes patula L. Bangladesh J. Bot. 2021, 50, 131–140. [Google Scholar] [CrossRef] [Scilit]
  107. Chen, X.-Y.-L.; Zhang, C.; Yang, H.; Yang, M.-F.; Cernava, T. First report of leaf spot on Chenopodium album caused by Nigrospora pyriformis in China. Plant Dis. 2020, 104, 1872. [Google Scholar] [CrossRef] [Scilit]
  108. Barman, A.; Nath, A.; Thakur, D. Identification and characterization of fungi associated with blister blight lesion of tea (Camellia sinensis L. Kuntze) isolated from Meghalaya, India. Microbiol. Res. 2020, 240, 126561. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  109. Szilagyi-Zecchin, V.J.; Adamoski, D.; Rodrigues Gomes, R.; Hungria, M.; Ikeda, A.C.; Kava-Cordeiro, V.; Glienke, C.; Galli-Terasawa, L.V. Composition of endophytics fungal community associated with leaves of maize cultivated in south Brazilian field. Acta Microbiol. Immunol. Hung. 2016, 63, 449–466. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  110. Dutta, J.; Gupta, S.; Thakur, D.; Handique, P.J. First report of Nigrospora leaf blight on tea caused by Nigrospora sphaerica in India. Plant Dis. 2015, 99, 417. [Google Scholar] [CrossRef] [Scilit]
  111. Liu, Y.J.; Tang, Q.; Fang, L. First report of Nigrospora sphaerica causing leaf blight on Camellia sinensis in China. Plant Dis. 2016, 100, 221. [Google Scholar] [CrossRef] [Scilit]
  112. Wright, E.R.; Folgado, M.; Rivera, M.C.; Crelier, A.; Vasquez, P.; Lopez, S.E. Nigrospora sphaerica causing leaf spot and twig and shoot blight on blueberry: A new host of the pathogen. Plant Dis. 2008, 92, 171. [Google Scholar] [CrossRef] [Scilit]
  113. Li, Y.G.; Huang, M.H.; Sun, L.P.; Ji, P. Occurence of leaf spot on calabash caused by Nigrospora sphaerica in Georgia. Plant Dis. 2016, 100, 1506. [Google Scholar]
  114. Xu, Y.M.; Liu, Y.J. First report of Nigrospora sphaerica causing leaf bligh on Cunninghamia lanceolata—China. Plant Dis. 2017, 101, 389. [Google Scholar] [CrossRef] [Scilit]
  115. Soylu, S.; Dervis, S.; Soylu, E.M. First report of Nigrospora sphaerica causing leaf spots on Chinese Wisteria: A new host of the pathogen. Plant Dis. 2011, 95, 219. [Google Scholar] [CrossRef] [Scilit]
  116. Sun, X.D.; Cai, X.L.; Pang, Q.Q.; Zhou, M.; Zhang, W.; Chen, Y.S.; Bian, Q. First report of leaf blight on Mentha canadensis caused by Nigrospora sphaerica in China. Plant Dis. 2020, 104, 3059. [Google Scholar] [CrossRef] [Scilit]
  117. Deepika, Y.S.; Mahadevakumar, S.; Amruthesh, K.N.; Lakshmidevi, N. First report of Nigrospora sphaerica associated with leaf spot disease of Cowpea (Vigna unguiculata) from India. Plant Dis. 2020, 105, 506. [Google Scholar] [CrossRef] [Scilit]
  118. Zhang, L.X.; Song, J.H.; Tan, G.J.; Li, S.S. First report of leaf blight caused by Nigrospora sphaerica on Curcuma in China. Plant Dis. 2011, 95, 1190. [Google Scholar] [CrossRef] [Scilit]
  119. Abass, M.H.; Hameed, M.A.; Ahmed, A.N. First report of Nigrospora sphaerica (Sacc.) Mason as potential pathogen on date palm (Phoenix dactylifera L.). Can. J. Plant Pathol. 2012, 35, 75–80. [Google Scholar] [CrossRef] [Scilit]
