First Report of Nigrospora Species Causing Leaf Spot on Olive (Olea europaea L.)

Abstract

Leaf spot symptoms were spotted in two olive orchards in Istria and in Kvarner Gulf, Croatia. Fungal species from three representative isolates (P13 LECIII, R18 BI, JA20 NP) have been morphologically characterized based on the colony and conidial characteristics. Several techniques were performed for inducing the sporulation of the JA20 NP isolate. Only PDA + banana medium was successful. PCR was conducted for ITS, TUB, and EF1α gene regions. Phylogenetic analyses were performed using internal transcribed spacer, beta-tubulin, and translation elongation factor 1-alpha sequence data. Three types of tests were conducted: a pathogenicity test on detached leaves, on detached and scratched leaves, and on olive seedlings. Ultimately, from the morphological characterizations, DNA sequence analysis of ITS, TUB, and EF1α gene regions, and phylogenetic analysis, these species were identified as Nigrospora gorlenkoana Novobr., Nigrospora osmanthi Mei Wang & L. Cai, and Nigrospora philosophiae-doctoris M. Raza, Qian Chen & L. Cai. This is the first report of Nigrospora species causing leaf spot on olive trees and the first report of Nigrospora philosophiae-doctoris as a plant pathogen. Fungal leaf diseases in conditions that are favorable for infection and disease development can lead to a decrease in the yield and olive oil quality. Therefore, it is necessary to conduct further research and the monitoring of fungal leaf diseases.

1. Introduction

The olive tree, Olea europaea L., is among the world’s most important crops. At present, the approximate production levels per year are 23.0 million tons of olives and 3.0 million tons of oil [1]. The crop is indigenous to the Mediterranean region with a mild, rainy winter and a hot, dry summer [2]. In the Republic of Croatia, the production area includes from the north of the Istrian peninsula, the Kvarner Gulf, and the Dalmatia coastal belt with the islands to the south. In recent years, interest in olive oil production has been rising due to certain socio-economic factors, such as a higher demand for olive oil, the possibility of achieving higher prices, and tourism development.

Among all fungal pathogens affecting olives, Venturia oleaginea (Castagne) Rossman & Crous and Pseudocercospora cladosporioides (Sacc.) U. Braun are two of the most important pathogens causing leaf spots: peacock spot disease (syn. bird’s-eye spot, olive leaf scab, olive leaf spot) and cercosporiosis (syn. cercospora leaf spot) [3]. Olive leaf spots caused by V. oleaginea and P. cladosporioides result in the defoliation of leaves and weakness or death of branches, a reduced fruit set, and a decrease in the oil yield in the following years [4,5,6,7,8].

Other fungal causal agents of leaf spot symptoms on olives are Alternaria alternata (Fr.) Keissl. [9], Colletotrichum acutatum J.H. Simmonds and C. gloeosporioides (Penz.) Penz. & Sacc. [10], Neofabraea kienholzii (Seifert, Spotts & Levesque) Spotts, Levesque & Seifert, and Phylctema vagabunda Desmazières [11].

Leaf spot usually manifests as small, circular-to-elliptical spots on the leaves. Spots are initially green or yellow-green but gradually turn brown or black as the disease progresses. They often have a dark border and may have a yellow halo around them. In severe cases, the spots can merge, leading to significant defoliation. Leaf spot fungi usually thrive in warm and humid conditions. Rain or overhead irrigation can facilitate the spread of the disease by splashing fungal spores onto healthy leaves. The disease exhibits its highest activity during the wetter months of the year. While leaf spot primarily affects the leaves, a severe infection can weaken the tree and reduce its overall vitality. In severe cases, defoliation can expose fruit to direct sunlight, leading to sunburn and reduced fruit quality. Leaf spot diseases also weaken trees by interrupting the process of photosynthesis. This means the tree produces less energy, which can lead to stunted growth and smaller and less flavorful olives. This can be problematic for olive growers who rely on high-quality fruit for oil production or table olives. Leaf spot diseases can also affect the appearance of olive trees, which may be a concern for growers who want their orchard to be visually appealing. Management practices, such as maintaining good tree spacing and air circulation, pruning, avoiding excessive moisture on the leaves, proper disposal of infected leaves and pruning debris, planting resistant cultivars, etc., can help to maintain the health and productivity of olive orchards.

This study focuses on fungal species from the Nigrospora genus, new causal agents of a leaf spot symptom on olives. The Nigrospora genus has been introduced in 1902. for N. panici, which was isolated as an endophyte from leaves of Panicum amphibium in Java, Indonesia [12]. Based on its conidial characteristics, Nigrospora was placed in Dermateaceae (Moniliales) by Barnett and Hunter [13]. Kirk et al. [14] assigned Nigrospora and its Khuskia sexual morph to Trichosphaeriaceae (Trichosphaeriales). Wang et al. [15] placed the Nigrospora species in the family Apiosporaceae based on the phylogenetic analyses of combined ITS, TUB, and EF1-α sequence data of 165 strains from China and Europe [16].

Currently, there are 45 records of Nigrospora species in the MycoBank database, namely Nigrospora aerophila, N. arundinacea, N. aurantiaca, N. bambusae, N. brasiliensis, N. camelliae-sinensis, N. canescens, N. chinensis, N. cooperae, N. covidalis, N. endophytica, N. falsivesicularis, N. gallarum, N. globosa, N. globospora, N. gorlenkoana, N. gorlenkoanum, N. gossypii, N. guangdongensis, N. guilinensis, N. hainanensis, N. javanica, N. lacticolonia, N. macarangae, N. magnoliae, N. manihoticola, N. maydis, N. musae, N. oryzae, N. osmanthi, N. padwickii, N. panici, N. pernambucoensis, N. philosophiae-doctoris, N. pyriformis, N. rubi, N. sacchari, N. sacchari-officinarum, N. saccharicola, N. singularis, N. sphaerica, N. vesicularifera, N. vesicularis, N. vietnamensis, and N. zimmermanii [17].

Until now, only Nigrospora oryzae was isolated from olive trees [18,19], but it was not described as a pathogen on olives.

The aims of this research were to determine the causal agent of leaf spot symptoms on olive trees in Croatia, to morphologically characterize the fungal species from representative isolates, to molecularly identify the isolates of phytopathogenic fungal species using PCR and DNA sequence analysis of ITS, TUB, and EF1α gene regions, and to determine isolate pathogenicity in pathogenicity tests conducted in the laboratory and in a greenhouse experiment.

2. Materials and Methods

2.1. Collection of Plant Materials and Fungal Isolations

During the summer and autumn of 2021, leaf spot symptoms were spotted on olive trees on the coastal belt in Jadranovo, Kvarner Gulf (45°13′46″ N, 14°36′40″ E), and in olive orchards in Vabriga (45°17′14″ N, 13°36′41″ E) and Španidiga (45°03′02.2″ N, 13°42′43.9″ E) in Istria, Croatia (Figure 1).

The symptoms were yellow and brown spots on leaves and defoliation. The samples from symptomatic trees were collected (30 leaves from each tree) in a sterile plastic bag, placed in a portable refrigerator at +4 °C, and immediately brought to the Laboratory for Plant Protection at the Institute of Agriculture and Tourism in Poreč (Croatia) for analysis. Olive varieties on which samples were collected in Istria were ‘Buža’ and ‘Leccino’. The olive variety on which samples were collected in Kvarner Gulfs remains unknown.

Fresh olive leaves were used to isolate the causal agent of yellow and brown spots on leaves. For surface sterilization, leaves were rinsed under tap water for 1 min and transferred to aseptic conditions. Leaves were submerged in 70% ethanol for two minutes, rinsed in sterile distilled water, and placed on a sterile paper sheet in a laminar flow cabinet to surface-dry. Entire leaves were plated on potato dextrose agar (PDA) supplemented with 35 mg/L of penicillin and incubated at 25 °C under dark conditions. After seven days of incubation, the isolates were transferred into the fresh PDA medium for pure culture.

2.2. Morphological Characterization

After 7 and 30 days of incubation at 28 °C in dark conditions, pure fungal cultures were taken for examination. Fungal species, from three representative isolates (P13 LECIII, R18 BI, JA20 NP), have been characterized based on the colony characteristics (color, form, elevation, margin, surface, and opacity) and conidial characteristics (color, shape, presence or absence of septum, dimensions). A Boeco BM-2000 microscope, Boeco BCAM10 camera, and B-View software (Boeckel + Co (GmbH + Co), Hamburg, Germany) were used to capture conidia and hyphae. Isolate JA20 NP did not sporulate on PDA. Several techniques were performed for inducing the sporulation of the JA20 NP isolate. Pine needle medium was prepared according to Su et al. [20]. The banana peel technique was performed based on Kindo et al. [21]. The PDA + banana medium was prepared based on a technique for the pine needle medium described in Su et al. [20], by putting 100 g of fresh banana peel (instead of pine needle) and 20 g of potatoes into 1 L of distilled water, boiling for 30 min, filtrating, and keeping the volume at 1 L by adding distilled water. After filtration, it was amended with 20 g of agar and autoclaved for 20 min at 121 °C.

2.3. DNA Extraction, Amplification, and Sequencing

Fresh fungal mycelia of fungal isolates grown on PDA for 5 days, at 28 °C, under dark conditions, were scraped with a sterile laboratory needle from the colony margins and used for genomic DNA (deoxyribonucleic acid) extraction. Total DNA from the isolate was extracted using the Extract-N-Amp™ Plant PCR kit (Sigma-Aldrich, Merck, Saint Louis, MO, USA) according to manufacturer’s protocol. The PCR (polymerase chain reaction) amplification process was performed using ITS1/ITS4 [22], ITS5/ITS4 [23], Btub2Fd/Btub4Rd [24], and EF1-728F/EF1-986R [25] pairs of primers (

Table 1. List of the primers used for PCR and sequencing.

Locus	Primer	Sequence (5′-3′)
Internal transcribed spacer (ITS)	ITS1	5′ TCCGTAGGTGAACCTGCGG 3′
	ITS4	5′ TCCTCCGCTTATTGATATGC 3′
	ITS5	5′ GGAAGTAAAAGTCGTAACAAGG 3′
Beta-tubulin	Btub2Fd	5′ AACATGCGTGAGATTGTAAGT 3′
	Btub4Rd	5′ TAGTGACCCTTGGCCCAGTTG 3′
Translation elongation factor 1-alpha	EF1-728F	5′ CATCGAGAAGTTCGAGAAGG 3′
	EF1-986R	5′ TACTTGAAGGAACCCTTACC 3′

). The PCR reaction mixture was composed of 12.5 µL of EmeraldAmp^® GT PCR Master Mix, 0.5 µL (10 µM) of each primer, 6.5 µL of nuclease-free water, and 5 µL (4.5 ng/µL) of genomic DNA. The PCR was conducted in a SureCycler 8800 Thermal Cycler (Agilent Technologies, Santa Clara, CA, USA) using different PCR conditions for ITS, TUB, and EF1α gene regions (

Table 2. PCR amplification program for ITS and EF1α region sets, according to White et al. [22], and for ITS and TUB region sets, according to Hao et al. [26].

ITS1/ITS4 and EF-728F/EF-986R
HOT START 95 °C	Start Cycle 34 times	Denaturation 95 °C	Annealing 58 °C	Elongation 72 °C	End Cycle	Elongation 72 °C
3 min		30 s	30 s	1 min		10 min
ITS5/ITS4, and Btub2Fd/Btub4Rd
HOT START 95 °C	Start Cycle 34 times	Denaturation 95 °C	Annealing 58 °C	Elongation 72 °C	End Cycle	Elongation 72 °C
3 min		30 s	30 s	1 min		10 min

). In the case of the R18 BI isolate, amplification of the EF1-alpha region was unsuccessful. Therefore, a second PCR was conducted using 1 µL of the initial PCR amplification as the template. Electrophoresis was performed using 1% agarose gel amended with two drops of GelRed^® Nucleic Acid Gel Stain (Biotium, Fremont, CA, USA) at 110 V for 30 min in 1x TAE buffer with a BIO-RAD Power Pac 300 electrophoresis power supply (Agilent, Santa Clara, CA, USA). After electrophoresis, the PCR products were visualized using an iBright CL1000 Imaging System (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA). Purification of PCR products was performed with the GenElute™ PCR Clean-Up Kit (Sigma-Aldrich^®, Burlington, MA, USA).

2.4. DNA Sequence Assembly and Phylogenetic Analysis

Sequencing of the PCR products was performed by Macrogen Europe (Amsterdam, The Netherlands). Sequences were edited in Sequencher^® (Gene Codes Corporation, Ann Arbor, MI, USA) and compared with sequences from GenBank^®.

The phylogenetic trees were constructed and the evolutionary history of the isolated fungi was concluded based on the Neighbor-joining method [27]. Phylogenetic analysis was performed using ITS, TUB, and EF1α sequence data from isolates and relevant sequence data of Nigrospora and Botryosphaeria dothidea (outgroup) isolates from GenBank^® (a list of isolates used is presented in

Table 3. Genbank accession numbers of isolates used for phylogenetic analysis based on research carried out by Chen et al. [28].