  120. Al-Sadi, A.M.; Al-Jabri, A.H.; Al-Mazroui, S.S.; Al-Mahmooli, I.H. Characterization and pathogenicity of fungi and oomycetes associated with root disease of date palm in Oman. Crop Prot. 2012, 37, 1–6. [Google Scholar] [CrossRef] [Scilit]
  121. Alam, M.W.; Rehman, A.; Ahmad, S.; Sarwar, M.; Nawaz, A.; Khan, S.M.; Ali, S.; Aslam, S.; Mannan, A. First report of Nigrospora sphaerica causing leaf spot of date palm in Pakistan. J. Plant Pathol. 2020, 102, 223. [Google Scholar] [CrossRef] [Scilit]
  122. Yasmin, Z.; Shamsi, S. Mycoflora associated with symptomatic leaves of Rauvolfia serpentina (L.) Benth. Ex. Kurz. in Bangladesh. Bangladesh J. Plant Taxon. 2020, 27, 129–136. [Google Scholar] [CrossRef] [Scilit]
  123. Taguiam, J.D.; Evallo, E.; Bengoa, J.; Maghirang, R.; Balendres, M.A. Detection of Nigrospora sphaerica in the Philippines and the suscpetibility of three Hylocereus species to reddish-brown spot disease. J. Prof. Assoc. Cactus Dev. 2020, 22, 49–61. [Google Scholar] [CrossRef] [Scilit]
  124. Liu, F.; Wu, J.B.; Zhan, R.L.; Ou, X.C. First report of reddish brown spot disease on pitaya caused by Nigrospora sphaerica in China. Plant Dis. 2016, 100, 1792. [Google Scholar] [CrossRef] [Scilit]
  125. Han, Y.Z.; Fan, Z.W.; Wu, C.F.; Li, M.Y.; Zhou, D.D. First report of Nigrospora leaf blight on elephant grass caused by Nigrospora sphaerica in China. Plant Dis. 2019, 103, 2681. [Google Scholar] [CrossRef] [Scilit]
  126. Gautam, A.K. First report of Nigrospora sphaerica causing leaf spot on Celtis australis from Himachal Pradesh, India. Int. Lett. Nat. Sci. 2015, 40, 16–18. [Google Scholar] [CrossRef] [Scilit]
  127. Qiu, C.; Liu, C.; Niu, T.; Zhu, W.; Liu, Z. Nigrospora sphaerica causing leaf spot in a new host, Eclipta prostrata (False Daisy), in China. J. Phytopathol. 2022, 170, 242–246. [Google Scholar] [CrossRef] [Scilit]
  128. Alam, M.W.; Rehman, A.; Gleason, M.L.; Riaz, K.; Saira, M.; Aslam, S.; Rosli, H.; Muhammad, S. First report of Nigrospora sphaerica causing leaf spot on Kinnow mandarin in Pakistan. J. Plant Pathol. 2017, 99, 295. [Google Scholar]
  129. Chen, Y.; Yang, X.; Zhang, A.F.; Zhang, H.Y.; Gu, C.Y.; Hameed, U.; Qi, Y.J.; Xu, Y.L. First report of leaf spot caused by Nigrospora sphaerica on kiwifruit in China. Plant Dis. 2016, 100, 2326. [Google Scholar] [CrossRef] [Scilit]
  130. Verma, O.P.; Gupta, R.B.L. A new host for Nigrospora sphaerica causing leaf spots on Glycyrrhiza glabra. Plant Pathol. 2008, 57, 782. [Google Scholar] [CrossRef] [Scilit]
  131. Pandey, A.; Pandey, S.; Awasthi, A.K. A new host record of Nigrospora sphaerica on Mangifera indica from Jabalpur, India. J. Mycol. Plant Pathol. 2013, 43, 255–256. [Google Scholar]
  132. Youssef, K.; Mosa, M.A.; Kamhawy, M.A. First report of Nigrospora sphaerica causing twig dieback and leaf spot of mango in Egypt. J. Plant Pathol. 2022, 104, 1571. [Google Scholar] [CrossRef] [Scilit]