Species		GenBank Accession Number		References
	ITS	TUB	TEF1α
Botryosphaeria dothidea	AY236949	AY236927	AY236898	[29]
Nigrospora aurantiaca	KX986064	KY019465	KY019295	[15]
	MN215771	MN329935	MN264010	[30]
N. bambusae	KY385307	KY385319	KY385313	[15]
	KY385306	KY385320	KY385314	[15]
N. brasiliensis	KY569629	MK720816	MK753271	[31]
	KY569630	MK720817	MK753272	[31]
N. cameliae-sinensis	KX985986	KY019460	KY019293	[15]
	MN215775	MN329939	MN264014	[30]
N. chinensis	KX986023	KY019462	KY019422	[15]
	KX986026	KY019548	KY019445	[15]
N. covidalis	OK335209	OK431479	OK431485	[28]
	OK335210	OK431480	OK431486	[28]
N. falsivesicularis	MN215778	MN329942	MN264017	[30]
	MN215779	MN329943	MN264018	[30]
N. globospora	OK335211	OK431481	OK431487	[28]
	OK335212	OK431482	OK431488	[28]
N. gorlenkoana	KX986048	KY019456	KY019420	[15]
N. guilinensis	KX985983	KY019459	KY019292	[15]
	KX986063	KY019608	KY019404	[15]
N. hainanensis	KX986091	/	KY019415	[15]
	MN215780	MN329944	MN264019	[30]
N. lacticolonia	KX985978	KY019458	KY019291	[15]
	/	MN329948	MN264023	[30]
N. musae	KX986076	KY019455	KY019419	[15]
	KX986042	KY019567	KY019371	[15]
N. oryzae	KX985931	KY019601	KY019396	[15]
	KX985954	KY019481	KY019307	[15]
N. osmanthi	KX986010	KY019461	KY019421	[15]
	KX986017	KY019540	KY019438	[15]
N. philosophiae-doctoris	OK335213	OK431483	OK431489	[28]
	OK335214	OK431484	OK431490	[28]
N. pyriformis	KX985940	KY019457	KY019290	[15]
	MN215787	MN329988	MN264026	[30]
N. rubi	KX985948	KY019475	KY019302	[15]
N. sacchari-officinarum	MN215791	MN329954	MN264030	[30]
	MN215792	MN329955	MN264031	[30]
N. saccharicola	MN21578	/	MN264027	[30]
	MN215789	MN329952	MN264028	[30]
N. singularis	MN215793	MN329956	MN264032	[30]
	MN215794	MN329957	MN264033	[30]
N. sphaerica	KX985965	KY019492	KY019318	[15]
	MN215811	MN329974	MN264050	[30]
N. vesicularifera	MN215812	MN329975	MN264051	[30]
	MN215814	MN329977	MN264053	[30]
N. vesicularis	KX986088	KY019463	KY019294	[15]
	KX985939	KY019467	/	[15]
N. zimmermanii	KY385309	KY385317	KY385311	[15]
	MN215824	MN329987	MN264063	[30]

). The sequences were aligned using ClustalX2 (UCD Dublin, Dublin, Ireland) software, and a phylogenetic tree was made using MEGA11 software (Pennsylvania State University, State College, PA, USA).

2.5. Pathogenicity Test

Three pathogenicity tests were conducted to determine the isolates’ pathogenicity: pathogenicity test on detached leaves, pathogenicity test on detached and scratched leaves, and pathogenicity test on olive seedlings.

2.5.1. Pathogenicity Test on Detached Leaves and Scratched Detached Leaves

In May 2022, healthy olive leaves of the cultivars Leccino and Buža were collected from a collection orchard at the Institute of Agriculture and Tourism in Poreč (Istria, Croatia). Leaves were washed with tap water, surface-sterilized in 1% sodium hypochlorite solution for three minutes, rinsed with sterilized distilled water for one minute, and placed in a laminar flow cabinet, on sterile paper, until dry. After air-drying, ten leaves of each cultivar (per isolate), scratched with a needle, and ten unscratched leaves of each cultivar (per isolate), were inoculated by placing a 5 mm-diameter mycelium plug, taken from the margins of a five-day-old PDA culture of the isolates. The same numbers of scratched and unscratched leaves inoculated using pure PDA agar plugs were used as controls. Leaves were placed on a sterile filter paper, sprayed with sterile distilled water, in a Petri dish, and protected with parafilm. Two replicates were performed. Leaves were incubated at 28 °C, in dark conditions. After nine days, samples were analyzed.

2.5.2. Pathogenicity Test on Olive Seedlings

For the whole plant assay, the fungus was grown on PDA at 28 °C for five days, and mycelia were collected. Approximately one gram of mycelia was grinded in 10 mL of sterilized distilled water. The grinded mycelia were homogenized by mixing with a vortex mixer. In the greenhouse of the Institute of Agriculture and Tourism, the grinded mycelia were injected into the petiole of the leaves of three-year-old olive seedlings of cultivar Rosinjola. Thirty leaves (ten per isolate) were inoculated with a grinded mycelium. An equal number of control leaves were inoculated with sterile distilled water to serve as a negative control. Two replicates were performed. The inoculated plants were kept in a greenhouse for two weeks. After the incubation period, samples from all tests were collected and, in an effort to adhere to Koch’s postulate, small sections of necrotic tissue from the periphery of lesions were excised and placed on PDA to isolate the inoculated fungus.

3. Results

3.1. Field Survey and Disease Symptoms

Symptoms of leaf spot were observed on mature 10- to 38-year-old trees in Istria, Croatia. Leaves were dry and yellowish to chocolate-brown in color (Figure 2). Some of them had brown spots. Defoliation was observed on leaves with expanded spots, and symptoms affected only part of the trees.

3.2. Molecular Phylogenetic Identification

For molecular identification, consensus sequences of isolates were produced and registered in GenBank^®. GenBank^® accession numbers for each isolate and its genome region are represent in

Table 4. GenBank accession numbers of the sequences.

SPECIES	ISOLATE	COLLECTION DATE	Varieties	Genbank Accession Number
				ITS	TUB	Ef1α
Nigrospora gorlenkoana	P13 LECIII	24 September 2021	Leccino	OP999642	OQ286068	OQ286069
Nigrospora osmanthi	JA20 NP	31 October 2021	Unknown	OP999639	OQ275027	OQ275028
Nigrospora philosophiae-doctoris	R18 BI	14 October 2021	Buža	OP999644	OQ286067	OQ286066

.

BLAST analysis of the sequences from the P13 LECIII isolate showed 100% similarity for ITS and TUB and 99.27% similarity for the EF1α gene region to N. gorlenkoana. BLAST analysis of the sequences from the JA20 NP isolate showed 100% similarity for ITS, TUB, and EF1α gene regions to N. osmanthi. BLAST analysis of the sequences from the R18 BI isolate showed 100% similarity for ITS and TUB and 98.64% similarity for the EF1α gene region to N. philosophiae-doctoris. Phylogenetic trees were constructed by aligning ITS, TUB, and EF1α sequences, and the evolutionary history was inferred using the Neighbor-Joining method [27]. Finally, a multilocus tree was created from a combination of ITS, TUB, and EF1α sequence alignments. The optimal trees are displayed in Figure 3, Figure 4, Figure 5 and Figure 6. Beneath the branches are the percentages of replicate trees where related taxa clustered together in the bootstrap test based on 1000 replicates [32]. The Maximum Composite Likelihood method [33] was used to calculate evolutionary distances, expressed in the units of base substitutions per site. The Botryosphaeria dothidea isolate CMW8000 was used as the outgroup. Ambiguous positions were excluded via pairwise detection using MEGA11 software [34].

Ultimately, from the DNA sequence analysis of ITS, TUB, and EF1α gene regions and the phylogenetic analysis, these species were identified as Nigrospora gorlenkoana Novobr., Nigrospora osmanthi Mei Wang & L. Cai, and Nigrospora philosophiae-doctoris M. Raza, Qian Chen & L. Cai.

3.3. Morphological Characterization and Fungal Incidence

Regarding sporulation, successful sporulation of the JA20 NP isolate was observed exclusively when it was cultured on a PDA + banana medium, as shown in

Table 5. List of techniques used for inducing sporulation of the JA20 NP isolate and results.

TECHNIQUES
PDA Temperatures: 22 °C, 25 °C, 28 °C, 30 °C	1/2 strength PDA medium	WA Temperatures: 22 °C, 25 °C, 28 °C, 30 °C	Pine needle extracts + WA	MEA Temperatures: 22 °C, 25 °C, 28 °C, 30 °C	Host tissue	Slide culture	Exposure to near-ultraviolet light (12 h day/12 h night)	Banana peel	PDA + banana medium
x	x	x	x	x	x	x	x	x	✓

x—sporulation not determined, ✓—sporulation recorded, WA—water agar, MEA—malt extract agar.

.

3.3.1. Nigrospora gorlenkoana

Colonies on PDA had reached a nine-centimeter diagram after two days at 28 °C and on WA after five days and sporulated after three days of incubation on PDA medium. Colonies of N. gorlenkoana developing on PDA (Figure 7a,b) were circular-shaped with aerial, woolly mycelium, entire-margined, opaque, floccose, raised with fuzzy edges, and growing rapidly; at first, they were white, becoming light grey when they matured and the reverse initially white, becoming darker grey when they matured. Conidia of N. gorlenkoana were round-shaped, light-brown-to-black-colored and aseptated, solitary, smooth, and 10.5–13.8 × 13.5–17.3 µm in diameter ($\overline{\mathrm{x}}$= 11.9 × 15.1 µm, n = 30). Hyphae were smooth, septate, hyaline, and yellowish. On WA, colonies were white and growing poorly.

3.3.2. Nigrospora osmanthi

Colonies on PDA had reached a nine-centimeter diagram after three days at 28 °C and on WA after seven days and sporulated after five days of incubation on PDA + banana medium. Colonies of N. osmanthi developing on PDA (Figure 7c,d) were circular-shaped with an aerial, slightly woolly mycelium, entire-margined, opaque, raised a little, filiform, and growing rapidly; they were creamy-white-colored up and the reverse becoming greyish when mature. Conidia of N. osmanthi were round-shaped, black-colored, and aseptated, solitary, smooth, and 11.2–12.8 × 12.7–15.4 in diameter ($\overline{\mathrm{x}}$ = 12.5 × 15.3 µm, n = 30). Hyphae were smooth, septate, hyaline, and yellowish. On WA, colonies were white and growing poorly.

3.3.3. Nigrospora philosophiae-doctoris

Colonies on PDA had reached a nine-centimeter diagram after three days at 28 °C and on WA after nine days and sporulated after four days of incubation on PDA medium. Colonies of N. philosophiae-doctoris developing on PDA (Figure 7e,f) were circular-shaped with aerial, woolly mycelium, entire-margined, opaque, floccose, raised with fuzzy edges, and growing rapidly; they were white-to-greyish-colored and reverse initially white, becoming creamy white when mature. Conidia of N. philosophiae-doctoris were round-shaped, brown-to-black-colored, aseptated, solitary, smooth, and 10.8–15.6 × 8.4–14.4 in diameter ($\overline{\mathrm{x}}$ =11.6 × 13.2, n = 30). Hyphae were smooth, septate, and hyaline. On WA, colonies were white to greyish and growing poorly.

3.4. Pathogenicity Tests

3.4.1. Pathogenicity Test on Detached Leaves

The symptoms of the disease on olive leaves tested in the laboratory showed similar symptoms as the leaf samples collected from the field survey. All inoculated leaves had yellowish-to-chocolate-brown spots (Figure 8). No symptoms were spotted on the control leaves. The re-isolated fungus from the diseased leaves was identical to the Nigrospora species.

3.4.2. Pathogenicity Test on Olive Seedlings

The first symptoms were observed three days after inoculation. All inoculated leaves had chocolate-brown spots, similar to those observed in the field. The symptoms progressed until the entire leaf surface was covered (Figure 9). No symptoms were observed on the control leaves. The re-isolated fungus from the diseased leaves was identical to the Nigrospora species.

4. Discussion

In this study, three different species of the Nigrospora genus, i.e., N. gorlenkoana, N. osmanthi, and N. philsophiae-doctoris, were detected on olive trees in Croatia. These species were the causal agents of leaf spots on olive trees in Istria and in Kvarner Gulf (Croatia).

Nigrospora species are cosmopolitan, filamentous, dematiaceous taxa distributed on various hosts, including crops with economic importance [15,16]. These species were isolated from different hosts around the world, such as Cirsium setosum, Nelumbo sp., Oryza sativa, Vitis vinifera, etc. [26]. They are known as plant pathogens, endophytes, and saprobes [35,36]. Nigrospora species known as plant pathogens cause many diseases, but the most common disease is leaf spot. A list of reported Nigrospora pathogens, diseases, and distributions is represented in Table 6. Nigrospora sp. are also known as contaminants on farm-stored maize [37] and stored wheat [38] and are the causative agent of the post-harvest rot of ginger rhizomes [39] and post-harvest black rot of kiwifruit [40,41]. There are records of N. oryzae infecting the roots of 21 plant species [42] and N. sphaerica isolated from diseased grapevines [43], but there are no data on the pathogenicity of this fungus on the mentioned plant species.

Based on GenBank^® data, N. philosophiae-doctoris was first isolated from the plant species Disporum sessile (Thunb.) D.Don ex Schult. & Schult.f., but there are no reports of this fungus as a plant pathogen. N. philosophiae-doctoris clustered in a well-supported clade closely related to N. sacchari-officinarum and N. gorlenkoana. N. philosophiae-doctoris produces smaller conidiogenous cells, when compared to those in N. sacchari-officinarum and N. gorlenkoana, and smaller conidia than those of N. sacchari-officinarum [28]. The conidial sizes frequently overlap among morphologically similar, but phylogenetically distinct, species of Nigrospora, and identification based on molecular and phylogenetic data for this fungal species is crucial [15]. In this research for molecular identification, consensus sequences were made of ITS1, ITS5, and ITS4 sequence data for the ITS gene region, Btub2Fd, and Btub4Rd sequence data for the TUB gene region and EF-728F and EF-986R sequence data for the EF1α gene region. In our research, Nigrospora species were distinguished based on morphological and molecular data, four phylogenetic trees were made, and they support three separate species.