  133. Chen, J.; Xiang, T.T.; Liu, X.Y.; Wang, W.H.; Zhang, B.L.; Liu, J.; Zhou, W.; Wan, Y.J.; Chen, G.; Zhu, H.S. First report of Nigrospora sphaerica causing shot hole disease on mulberry in China. Plant Dis. 2018, 102, 245. [Google Scholar] [CrossRef] [Scilit]
  134. Arunakumar, G.S.; Gnanesh, B.N.; Supriya, M.; Sivaprasad, V. First report of Nigrospora sphaerica causing shot hole disease on mulberry in India. Plant Dis. 2019, 103, 1783. [Google Scholar] [CrossRef] [Scilit]
  135. Wang, Y.; Cernava, T.; Zhou, X.; Yang, L.; Baccelli, I.; Wang, J.; Gou, Y.; Sang, W.; Chen, X. First report of passion fruit leaf blight caused by Nigrospora sphaerica in China. Plant Dis. 2022, 106, 323. [Google Scholar] [CrossRef] [Scilit]
  136. Liu, X.; Yu, F.; Fu, D.; Yang, W. First report of leaf blight on peanut caused by Nigrospora sphaerica in China. J. Plant Pathol. 2020, 102, 1269. [Google Scholar] [CrossRef] [Scilit]
  137. Hernández-Cubero, L.C.; Ampofo, P.; Montes, J.M.; Voegele, R.T. Identification of pathogenic fungi and preliminary screening for resistance in Jatropha curcas L. germplasm. Eur. J. Plant Pathol. 2017, 149, 325–336. [Google Scholar] [CrossRef] [Scilit]
  138. Zheng, X.; Liu, C.; Zhang, M.; Shang, X.; Fang, S.; Chen, F. First report of leaf blight of Cyclocarya paliurus caused by Nigrospora sphaerica in China. Crop Prot. 2021, 140, 105453. [Google Scholar] [CrossRef] [Scilit]
  139. Zhao, H.; Liu, H.Y.; Yang, X.S.; Liu, Y.X.; Ni, Y.X.; Wang, F.; Tang, L. First report of Nigrospora leaf blight on sesame caused by Nigrospora sphaerica in China. Plant Dis. 2014, 98, 842. [Google Scholar] [CrossRef] [Scilit]
  140. Rehman, A.; Alam, M.W.; Saira, M.; Naz, S.; Mushtaq, R.; Chohan, T.A.; Din, S.U.; Noureen, A.; Gilani, K.; Hussain, D. Nigrospora sphaerica causing leaf blight disease on sesame in Palkistan. Plant Dis. 2022, 106, 317. [Google Scholar] [CrossRef] [Scilit]
  141. Cui, Y.P.; Wu, B.; Peng, A.T.; Li, Z.L.; Lin, J.F.; Song, X.B. First report of Nigrospora leaf blight on sugarcane caused by Nigrospora sphaerica in China. Plant Dis. 2018, 102, 824. [Google Scholar] [CrossRef] [Scilit]
  142. Hong, X.; Chen, S.; Wang, L.; Liu, B.; Yang, Y.; Tang, X.; Liu, Y.S.; Huang, S. First report of Nigrospora sphaerica causing fruit dried-shrink disease in Akebia trifolitata from China. Plant Dis. 2021, 105, 2244. [Google Scholar] [CrossRef] [Scilit]
  143. Liu, Y.J.; Hu, F.; Chen, L.S.; Xu, S.W. First report of Nigrospora sphaerica causing leaf blight on oil tea (Camellia oleifera) in China. Plant Dis. 2020, 104, 3252. [Google Scholar] [CrossRef] [Scilit]
  144. Ismail, S.I.; Razak, N.F.A. First report of Nigrospora sphaerica causing leaf spot on watermelon (Citrullus lanatus L.) in Malaysia. Plant Dis. 2020, 105, 488. [Google Scholar] [CrossRef] [Scilit]
  145. Bernardi, C.; Busso, C.; Borin, R.C.; Mazaro, S.M.; Saburo, R.S.S. The first report of Nigrospora sphaerica associated with Helicarpus americanus seeds in Brazil. Floresta Ambiente 2021, 28, e20190103. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Locations of collected samples: Vabriga, and Špainidiga in Istria, and Jadranovo in Kvarner Gulf.
Figure 1. Locations of collected samples: Vabriga, and Špainidiga in Istria, and Jadranovo in Kvarner Gulf.
Horticulturae 09 01067 g001
Figure 2. Symptoms on olive leaves, (a) Nigrospora gorlenkoana, (b) Nigrospora osmanthi, (c,d) Nigrospora philosophiae-doctoris.
Figure 2. Symptoms on olive leaves, (a) Nigrospora gorlenkoana, (b) Nigrospora osmanthi, (c,d) Nigrospora philosophiae-doctoris.
Horticulturae 09 01067 g002
Figure 3. Phylogenetic tree based on internal transcribed spacer sequence alignment. Sequences identified in this research are highlighted with red rectangles. This analysis encompassed 51 nucleotide sequences, resulting in a final dataset comprising 595 positions.
Figure 3. Phylogenetic tree based on internal transcribed spacer sequence alignment. Sequences identified in this research are highlighted with red rectangles. This analysis encompassed 51 nucleotide sequences, resulting in a final dataset comprising 595 positions.
Horticulturae 09 01067 g003
Figure 4. Phylogenetic tree based on beta-tubulin sequence alignment. Sequences identified in this research are highlighted with red rectangles. This analysis encompassed 50 nucleotide sequences, resulting in a final dataset comprising 808 positions.
Figure 4. Phylogenetic tree based on beta-tubulin sequence alignment. Sequences identified in this research are highlighted with red rectangles. This analysis encompassed 50 nucleotide sequences, resulting in a final dataset comprising 808 positions.
Horticulturae 09 01067 g004
Figure 5. Phylogenetic tree based on translation elongation factor 1-alpha sequence alignment. Sequences identified in this research are highlighted with red rectangles. This analysis encompassed 51 nucleotide sequences, resulting in a final dataset comprising 567 positions.
Figure 5. Phylogenetic tree based on translation elongation factor 1-alpha sequence alignment. Sequences identified in this research are highlighted with red rectangles. This analysis encompassed 51 nucleotide sequences, resulting in a final dataset comprising 567 positions.
Horticulturae 09 01067 g005
Figure 6. Multilocus tree based on internal transcribed spacer, beta-tubulin, and translation elongation factor 1-alpha sequence alignment. Sequences identified in this research are highlighted with red rectangles. This analysis encompassed 48 nucleotide sequences, resulting in a final dataset comprising 1581 positions.
Figure 6. Multilocus tree based on internal transcribed spacer, beta-tubulin, and translation elongation factor 1-alpha sequence alignment. Sequences identified in this research are highlighted with red rectangles. This analysis encompassed 48 nucleotide sequences, resulting in a final dataset comprising 1581 positions.
Horticulturae 09 01067 g006
Figure 7. Left: Upper surface and reverse overview of cultures five days after incubation at 28 °C on PDA medium. Right: micrographs of isolates under the microscope with conidia. Scale bar = 10 µm, (a,b) Nigrospora gorlenkoana, (c,d) N. osmanthi, (e,f) N. philosophiae-doctoris.
Figure 7. Left: Upper surface and reverse overview of cultures five days after incubation at 28 °C on PDA medium. Right: micrographs of isolates under the microscope with conidia. Scale bar = 10 µm, (a,b) Nigrospora gorlenkoana, (c,d) N. osmanthi, (e,f) N. philosophiae-doctoris.
Horticulturae 09 01067 g007
Figure 8. (a) Symptoms on unwounded leaves, from left to right: N. philosophiae-doctoris, N. gorlenkoana, N. osmanthi. (b) Symptoms on the bottoms of unwounded leaves, top left: control, from control to right: N. philosophiae-doctoris, N. gorlenkoana, N. osmanthi. (c) Symptoms on unwounded leaf: N. philosophiae-doctoris. (d) Symptoms on wounded leaves, from left to right: control, N. philosophiae-doctoris, N. gorlenkoana, N. osmanthi.