Sporulation in fungi usually occurs when the growth rate is reduced and is hampered under conditions that favor rapid mycelial growth [44]. Many techniques are used for inducing the sporulation of fungi, such as slide culture [45], low-nutrient media [46], sporulation on host tissue, etc. In our survey, several techniques were performed for inducing the sporulation of the JA20 NP isolate (Table 5) in order to carry out morphological research. Banana peel culture is used for inducing the sporulation of Nigrospora sphaerica [21] but was not effective for the Nigrospora osmanthi JA20 NP isolate. Interestingly, this isolate sporulates only on PDA + banana medium. Spore dispersal in Nigrospora is aided by the wind, rain splashes, and insect vectors [47], so it can be easily spread around the orchard and create defoliation and economical losses. In some cases, an irregular string of a mucilaginous substance (small hyaline drop) was found to be attached to the spore [48]. It has been hypothesized that this substance facilitates adherence to the host substrate or to a vector as a successful spore-dispersal mechanism [26]. The moth Sitotroga cerealella transports the spores of Nigrospora oryzae, which adhere to its body [49]. Alfaro [50] has described how the non-gravid females of the mite Pediculopsis graminum transport the conidia of Nigrospora oryzae in their abdominal sacks. Webster [48] states that the spores can be transmitted while adhered to the body of the mite. A study of airborne fungal spores carried out at nine locations in Nigeria showed that the numbers of Nigrospora spores significantly correlate with the relative humidity, light intensity, and temperature [51]. Research conducted on bananas has shown that with an increase in the temperature, the rotting of bananas caused by Nigrospora species speeds up, with maximum infection recorded at 30 °C [52]. In our survey, out of the four temperatures at which all three isolates were kept on PDA (represented in Table 5), the fastest growth was recorded at 28 °C. Therefore, this temperature was chosen as the incubation temperature for morphological analysis of the isolates.

Regarding protection measures, for N. oryzae, Azoxystrobin (EC50 = 0.0001 mg/L) had the most significant fungal-controlling effect, followed by Prochloraz (copper salt), 15% Difenoconazole + 15% Propiconazole, Difenoconazole, Pyraclostrobin, and Myclobutanil [53]. Lignans, isopicropodophyllone, and dehydropodophyllotoxin, isolated from the leaves of Podophyllum hexandrum (Royle) T. S. Ying of Pakistani origin showed strong antifungal activity against N. oryzae [54]. Bacillus thuringiensis var. israelensis has shown inhibitory effects against Nigrospora sp. [55]. The mushroom species Coprinellus disseminates (isolate 12b), Marasmiellus palmivorus (isolate 42b), Trametes maxima (isolate 56e), and Lentinus sajor-caju (isolate 60a) have potential antagonistic effects on Nigrospora species via the production of secondary metabolites and mycoparasitic interactions [56]. Unfortunately, there are no data about protection measures for these three species identified in this study.

Some Nigrospora species can act as an antagonist against fungal and bacterial plant pathogens [57,58]. Phomalactone from Nigrospora sphaerica exhibits a broad spectrum of antimicrobial activity against human and phytopathogenic bacteria and fungi [59], such as Phytophthora infestans (Mont.) de Bary, which causes tomato late blight [60]. An ethyl acetate extract of Nigrospora sphaerica affects the cell wall in growing methicillin-resistant Staphylococcus aureus Rosenbach and Klebsiella pneumonia (Schroeter 1886) Trevisan [61].

Table 6. A list of reported Nigrospora pathogens, diseases, and distributions.