Figure 8. (a) Symptoms on unwounded leaves, from left to right: N. philosophiae-doctoris, N. gorlenkoana, N. osmanthi. (b) Symptoms on the bottoms of unwounded leaves, top left: control, from control to right: N. philosophiae-doctoris, N. gorlenkoana, N. osmanthi. (c) Symptoms on unwounded leaf: N. philosophiae-doctoris. (d) Symptoms on wounded leaves, from left to right: control, N. philosophiae-doctoris, N. gorlenkoana, N. osmanthi.
Horticulturae 09 01067 g008
Figure 9. Symptoms on olive seedling leaves (cv. Rosinjola) in the pathogenicity test in the greenhouse, (a) Nigrospora gorlenkoana, (b) N. osmanthi, (c) N. philosophiae-doctoris after 9 days, (d) N. philosophiae-doctoris after 15 days.
Figure 9. Symptoms on olive seedling leaves (cv. Rosinjola) in the pathogenicity test in the greenhouse, (a) Nigrospora gorlenkoana, (b) N. osmanthi, (c) N. philosophiae-doctoris after 9 days, (d) N. philosophiae-doctoris after 15 days.
Horticulturae 09 01067 g009
Table 1. List of the primers used for PCR and sequencing.
Table 1. List of the primers used for PCR and sequencing.
LocusPrimerSequence (5′-3′)
Internal transcribed spacer (ITS)ITS15′ TCCGTAGGTGAACCTGCGG 3′
ITS45′ TCCTCCGCTTATTGATATGC 3′
ITS55′ GGAAGTAAAAGTCGTAACAAGG 3′
Beta-tubulinBtub2Fd5′ AACATGCGTGAGATTGTAAGT 3′
Btub4Rd5′ TAGTGACCCTTGGCCCAGTTG 3′
Translation elongation factor 1-alphaEF1-728F5′ CATCGAGAAGTTCGAGAAGG 3′
EF1-986R5′ TACTTGAAGGAACCCTTACC 3′
Table 2. PCR amplification program for ITS and EF1α region sets, according to White et al. [22], and for ITS and TUB region sets, according to Hao et al. [26].
Table 2. PCR amplification program for ITS and EF1α region sets, according to White et al. [22], and for ITS and TUB region sets, according to Hao et al. [26].
ITS1/ITS4 and EF-728F/EF-986R
HOT START 95 °CStart
Cycle
34 times
Denaturation 95 °CAnnealing 58 °CElongation 72 °CEnd
Cycle
Elongation 72 °C
3 min30 s30 s1 min10 min
ITS5/ITS4, and Btub2Fd/Btub4Rd
HOT START 95 °CStart
Cycle
34 times
Denaturation 95 °CAnnealing 58 °CElongation 72 °CEnd
Cycle
Elongation 72 °C
3 min30 s30 s1 min10 min
Table 3. Genbank accession numbers of isolates used for phylogenetic analysis based on research carried out by Chen et al. [28].
Table 3. Genbank accession numbers of isolates used for phylogenetic analysis based on research carried out by Chen et al. [28].