SPECIES	HOST (Common Name)	TAXONOMY ID	DISEASE SYMPTOMS	DISTRIBUTION	REFERENCES
Nigrospora aurantiaca	Chinese chestnut	Castanea mollissima Blume	Leaf spot	China	[62]
	Pandan rampeh	Pandanus amaryllifolius Roxb.	Leaf spot	Malaysia	[63]
	Sugarcane	Saccharum officinarum L.	Leaf spot	China	[30]
	Tobacco	Nicotiana tabacum L.	Leaf spot	China	[64]
Nigrospora brasiliensis	Cochineal cactus	Nopalea cochenillifera (L.) Salm-Dyck	Brown leaf spot	Brazil	[31]
Nigrospora camelliae-sinensis	Black tea	Camellia sinensis L.	Leaf blight	China	[65]
	Sugarcane	Saccharum officinarum L.	Leaf spot	China	[30]
Nigrospora chiensis	Tea-oil plant	Camellia oleifera C. Abel	Leaf blight	China	[66]
Nigrospora falsivesicularis	Sugarcane	Saccharum officinarum L.	Leaf spot	China	[30]
Nigrospora guiliensis	Chinese corktree	Phellodendron chinense C. K. Schneid.	Leaf spot	China	[67]
Nigrospora hainanensis	Cochineal cactus	Nopalea cochenillifera (L.) Salm-Dyck	Brown spot	Brazil	[68]
	Pink wood sorrel	Oxalis corymbosa DC.	Leaf spot	China	[69]
	Sugarcane	Saccharum officinarum L.	Leaf spot	China	[30]
Nigrospora lacticolonia	Date palm	Phoenix dactylifera L.	Leaf spot	Oman	[70]
	Dragon fruit	Hylocereus polyrhizus (F.A.C.Weber) Britton & Rose	Reddish-brown spot	Malaysia	[71]
	Great Bougainvillea	Bougainvillea spectabilis Raeusch. Willd.	Leaf spot	China	[72]
	Sugarcane	Saccharum officinarum L.	Leaf spot	China	[30]
Nigrospora oryzae	Aloe-vera	Aloe vera var. chinensis (Haw.) A.Berger	Leaf spot	China	[73]
			Leaf spot	Pakistan	[74]
			Leaf spot	Bangladesh	[75]
	Asiatic dayflower	Commelina communis L.	Leaf spot	China	[76]
	Bayberry	Morella rubra Lour.	Twig blight	China	[53]
	Blueberry	Vaccinium corymbosum L.	Leaf spot	China	[77]
	Chinese photinia	Photinia serratifolia (Desf.) Kalkman (syn. Photinia serrulata Lindl.)	Leaf spot	China	[78]
	Cotton	Gossypium hirsutum L.	Leaf spot	China	[79]
	Cotton-rose	Hibiscus mutabilis Mill.	Black leaf spot	China	[80]
	Crepe-ginger	Hellenia speciosa (J.Koenig) Govaerts (syn. Costus speciosus (J.Koenig) Sm.)	Leaf spot	China	[36]
	Dendrobium (Shi Hu)	Dendrobium candidum Wall. ex Lindl.	Leaf spot	China	[81]
	Dove tree	Davidia involucrata Baill.	Leaf blight	China	[82]
	Dryland winter wheat	Triticum L.	Crown and rot root	Azerbaijan	[83]
	Giant red	Arundo donax L.	Foliar and cane rot	Europe	[84]
	Ginger	Zingiber officinale Roscoe	Leaf spot	China	[85]
	Indian lotus	Nelumbo nucifera Gaertn.	Leaf spot	China	[86]
	Indian mustard	Brassica juncea (L.) Czern.	Stem blight	India	[87]
	Kentucky bluegrass	Poa pratensis L.	Leaf spot	Ontario	[88]
	Kidney bean	Phaseolus vulgaris L.	Leaf spot	China	[89]
	Kiwifruit	Actinidia deliciosa (A.Chev.) C.F.Liang & A.R.Ferguson	Brown/black spot	China	[90]
	Million bells	Calibrachoa hybrid cultivar	Leaf spot	Argentina	[91]
	Pearl millet	Cenchrus americanus (L.) Morrone (syn. Pennisetum americanum (L.) Leeke)	Leaf spot	Iran	[92]
	Peppermint	Mentha spicata L.	Brown leaf spot	Iran	[93]
	Poplar	Populus alba L. × P. berolinensis Dipp. (hybrid poplar)	Leaf blight	China	[94]
	Rice	Oryza sativa L.	Sheaths and grains of sheath rot	Bangladesh	[95]
	Tobacco	Nicotiana tabacum L.	Leaf spot	China	[96]
	Watermelon	Citrullus lanatus (Thunb.) Matsum. & Nakai	Leaf spot	China	[97]
	Wheat	Triticum aestivum Vill.	Dark brown to black lesions	Kazahstan	[98]
			Crown and root rot	Kazahstan	[99]
	Wild rice	Oryza rufipogon Griff.	Leaf spot	China	[100]
	Zebra leaf aloe	Aloe zebrina Baker	Flower malformation	Namibia	[101]
Nigrospora osmanthi	Fiddle-leaf fig	Ficus pandurata Hance	Leaf blight	China	[102]
	Java tea	Orthosiphon stamineus Benth.	Leaf blight	Malaysia	[103]
	St. Augustine grass	Stenotaphrum secundatum (Walter) Kuntze	Leaf blight	China	[104]
	Tartary buckwheat	Fagopyrum tataricum (L.) Gaertn.	Leaf spot	China	[105]
Nigrospora panici	Big marigold	Tagetes erecta L.	Leaf blight	Bangladesh	[106]
	French marigold	Tagetes patula L.	Leaf blight	Bangladesh	[106]
Nigrospora pyriformis	Sugarcane	Saccharum officinarum L.	Leaf spot	China	[30]
	White goosefoot	Chenopodium album L.	Leaf spot	China	[107]
Nigrospora sacchari-officinarum	Sugarcane	Saccharum officinarum L.	Leaf spot	China	[30]
Nigrospora saccharicola	Sugarcane	Saccharum officinarum L.	Leaf spot	China	[30]
Nigrospora singularis	Sugarcane	Saccharum officinarum L.	Leaf spot	China	[30]
Nigrospora sp.	Black tea	Camellia sinensis L.	Blister blight lesions	India	[108]
	Cochineal cactus	Nopalea cochenillifera (L.) Salm-Dyck	Brown spot	Brazil	[68]
	Maize	Zea mays L.	Weight/discoloration/necrosis of grains	Brazil	[109]
Nigrospora sphaerica	Balloon flower	Platycodon grandiflorus (Jacq.) A. DC.	Necrosis	China	[28]
	Black tea	Camellia sinensis L.	Leaf blight	India	[110]
				China	[111]
	Blueberry	Vaccinium corymbosum L.	Leaf spot, twig and shoot blight	Argentina	[112]
	Calabash	Lagenaria siceraria (Molina) Standl.	Leaf spot	Georgia	[113]
	China fir	Cunninghamia lanceolata (Lamb.) Hook.	Leaf blight	China	[114]
	Chinese Wisteria	Wisteria sinensis (Sims) DC., 1825	Leaf spot	Turkey	[115]
	Cochineal cactus	Nopalea cochenillifera (L.) Salm-Dyck	Brown spot	Brazil	[68]
	Corn mint	Mentha canadensis L.	Leaf blight	China	[116]
	Cowpea	Vigna unguiculata (L.) Walp.	Leaf spot	India	[117]
	Curcuma	Curcuma wenyujin Y.H.Chen & C.Ling	Leaf blight	China	[118]
	Date palm	Phoenix dactylifera L.	Not applicable	Iraq	[119]
			Root disease	Oman	[120]
			Leaf spot	Pakistan	[121]
	Devilpepper	Rauvolfia serpentina (L.) Benth. ex Kurz	Leaf spot and antracnose	Bangladesh	[122]
	Dragon fruit	Selenicereus monacanthus (hort. ex Lem.) D.R.Hunt (syn. Hylocereus polyrhizus (F.A.C.Weber) Britton & Rose)	Reddish-brown spot	Malaysia	[71]
	Dragon fruit (pitaya)	Selenicereus undatus (Haw.) D.R.Hunt (syn. Hylocereus undatus (Haw.) Britton & Rose)	Reddish-brown spot	Philippines	[123]
			Reddish-brown spot	China	[124]
	Elephant grass	Cenchrus purpureus (Schumach.) Morrone	Leaf blight	China	[125]
	European nettle tree	Celtis australis L., 1753	Leaf spot	India	[126]
	False Daisy	Eclipta prostrata (L.) L.	Leaf spot	China	[127]
	Kinnow mandarin	hybrid: Citrus nobilis Lour. × Citrus deliciosa Ten.	Leaf spot	Pakistan	[128]
	Kiwifruit	Actinidia deliciosa (A. Chev.) C.F.Liang & A.R.Ferguson	Leaf spot	China	[129]
	Liqourice	Glycyrrhiza glabra L.	Leaf spot	India	[130]
	Mango	Mangifera indica L.	Leaf spot	India	[131]
			Twig dieback and leaf spot	Egypt	[132]
	Moonlight cactus	Selenicereus monacanthus (hort. ex Lem.) D.R.Hunt (syn. Hylocereus monacanthus (hort. ex Lem.) Britton & Rose)	Reddish-brown spot	Philippines	[123]
	Mulberry	Morus alba Hort. ex Loudon L	Shot hole	China	[133]
				India	[134]
	Passion fruit	Passiflora edulis Sims	Leaf blight	China	[135]
	Peanut	Arachis hypogaea L.	Leaf blight	China	[136]
	Pitaya	Selenicereus megalanthus (K.Schum. ex Vaupel) Moran (syn. Hylocereus megalanthus (K.Schum. ex Vaupel) Ralf Bauer)	Reddish-brown spot	Philippines	[123]
	Purging nut	Jatropha curcas L.	Necrosis, chlorosis	India	[137]
	Qing qian liu	Cyclocarya paliurus (Batalin) Iljinsk.	Leaf blight	China	[138]
	Sesame	Sesamum indicum L.	Leaf blight	China	[139]
			Leaf blight	Pakistan	[140]
	Sugarcane	Saccharum spp.	Leaf blight	China	[141]
	Sugarcane	Saccharum officinarum L.	Leaf spot	China	[30]
	Three-leaf Akebia	Akebia trifoliata (Thunb.) Koidz.	Dried-shrink fruit	China	[142]
	Tea-oil plant	Camellia oleifera C. Abel	Leaf blight	China	[143]
	Watermelon (wild melon)	Citrullus lanatus (Thunb.) Matsum. & Nakai	Leaf spot	Malaysia	[144]
	White moho	Heliocarpus americanus L.	Leaf spot	Brazil	[145]
Nigrospora vesicularifera	Sugarcane	Saccharum officinarum L.	Leaf spot	China	[30]
Nigrospora zimmermani	Sugarcane	Saccharum officinarum L.	Leaf spot	China	[30]

Table 6. A list of reported Nigrospora pathogens, diseases, and distributions.

SPECIES	HOST (Common Name)	TAXONOMY ID	DISEASE SYMPTOMS	DISTRIBUTION	REFERENCES
Nigrospora aurantiaca	Chinese chestnut	Castanea mollissima Blume	Leaf spot	China	[62]
	Pandan rampeh	Pandanus amaryllifolius Roxb.	Leaf spot	Malaysia	[63]
	Sugarcane	Saccharum officinarum L.	Leaf spot	China	[30]
	Tobacco	Nicotiana tabacum L.	Leaf spot	China	[64]
Nigrospora brasiliensis	Cochineal cactus	Nopalea cochenillifera (L.) Salm-Dyck	Brown leaf spot	Brazil	[31]
Nigrospora camelliae-sinensis	Black tea	Camellia sinensis L.	Leaf blight	China	[65]
	Sugarcane	Saccharum officinarum L.	Leaf spot	China	[30]
Nigrospora chiensis	Tea-oil plant	Camellia oleifera C. Abel	Leaf blight	China	[66]
Nigrospora falsivesicularis	Sugarcane	Saccharum officinarum L.	Leaf spot	China	[30]
Nigrospora guiliensis	Chinese corktree	Phellodendron chinense C. K. Schneid.	Leaf spot	China	[67]
Nigrospora hainanensis	Cochineal cactus	Nopalea cochenillifera (L.) Salm-Dyck	Brown spot	Brazil	[68]
	Pink wood sorrel	Oxalis corymbosa DC.	Leaf spot	China	[69]
	Sugarcane	Saccharum officinarum L.	Leaf spot	China	[30]
Nigrospora lacticolonia	Date palm	Phoenix dactylifera L.	Leaf spot	Oman	[70]
	Dragon fruit	Hylocereus polyrhizus (F.A.C.Weber) Britton & Rose	Reddish-brown spot	Malaysia	[71]
	Great Bougainvillea	Bougainvillea spectabilis Raeusch. Willd.	Leaf spot	China	[72]
	Sugarcane	Saccharum officinarum L.	Leaf spot	China	[30]
Nigrospora oryzae	Aloe-vera	Aloe vera var. chinensis (Haw.) A.Berger	Leaf spot	China	[73]
			Leaf spot	Pakistan	[74]
			Leaf spot	Bangladesh	[75]
	Asiatic dayflower	Commelina communis L.	Leaf spot	China	[76]
	Bayberry	Morella rubra Lour.	Twig blight	China	[53]
	Blueberry	Vaccinium corymbosum L.	Leaf spot	China	[77]
	Chinese photinia	Photinia serratifolia (Desf.) Kalkman (syn. Photinia serrulata Lindl.)	Leaf spot	China	[78]
	Cotton	Gossypium hirsutum L.	Leaf spot	China	[79]
	Cotton-rose	Hibiscus mutabilis Mill.	Black leaf spot	China	[80]
	Crepe-ginger	Hellenia speciosa (J.Koenig) Govaerts (syn. Costus speciosus (J.Koenig) Sm.)	Leaf spot	China	[36]
	Dendrobium (Shi Hu)	Dendrobium candidum Wall. ex Lindl.	Leaf spot	China	[81]
	Dove tree	Davidia involucrata Baill.	Leaf blight	China	[82]
	Dryland winter wheat	Triticum L.	Crown and rot root	Azerbaijan	[83]
	Giant red	Arundo donax L.	Foliar and cane rot	Europe	[84]
	Ginger	Zingiber officinale Roscoe	Leaf spot	China	[85]
	Indian lotus	Nelumbo nucifera Gaertn.	Leaf spot	China	[86]
	Indian mustard	Brassica juncea (L.) Czern.	Stem blight	India	[87]
	Kentucky bluegrass	Poa pratensis L.	Leaf spot	Ontario	[88]
	Kidney bean	Phaseolus vulgaris L.	Leaf spot	China	[89]
	Kiwifruit	Actinidia deliciosa (A.Chev.) C.F.Liang & A.R.Ferguson	Brown/black spot	China	[90]
	Million bells	Calibrachoa hybrid cultivar	Leaf spot	Argentina	[91]
	Pearl millet	Cenchrus americanus (L.) Morrone (syn. Pennisetum americanum (L.) Leeke)	Leaf spot	Iran	[92]
	Peppermint	Mentha spicata L.	Brown leaf spot	Iran	[93]
	Poplar	Populus alba L. × P. berolinensis Dipp. (hybrid poplar)	Leaf blight	China	[94]
	Rice	Oryza sativa L.	Sheaths and grains of sheath rot	Bangladesh	[95]
	Tobacco	Nicotiana tabacum L.	Leaf spot	China	[96]
	Watermelon	Citrullus lanatus (Thunb.) Matsum. & Nakai	Leaf spot	China	[97]
	Wheat	Triticum aestivum Vill.	Dark brown to black lesions	Kazahstan	[98]
			Crown and root rot	Kazahstan	[99]
	Wild rice	Oryza rufipogon Griff.	Leaf spot	China	[100]
	Zebra leaf aloe	Aloe zebrina Baker	Flower malformation	Namibia	[101]
Nigrospora osmanthi	Fiddle-leaf fig	Ficus pandurata Hance	Leaf blight	China	[102]
	Java tea	Orthosiphon stamineus Benth.	Leaf blight	Malaysia	[103]
	St. Augustine grass	Stenotaphrum secundatum (Walter) Kuntze	Leaf blight	China	[104]
	Tartary buckwheat	Fagopyrum tataricum (L.) Gaertn.	Leaf spot	China	[105]
Nigrospora panici	Big marigold	Tagetes erecta L.	Leaf blight	Bangladesh	[106]
	French marigold	Tagetes patula L.	Leaf blight	Bangladesh	[106]
Nigrospora pyriformis	Sugarcane	Saccharum officinarum L.	Leaf spot	China	[30]
	White goosefoot	Chenopodium album L.	Leaf spot	China	[107]
Nigrospora sacchari-officinarum	Sugarcane	Saccharum officinarum L.	Leaf spot	China	[30]
Nigrospora saccharicola	Sugarcane	Saccharum officinarum L.	Leaf spot	China	[30]
Nigrospora singularis	Sugarcane	Saccharum officinarum L.	Leaf spot	China	[30]
Nigrospora sp.	Black tea	Camellia sinensis L.	Blister blight lesions	India	[108]
	Cochineal cactus	Nopalea cochenillifera (L.) Salm-Dyck	Brown spot	Brazil	[68]
	Maize	Zea mays L.	Weight/discoloration/necrosis of grains	Brazil	[109]
Nigrospora sphaerica	Balloon flower	Platycodon grandiflorus (Jacq.) A. DC.	Necrosis	China	[28]
	Black tea	Camellia sinensis L.	Leaf blight	India	[110]
				China	[111]
	Blueberry	Vaccinium corymbosum L.	Leaf spot, twig and shoot blight	Argentina	[112]
	Calabash	Lagenaria siceraria (Molina) Standl.	Leaf spot	Georgia	[113]
	China fir	Cunninghamia lanceolata (Lamb.) Hook.	Leaf blight	China	[114]
	Chinese Wisteria	Wisteria sinensis (Sims) DC., 1825	Leaf spot	Turkey	[115]
	Cochineal cactus	Nopalea cochenillifera (L.) Salm-Dyck	Brown spot	Brazil	[68]
	Corn mint	Mentha canadensis L.	Leaf blight	China	[116]
	Cowpea	Vigna unguiculata (L.) Walp.	Leaf spot	India	[117]
	Curcuma	Curcuma wenyujin Y.H.Chen & C.Ling	Leaf blight	China	[118]
	Date palm	Phoenix dactylifera L.	Not applicable	Iraq	[119]
			Root disease	Oman	[120]
			Leaf spot	Pakistan	[121]
	Devilpepper	Rauvolfia serpentina (L.) Benth. ex Kurz	Leaf spot and antracnose	Bangladesh	[122]
	Dragon fruit	Selenicereus monacanthus (hort. ex Lem.) D.R.Hunt (syn. Hylocereus polyrhizus (F.A.C.Weber) Britton & Rose)	Reddish-brown spot	Malaysia	[71]
	Dragon fruit (pitaya)	Selenicereus undatus (Haw.) D.R.Hunt (syn. Hylocereus undatus (Haw.) Britton & Rose)	Reddish-brown spot	Philippines	[123]
			Reddish-brown spot	China	[124]
	Elephant grass	Cenchrus purpureus (Schumach.) Morrone	Leaf blight	China	[125]
	European nettle tree	Celtis australis L., 1753	Leaf spot	India	[126]
	False Daisy	Eclipta prostrata (L.) L.	Leaf spot	China	[127]
	Kinnow mandarin	hybrid: Citrus nobilis Lour. × Citrus deliciosa Ten.	Leaf spot	Pakistan	[128]
	Kiwifruit	Actinidia deliciosa (A. Chev.) C.F.Liang & A.R.Ferguson	Leaf spot	China	[129]
	Liqourice	Glycyrrhiza glabra L.	Leaf spot	India	[130]
	Mango	Mangifera indica L.	Leaf spot	India	[131]
			Twig dieback and leaf spot	Egypt	[132]
	Moonlight cactus	Selenicereus monacanthus (hort. ex Lem.) D.R.Hunt (syn. Hylocereus monacanthus (hort. ex Lem.) Britton & Rose)	Reddish-brown spot	Philippines	[123]
	Mulberry	Morus alba Hort. ex Loudon L	Shot hole	China	[133]
				India	[134]
	Passion fruit	Passiflora edulis Sims	Leaf blight	China	[135]
	Peanut	Arachis hypogaea L.	Leaf blight	China	[136]
	Pitaya	Selenicereus megalanthus (K.Schum. ex Vaupel) Moran (syn. Hylocereus megalanthus (K.Schum. ex Vaupel) Ralf Bauer)	Reddish-brown spot	Philippines	[123]
	Purging nut	Jatropha curcas L.	Necrosis, chlorosis	India	[137]
	Qing qian liu	Cyclocarya paliurus (Batalin) Iljinsk.	Leaf blight	China	[138]
	Sesame	Sesamum indicum L.	Leaf blight	China	[139]
			Leaf blight	Pakistan	[140]
	Sugarcane	Saccharum spp.	Leaf blight	China	[141]
	Sugarcane	Saccharum officinarum L.	Leaf spot	China	[30]
	Three-leaf Akebia	Akebia trifoliata (Thunb.) Koidz.	Dried-shrink fruit	China	[142]
	Tea-oil plant	Camellia oleifera C. Abel	Leaf blight	China	[143]
	Watermelon (wild melon)	Citrullus lanatus (Thunb.) Matsum. & Nakai	Leaf spot	Malaysia	[144]
	White moho	Heliocarpus americanus L.	Leaf spot	Brazil	[145]
Nigrospora vesicularifera	Sugarcane	Saccharum officinarum L.	Leaf spot	China	[30]
Nigrospora zimmermani	Sugarcane	Saccharum officinarum L.	Leaf spot	China	[30]

5. Conclusions

This study identified, described and characterized three fungal species that caused leaf spot symptoms on olive trees in Croatia. Nigrospora species can be economically significant as plant pathogens, causing crop loses in agriculture. Early detection can help prevent the spreading, so it is important to identify and manage leaf spot promptly to prevent it from causing damage to olive trees. Over time, repeated infections can weaken the olive tree. Weakened trees are more susceptible to other diseases and environmental stressors, which can lead to a decline in the tree’s overall health and longevity. Also, fungi can spread to other parts of the tree and neighboring trees, which can lead to more widespread infections and increased management challenges for growers. Additionally, the cost of managing and treating leaf spot diseases can add to production expenses. In conclusion, leaf spot diseases on olive trees are important because they can negatively affect the tree’s health, fruit quality, and overall productivity. Olive growers need to monitor for leaf spot diseases and implement effective management strategies to minimize their impact and ensure a healthy and productive orchard. It is also necessary to conduct further research that will include monitoring these fungal diseases and studying the effectiveness of various substances or treatments in inhibiting the growth and reproduction of these fungi.

To our knowledge, this paper is the first report of Nigrospora species causing diseases on olives and the first report of Nigrospora philosophiae-doctoris causing plant disease.