Species GenBank Accession NumberReferences
ITSTUBTEF1α
Botryosphaeria dothideaAY236949AY236927AY236898[29]
Nigrospora aurantiacaKX986064KY019465KY019295[15]
MN215771MN329935MN264010[30]
N. bambusaeKY385307KY385319KY385313[15]
KY385306KY385320KY385314[15]
N. brasiliensisKY569629MK720816MK753271[31]
KY569630MK720817MK753272[31]
N. cameliae-sinensisKX985986KY019460KY019293[15]
MN215775MN329939MN264014[30]
N. chinensisKX986023KY019462KY019422[15]
KX986026KY019548KY019445[15]
N. covidalisOK335209OK431479OK431485[28]
OK335210OK431480OK431486[28]
N. falsivesicularisMN215778MN329942MN264017[30]
MN215779MN329943MN264018[30]
N. globosporaOK335211OK431481OK431487[28]
OK335212OK431482OK431488[28]
N. gorlenkoanaKX986048KY019456KY019420[15]
N. guilinensisKX985983KY019459KY019292[15]
KX986063KY019608KY019404[15]
N. hainanensisKX986091/KY019415[15]
MN215780MN329944MN264019[30]
N. lacticoloniaKX985978KY019458KY019291[15]
/MN329948MN264023[30]
N. musaeKX986076KY019455KY019419[15]
KX986042KY019567KY019371[15]
N. oryzaeKX985931KY019601KY019396[15]
KX985954KY019481KY019307[15]
N. osmanthiKX986010KY019461KY019421[15]
KX986017KY019540KY019438[15]
N. philosophiae-doctorisOK335213OK431483OK431489[28]
OK335214OK431484OK431490[28]
N. pyriformisKX985940KY019457KY019290[15]
MN215787MN329988MN264026[30]
N. rubiKX985948KY019475KY019302[15]
N. sacchari-officinarumMN215791MN329954MN264030[30]
MN215792MN329955MN264031[30]
N. saccharicolaMN21578/MN264027[30]
MN215789MN329952MN264028[30]
N. singularisMN215793MN329956MN264032[30]
MN215794MN329957MN264033[30]
N. sphaericaKX985965KY019492KY019318[15]
MN215811MN329974MN264050[30]
N. vesiculariferaMN215812MN329975MN264051[30]
MN215814MN329977MN264053[30]
N. vesicularisKX986088KY019463KY019294[15]
KX985939KY019467/[15]
N. zimmermaniiKY385309KY385317KY385311[15]
MN215824MN329987MN264063[30]
Table 4. GenBank accession numbers of the sequences.
Table 4. GenBank accession numbers of the sequences.
SPECIESISOLATECOLLECTION DATEVarietiesGenbank Accession Number
ITSTUBEf1α
Nigrospora gorlenkoanaP13 LECIII24 September 2021LeccinoOP999642OQ286068OQ286069
Nigrospora osmanthiJA20 NP31 October 2021UnknownOP999639OQ275027OQ275028
Nigrospora philosophiae-doctorisR18 BI14 October 2021BužaOP999644OQ286067OQ286066
Table 5. List of techniques used for inducing sporulation of the JA20 NP isolate and results.
Table 5. List of techniques used for inducing sporulation of the JA20 NP isolate and results.
TECHNIQUES
PDA
Temperatures: 22 °C, 25 °C, 28 °C, 30 °C
1/2 strength PDA
medium
WA
Temperatures: 22 °C, 25 °C, 28 °C, 30 °C
Pine
needle extracts + WA
MEA
Temperatures: 22 °C, 25 °C, 28 °C, 30 °C
Host tissueSlide
culture
Exposure to near-ultraviolet light (12 h day/12 h night)Banana
peel
PDA +
banana medium
xxxxxxxxx
x—sporulation not determined, ✓—sporulation recorded, WA—water agar, MEA—malt extract agar.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Petrović, E.; Vrandečić, K.; Ćosić, J.; Đermić, E.; Godena, S. First Report of Nigrospora Species Causing Leaf Spot on Olive (Olea europaea L.). Horticulturae 2023, 9, 1067. https://doi.org/10.3390/horticulturae9101067

AMA Style

Petrović E, Vrandečić K, Ćosić J, Đermić E, Godena S. First Report of Nigrospora Species Causing Leaf Spot on Olive (Olea europaea L.). Horticulturae. 2023; 9(10):1067. https://doi.org/10.3390/horticulturae9101067

Chicago/Turabian Style

Petrović, Elena, Karolina Vrandečić, Jasenka Ćosić, Edyta Đermić, and Sara Godena. 2023. "First Report of Nigrospora Species Causing Leaf Spot on Olive (Olea europaea L.)" Horticulturae 9, no. 10: 1067. https://doi.org/10.3390/horticulturae9101067

APA Style

Petrović, E., Vrandečić, K., Ćosić, J., Đermić, E., & Godena, S. (2023). First Report of Nigrospora Species Causing Leaf Spot on Olive (Olea europaea L.). Horticulturae, 9(10), 1067. https://doi.org/10.3390/horticulturae9101067

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop