Next Article in Journal
Interspecific Differentiation and Trait Trade-Offs in Heat and Drought Tolerance of Tropical Landscape Plants
Previous Article in Journal
Visual Understanding of Intelligent Apple Picking: Detection-Segmentation Joint Architecture Based on Improved YOLOv11
Previous Article in Special Issue
Genome Editing Using a New Self-Compatible Model Strain of the Genus Chrysanthemum
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 12
Issue 4
10.3390/horticulturae12040495
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Development of a CRISPR/Cas9 Platform in Datura inoxia for Disrupting Tropane Alkaloid Biosynthesis to Generate Non-Toxic Germplasm

by
Xianfang Zou
1,2,†,
Tianxing Yuan
1,2,†,
Yuxin Zhang
3,
Xiaohan Zhang
1,2,
Guoqing Niu
3 and
Yulong Guo
1,2,*
1
College of Horticulture and Landscape Architecture, Southwest University, Chongqing 400715, China
2
Chongqing Engineering Research Center for Floriculture, Beibei District, Chongqing 400715, China
3
College of Agronomy and Biotechnology, Southwest University, Chongqing 400715, China
*
Author to whom correspondence should be addressed.
†
These authors contribute equally to this work.
Horticulturae 2026, 12(4), 495; https://doi.org/10.3390/horticulturae12040495
Submission received: 27 February 2026 / Revised: 13 April 2026 / Accepted: 17 April 2026 / Published: 19 April 2026
(This article belongs to the Special Issue Advanced Omics Technologies and Regulatory Mechanisms of Ornamental Plants)
Browse Figures
Versions Notes

Abstract

Datura species are valued ornamentals but contain toxic tropane alkaloids (TAs) like hyoscyamine and scopolamine, which restrict their safe horticultural use. To address this, we developed a genome editing platform in Datura inoxia for creating non-toxic varieties. We first established an efficient, auxin-independent shoot regeneration system using a novel cytokinin combination (thidiazuron and 6-benzylaminopurine) achieving over 7 shoots per explant. This system facilitated an Agrobacterium tumefaciens-mediated transformation protocol with a stable efficiency exceeding 50% (49 independent lines from 100 explants for LS; 36 lines from 70 explants for CYP80F1). Using this platform, we performed CRISPR/Cas9-mediated knockout of two key TA biosynthetic genes, LS (littorine synthase) and CYP80F1 (littorine mutase). Among the transgenic lines analyzed, 8 out of 15 (53%) carried mutations in LS, while all 12 (100%) lines carried mutations in CYP80F1. HPLC and high-resolution mass spectrometry confirmed the complete absence of hyoscyamine and scopolamine in the mutant leaves, with no detectable peaks at the corresponding retention times. Crucially, the edited plants grew normally and were morphologically indistinguishable from the wild type. This work establishes the first CRISPR/Cas9 platform for Datura and generates the first non-toxic germplasm, providing both a functional genomics tool and a foundation for breeding safe ornamental cultivars.

1. Introduction

The genus Datura (Solanaceae) holds a distinctive position in plant biology. Early landmark studies, including the first report of haploid plants and systematic analyses of interspecific cross ability and species boundaries, established its utility for understanding speciation, hybridization, and polyploidization [1,2,3]. In addition, its phylogenetic position within the Solanaceae—closely related to fleshy-fruited genera such as Solanum and Capsicum, yet bearing dry, dehiscent capsules—makes it a unique system for investigating the evolutionary reversal from fleshy berries to dry fruits, a transition that involves complex anatomical and developmental changes [4,5]. Beyond its scientific intrigue, the genus is prized in horticulture for its striking trumpet-shaped flowers and elegant stature, with D. metel valued for its diverse flower colors and forms, D. inoxia for its robust growth and intense nocturnal fragrance, and D. stramonium for its medicinal properties [6]. This genus has a long history of ornamental cultivation [7]. However, the safe use of these captivating plants in modern landscapes is severely constrained by a significant biological hazard: all plant tissues contain potent tropane alkaloids (TAs), primarily hyoscyamine and scopolamine [8,9]. Accidental ingestion by humans or livestock can cause severe anticholinergic poisoning, characterized by hallucinations, tachycardia, confusion, and in extreme cases, respiratory failure or death [10,11,12]. As a result, cultivation is often restricted to secure areas or banned altogether in some regions, highlighting the urgent need to develop non-toxic varieties to unlock their full horticultural potential.
The biosynthetic pathways for hyoscyamine and scopolamine have been systematically elucidated in recent years [13,14] (Figure S1). These pathways converge with the condensation of tropine and phenyllactoyl-glucose, catalyzed by littorine synthase (LS), to form littorine. Littorine is subsequently rearranged by littorine mutase (CYP80F1) into hyoscyamine aldehyde, the direct precursor to hyoscyamine. Hyoscyamine is then converted into scopolamine through a two-step oxidation catalyzed by hyoscyamine 6β-hydroxylase (H6H). Given their pivotal and specific roles downstream of primary metabolism, LS and CYP80F1 present ideal targets for metabolic engineering. We therefore hypothesize that targeted knockout of either LS or CYP80F1 will effectively block the biosynthesis of hyoscyamine and scopolamine. This strategy is advantageous as it targets a dedicated, downstream branch of the tropane alkaloid pathway. Consequently, it is less likely to disrupt the synthesis of other upstream alkaloids with potential but unknown physiological or adaptive functions, thereby minimizing the risk of pleiotropic effects on plant development.
Functional studies of TA biosynthesis in Datura and related species have predominantly relied on the efficient Agrobacterium rhizogenes-mediated hairy root transformation system for gene overexpression or silencing [15,16,17,18,19,20]. In contrast, stable genetic transformation via Agrobacterium tumefaciens to generate whole transgenic plants in Datura is less developed. While successful reports exist for introducing reporter genes like GUS or eGFP into D. metel and D. stramonium [21,22], the application of CRISPR/Cas9-mediated genome editing to create stable, heritable mutations in Datura plants remains unreported.
Since the first successful application of CRISPR/Cas9 in plants in 2013, this technology has been rapidly adopted for functional genomics and trait improvement across a wide range of species, with particularly notable advances in the Solanaceae family [23]. In tomato, CRISPR/Cas9 has been employed to improve fruit quality, shelf-life, and disease resistance by targeting genes such as RIN, HQT, and DMR6-1 [24,25]. In potato, genome editing has been used to reduce steroidal glycoalkaloids and cold-induced sweetening [26], with recent studies achieving nearly glycoalkaloid-free starch potatoes [27]. In eggplant, disruption of the susceptibility gene SmDMR6-1 enhanced resistance to Phytophthora pathogens [28], and in pepper, virus-mediated CRISPR delivery enabled transgene-free editing of the PDS gene, overcoming a major bottleneck in this recalcitrant species [29].
In the context of secondary metabolism, CRISPR/Cas9 has been effectively applied across diverse Solanaceae species. For instance, knockout of HQT in tomato eliminated chlorogenic acid accumulation and revealed metabolic flux redirection toward flavonoid biosynthesis [24]; in Atropa belladonna, disruption of PYKS or H6H altered tropane alkaloid profiles [19,30]; in Nicotiana tabacum, editing of nicotine biosynthesis genes successfully reduced nicotine content [31]; and in Solanum nigrum, CRISPR/Cas9 knockout of SnAN2 abolished anthocyanin accumulation in fruits [32].
More recently, the CRISPR toolkit has expanded to include base editing and prime editing, enabling precise nucleotide substitutions without double-strand breaks, with successful applications reported in tomato and potato [33,34,35]. Collectively, these studies demonstrate the broad applicability and continuous evolution of CRISPR/Cas9 technologies across the Solanaceae family. Despite these advances, CRISPR/Cas9-mediated genome editing has not yet been applied to the genus Datura. This gap underscores a critical bottleneck in translating pathway knowledge into tangible, nontoxic ornamental varieties.
Here, to address this, we report the establishment of a stable A. tumefaciens-mediated transformation protocol for Datura inoxia. Utilizing this system, we employed CRISPR/Cas9 genome editing to knockout a key gene (LS or CYP80F1) in the scopolamine biosynthetic pathway. This work aims to create the first genome-edited, toxin-free Datura germplasm, providing a foundational strategy to enhance the safety and broaden the horticultural application of this enigmatic genus. Beyond horticulture, the platform established here also provides a much-needed genetic tool for investigating fundamental questions in Datura, including the genetic basis of fruit type evolution and species diversification.

2. Materials and Methods

2.1. Plant Material

Seeds of D. inoxia were kindly provided by Prof. Chunxian Yang (College of Life Sciences, Southwest University). Seeds were surface-sterilized with 75% (v/v) ethanol for 1 min, followed by a 20 min treatment with a sodium hypochlorite solution containing 2% available chlorine, and then rinsed five times with sterile distilled water. Sterilized seeds were germinated on solid half-strength MS medium [36]. After two weeks, the apical buds of germinated seedlings were excised and subcultured. Plantlets were grown under controlled conditions at 25 ± 2 °C with a 16 h photoperiod (50 μmol m−2 s−1).
Regenerated plants were transferred to plastic pots (top diameter × height: 16 cm × 17 cm) containing a peat: river sand (3:1, v/v) mixture and cultivated under natural conditions in an insect-proof screenhouse.

2.2. Callus Induction and Shoot Regeneration

To establish an efficient de novo shoot regeneration system for Agrobacterium-mediated transformation of D. inoxia, thirteen hormone combinations of thidiazuron (TDZ), 6-benzylaminopurine (6-BA), kinetin (KT), zeatin (ZT), and α-naphthaleneacetic acid (NAA) were tested to induce adventitious shoot regeneration from leaf explants (Figure 1; for detailed combinations, see Supplementary Table S1). ZT was filter-sterilized and added to the media after autoclaving (121 °C, 20 min) of other components.
Leaf explants (~1.0 cm × 1.0 cm) were excised from 4-week-old sterile plantlets and inoculated onto MS solid medium supplemented with different hormone combinations. Five explants were placed in each culture vessel, with six vessels per treatment. Due to occasional contamination during culture, the final number of explants analyzed ranged from 15 to 30 per treatment. After 21 days of culture, callus induction was assessed. A visual scoring system (grades 0 to ++++) was employed based on the percentage of explant surface area covered by callus: 0 (no callus), + (<25%), ++ (25–50%), +++ (50–75%), and ++++ (>75%). The Callus Induction Index (CII) was calculated as: CII = Σ (Grade × Number of explants at that grade)/Total number of explants. Explants were then subcultured onto the same media for an additional 21 days to induce adventitious shoots. A structure possessing a meristem and more than two young leaves was counted as one shoot. The significance of differences in the number of adventitious shoots per explant among hormone treatments was analyzed using the Kruskal–Wallis test followed by Dwass–Steel–Critchlow–Fligner post hoc pairwise comparisons in Jamovi (Version 2.6), with a significance threshold of p < 0.05.

2.3. Construction of CRISPR/Cas9 Genome Editing Vectors

Specific primers LS-F1/LS-R1 and CYP80F1-F1/CYP80F1-R1 (Table 1) were designed based on the reported sequences of the LS (DstT004733) and CYP80F1 (DstG019520) genes from Datura stramonium [14]. Genomic DNA fragments of LS and CYP80F1 were amplified from D. inoxia via PCR using TopTaq DNA Polymerase (TransGen Biotech, Beijing, China) with the following cycling conditions: 94 °C for 5 min, followed by 30 cycles of 94 °C for 30 s, 52 °C for 30 s, and 72 °C for 45 s, with a final extension at 72 °C for 10 min. The amplified products were gel-purified using a Quik Gel Extraction Kit (TransGen Biotech, Beijing, China) and subjected to Sanger sequencing (Tsingke Biotechnology Co., Ltd., Beijing, China). The obtained sequences were aligned with reference sequences to confirm accuracy.
Potential single-guide RNA (sgRNA) target sites were identified using CRISPR-GE [37] and analyzed for potential off-target effects using CasOT [38]. Sites were manually selected according to the following criteria: (1) avoiding targets with five consecutive T’s (to prevent premature sgRNA transcription termination); (2) GC content between 40% and 60%; (3) ensuring sufficient mismatches in the PAM-proximal seed region (≥1 mismatch) or the non-seed region (≥4 mismatches) compared to potential off-target genomic sites; (4) location within exons near the 5′ end of the gene; and (5) preference for a G or A as the first base of the target sequence, or addition of a 5′ G if necessary for U6 promoter transcription.
The CRISPR/Cas9 knockout vectors were constructed following the method described by [39], using the binary vector pGGE1c as the backbone. The target-specific sgRNA sequences for LS and CYP80F1 were inserted using the primer pairs LS-sgF1/LS-sgR1 and CYP-sgF1/CYP-sgR1, respectively (Table 1). The validated constructs were named pGEKls and pGEKcyp80f1 (Figure 2B). In these vectors, sgRNA expression is driven by the Arabidopsis thaliana U6 promoter, and plant selection is based on the phosphinothricin N-acetyltransferase (PAT) gene conferring resistance to glufosinate (Basta). The final constructs were introduced into Agrobacterium tumefaciens strain GV3101 via heat shock for subsequent plant transformation.

2.4. Agrobacterium-Mediated Transformation of D. inoxia

Young leaves from approximately 4-week-old sterile plantlets were cut into ~1.0 cm × 1.0 cm explants (leaf discs) and pre-cultured for 2 days on MS medium supplemented with 0.5 mg/L 6-BA and 1 mg/L TDZ.
A. tumefaciens GV3101 harboring pGEKls or pGEKcyp80f1 was grown in 50 mL of YEB liquid medium containing kanamycin (50 mg/L) and gentamicin (50 mg/L) at 28 °C with shaking at 200 rpm until OD600 reached 0.8–1.0 (~48 h). A 10 mL aliquot of the culture was centrifuged (4 °C, 7000 rpm, 10 min), and the pellet was resuspended in 25 mL of liquid MS0 medium containing 100 µmol/L acetosyringone (AS), adjusting the OD600 to 0.2–0.3. Pre-cultured leaf discs were immersed in this bacterial suspension for approximately 5 min with gentle agitation, blotted dry on sterile filter paper, and placed abaxial side down on co-cultivation medium (MS + 0.5 mg/L 6-BA + 1 mg/L TDZ + 100 µmol/L AS, pH 5.8) overlaid with a sterile filter paper. Co-cultivation proceeded in the dark for 48 h.
After co-cultivation, explants were blotted to remove excess bacteria and transferred to selection medium (MS + 0.5 mg/L 6-BA + 0.5 mg/L TDZ + 5 mg/L glufosinate + 500 mg/L carbenicillin). Explants were subcultured onto fresh selection medium every 2–3 weeks, during which browned or dead tissues were discarded. Once shoot primordia emerged from resistant calli, the explants were transferred to shoot elongation/rooting medium (½ MS + 5 mg/L glufosinate + 500 mg/L carbenicillin). Shoots reaching 1–2 cm in height were excised and rooted on the same medium. Well-rooted, glufosinate-resistant plantlets were removed from culture vessels, washed to remove residual medium, and acclimatized in sterile potting mix under contained conditions.
Transformation efficiency was calculated as the number of independent glufosinate-resistant lines obtained per viable explant, expressed as a percentage: (number of resistant lines/number of viable explants) × 100%. Viable explants were defined as those that did not become contaminated during the culture process. For each construct, two independent transformation experiments were performed, each using approximately 50 explants. Thus, a total of four independent experiments (two per construct) were conducted, representing four biological replicates. For statistical comparison of editing efficiencies between the LS and CYP80F1 target genes, Fisher’s exact test was performed using Jamovi (Version 2.6). A significance threshold of p < 0.05 was applied.

2.5. Mutant Identification and Phenotypic Observation

Genomic DNA was extracted from fresh leaves of glufosinate-resistant (T0) and wild-type (WT) plants using the CTAB method. Initial screening was performed by PCR with Cas9-specific primers (Cas9-F/Cas9-R) to confirm the integration of the T-DNA. To identify mutations in the target genes, genomic regions flanking the sgRNA target sites were amplified from putative transgenic plants using gene-specific primer pairs (LS-F1/LS-R1 for LS; CYP80F1-F1/CYP80F1-R1 for CYP80F1). The PCR products were purified and subjected to Sanger sequencing. Sequencing chromatograms were analyzed using DSDecode [40] to decipher heterozygous or bi-allelic edits. If the chromatograms were ambiguous, the amplicons were further analyzed by FastNGS sequencing (see Supplementary Document S1 for protocol), which resolves the sequence of each allele individually, allowing unambiguous identification of the exact mutations present in heterozygous and biallelic lines. The editing efficiency was calculated as the number of mutant lines (carrying at least one mutated allele) divided by the total number of transgenic lines analyzed, expressed as a percentage.
For further phenotypic and metabolic analysis, mutant lines carrying homozygous or biallelic mutations with indels not divisible by three were selected, as these mutations are predicted to cause frameshifts and premature stop codons, thereby likely disrupting protein function.
Genotype-confirmed mutant lines (T0) and WT plants were grown side-by-side under identical, contained environmental conditions. Systematic phenotypic observations were conducted throughout their life cycle, from vegetative growth to reproductive development.

2.6. Extraction and HPLC-HRMS Analysis of Hyoscyamine and Scopolamine

An HPLC system (Shimadzu SIL-20A, Shimadzu Corp., Kyoto, Japan) and an HPLC-HRMS system (Agilent Technologies 6230, Agilent Technologies, Santa Clara, CA, USA) were employed. Hyoscyamine and scopolamine standards were purchased from Shanghai Macklin Biochemical Co., Ltd. (Shanghai, China). Standard stock solutions were prepared by dissolving the compounds in HPLC-grade methanol (hyoscyamine: 1 g/L; scopolamine: 2.5 g/L).
Alkaloid extraction followed a published protocol [14] with modifications. For metabolic analysis, two independent mutant lines were selected for each target gene: ls-16 and ls-49 (for LS), and cyp80f1-14 and cyp80f1-17 (for CYP80F1), which met the selection criteria described above. Each line was analyzed with two replicates. For each replicate, leaves were pooled from 3–5 individual plants and ground into a fine powder. Briefly, young leaves from WT, ls, and cyp80f1 mutant plants were dried at 37 °C to constant weight. For each line, 800 mg of dry leaf powder was homogenized and extracted with 32 mL of methanol-acidified water (20% methanol, 0.1% formic acid) by vortexing and ultrasonication for 30 min. The extract was centrifuged at 7000 rpm for 5 min. The supernatant was collected, concentrated to dryness under reduced pressure at 40 °C, and the residue was redissolved in HPLC-grade methanol. The final solution was filtered through a 0.22 µm membrane prior to analysis.
Chromatographic separation was performed on a ZORBAX SB-C18 column (250 mm × 4.6 mm, 5 µm; Agilent Technologies, Santa Clara, CA, USA) at 40 °C. The mobile phase consisted of (A) 0.1% formic acid in water and (B) methanol, with a flow rate of 0.80 mL/min. The injection volume was 10 µL, and detection wavelength was set at 226 nm. The gradient program was: 0–10 min, 20–90% B; 10–13 min, 90% B; 13–15 min, 90–20% B; 15–25 min, 20% B.
For MS confirmation, the HPLC fraction corresponding to the scopolamine peak was collected. HPLC-HRMS analysis used the following gradient at 0.3 mL/min: 0–4 min, 10–50% B; 4–5 min, 50% B; 5–6 min, 50–10% B; 6–8 min, 10% B.

2.7. Chemicals and Reagents

Murashige and Skoog (MS) medium was purchased from Qingdao Hope Bio-Technology Co., Ltd. (Qingdao, China). Acetosyringone (AS), kanamycin, gentamicin, carbenicillin were purchased from Sangon Biotech (Shanghai, China). Thidiazuron (TDZ), 6-benzylaminopurine (6-BA), kinetin (KT), zeatin (ZT), α-naphthaleneacetic acid (NAA), glufosinate and all other chemicals were obtained from Shanghai Macklin Biochemical Co., Ltd. (Shanghai, China), unless otherwise stated.

3. Results

3.1. Establishment of a Regeneration System for D. inoxia

Leaf explants of D. inoxia exhibited swelling at the cut edges within 7 days of culture, progressing to visible callus formation. After three weeks, the callus induction frequency reached 100% across all treatments.
Among the eight combinations containing both NAA and a cytokinin, callus induction capacity showed limited variation. The Callus Induction Index (CII) values were >3.0 for six combinations, indicating that >75% of the explant surface was covered by callus on average. The remaining two combinations (KT 1.0 mg/L + NAA 0.5 mg/L and ZT 2.0 mg/L + NAA 1.0 mg/L) had CIIs of 2.7 and 3.0, respectively (Figure 1C). Media containing only highly active cytokinins (TDZ 1.0 mg/L combined with 0.5 or 1.0 mg/L 6-BA) also yielded effective callus induction, with CIIs of 3.2 and 3.0, respectively.
The capacity for callus to further differentiate into adventitious shoots varied significantly among hormone treatments. Combinations of TDZ and 6-BA were markedly superior to others. The highest shoot regeneration frequency (7.1 shoots per explant) was achieved on medium containing TDZ 1.0 mg/L and 6-BA 0.5 mg/L (Figure 1A,B). Notably, media containing ZT alone also supported higher shoot regeneration than ZT + NAA combinations.

3.2. Construction of CRISPR/Cas9 Vectors for DiLS and DiCYP80F1 Knockout

The full-length coding sequences (CDS) of LS and CYP80F1 were amplified from D. inoxia leaf cDNA. Sequencing confirmed that these sequences were identical to their counterparts in D. stramonium [14]. Alignment of cDNA with genomic DNA sequences revealed that the DiLS gene comprises 14 exons and 13 introns, while DiCYP80F1 contains 2 exons and 1 intron (Figure 2A). Specific primer pairs (LS-F1/LS-R1 and CYP80F1-F1/CYP80F1-R1, Table 1) were designed to amplify 1207 bp and 700 bp genomic fragments, respectively, for subsequent sequence verification and mutant genotyping (Figure 2A).
Using the CRISPR-GE online tool [37] followed by manual screening, a single CRISPR/Cas9 target site was selected near the 5′ end of each gene. The LS target is located in exon 3, 417 bp downstream of the translation start site, with a GC content of 45% and a PAM sequence of TGG. The CYP80F1 target is in exon 1, 288 bp from the start codon, with 55% GC content and a CGG PAM (Figure 2A). Because the first nucleotide of the selected LS target was not G or A, an additional G was added at the 5′ end during vector construction to serve as the transcription start site for the U6 promoter (Figure 2B). Schematic diagrams of the final binary vectors, named pGEKls and pGEKcyp80f1, are shown in Figure 2B.

3.3. Generation of Dils and Dicyp80f1 Mutants

The T-DNA regions of the pGEKls and pGEKcyp80f1 vectors were introduced into wild-type (WT) D. inoxia leaf explants via Agrobacterium tumefaciens-mediated transformation. Preliminary tests indicated that 5 mg/L glufosinate effectively inhibited the growth of non-transformed tissues, causing chlorosis and death within 10 days; therefore, this concentration was used for selection. Approximately two weeks after co-cultivation on selection medium, callus became evident at the edges of explants. After five weeks, adventitious shoots began to emerge from the resistant callus (Figure 1D,E,G,H). Shoots originating from physically separate callus clumps were designated as independent transgenic lines. About half of the excised shoots developed roots on rooting medium containing glufosinate, while non-rooting shoots turned chlorotic and died (Figure 1F,I).
Transformation with pGEKls (100 explants) yielded 49 independent lines, and pGEKcyp80f1 (70 explants) yielded 36 lines. From these, 20 randomly selected lines per construct were acclimatized, and all tested lines were confirmed to carry the Cas9 transgene (Figure 3B), verifying their transgenic status. The overall transformation efficiency was approximately 50%.
To identify mutations, genomic regions flanking the target sites were amplified from transgenic plants using gene-specific primers (LS-F1/LS-R1 and CYP80F1-F1/CYP80F1-R1). For the 15 pGEKls lines analyzed, sequencing revealed that 7 lines were wild-type, 3 lines were heterozygous, 2 lines were homozygous, and 3 lines were biallelic. In total, 13 mutant alleles were identified, comprising 8 insertions (all single-base) and 5 deletions (ranging from 2 to 23 bp). Notably, when the indels were not multiples of three, they are predicted to cause frameshifts and premature stop codons (Supplementary Figure S2A). Sequence analysis also revealed an in-frame ATG located downstream of the start codon in the DiLS cDNA, representing a potential alternative translation initiation site. For the 12 pGEKcyp80f1 lines, all carried mutations: 3 were heterozygous, 3 were homozygous, and 6 were biallelic. A total of 21 mutant alleles were identified, with 10 insertions (all single-base) and 11 deletions (ranging from 1 to 36 bp). When the indels were not multiples of three, they are predicted to result in truncated proteins lacking key functional domains (Supplementary Figure S2B). Thus, the mutation frequencies were 53% (8/15) for the LS gene and 100% (12/12) for CYP80F1, based on the number of lines carrying mutations. Fisher’s exact test indicated that the difference in editing efficiency between the two target genes was statistically significant (p < 0.001). All insertions and deletions (Indels) were concentrated near the PAM-distal region of the target site, consistent with typical CRISPR/Cas9-induced editing (representative sequences shown in Figure 3C). Phenotypic observation under contained conditions showed no discernible differences between mutant (ls or cyp80f1) and WT plants in terms of growth vigor, plant height, leaf morphology, flower and fruit morphology, or seed set (representative plants shown in Figure 3A).

3.4. Ablation of Hyoscyamine and Scopolamine in Mutant Plants

Methanol-acidified water extracts from leaves of WT and mutant plants were analyzed by HPLC (detection at 226 nm). Chromatograms of WT samples showed distinct peaks at the retention times corresponding to scopolamine (9.4 min) and hyoscyamine (11.4 min). In contrast, these characteristic peaks were completely absent in extracts from both ls and cyp80f1 mutants (Figure 4A), providing preliminary evidence that the biosynthesis of these alkaloids was blocked.
Given that scopolamine is the predominant tropane alkaloid in D. inoxia (constituting >77% of the total; [41]), the HPLC fraction corresponding to the scopolamine peak (9.4 min) from the WT sample was collected for further analysis by high-resolution mass spectrometry (HRMS). The HRMS analysis detected an [M+H]+ ion at m/z 304.1815, matching the ion observed for the authentic scopolamine standard ([M+H]+ m/z 304.1547) (Figure 4B). No corresponding signal was detected at this mass in the equivalent fractions from the mutant lines.
Collectively, these data demonstrate that both LS and CYP80F1 are essential for the biosynthesis of scopolamine and hyoscyamine in D. inoxia. Knockout of these genes effectively abolishes the production of these toxic tropane alkaloids without compromising normal plant growth and development.

4. Discussion

This study successfully established an efficient Agrobacterium tumefaciens-mediated transformation and CRISPR/Cas9-based genome editing platform in D. inoxia. This enabled the targeted knockout of two pivotal genes, LS and CYP80F1, in the tropane alkaloid (TA) biosynthetic pathway, resulting in the first-generation of toxin-free Datura plants with unaltered morphology. The implications of this work are multifaceted.
A key foundation for this work was the development of a novel, auxin-independent shoot regeneration protocol for D. inoxia leaf explants. High-frequency shoot regeneration was achieved on media containing only cytokinins, specifically the novel combination of TDZ and 6-BA, which yielded over 7 shoots per explant. This requirement contrasts with reported protocols for related species, such as D. metel, which utilizes 6-BA and NAA [21,42], and D. stramonium, which employs 2,4-D and KT for callus induction followed by ZT for shoot regeneration [22]. This species-specificity underscores the importance of optimizing regeneration protocols, even within a single genus. These results confirm that combinations of NAA with various cytokinins effectively induce callus from D. inoxia leaf explants. A comparison of media containing ZT alone versus ZT with NAA revealed that the addition of NAA promoted larger callus size (Figure 1C), suggesting a synergistic role for exogenous auxin in callus formation and growth. Notably, media containing ZT alone also supported higher shoot regeneration than ZT + NAA combinations, indicating that exogenous auxin is not essential for adventitious shoot induction from D. inoxia leaf explants. The efficient, auxin-independent regeneration system established here, combined with glufosinate selection, formed the robust foundation for our genetic transformation pipeline, achieving a transformation efficiency exceeding 50% and allowing recovery of transgenic shoots in as little as five weeks.
Building upon this robust regeneration system, we successfully established, to our knowledge, the first application of CRISPR/Cas9 to generate stable, heritable mutations in intact Datura plants. While the hairy-root system has been used for transient gene manipulation, it cannot yield whole edited plants for breeding. Our optimized system overcomes this critical barrier.
In evaluating the performance of this platform, we observed a notable difference in editing efficiency between the two target genes: 53% for LS versus 100% for CYP80F1. Fisher’s exact test indicated that this difference was statistically significant (p < 0.001), although the relatively small sample size (15 lines for LS and 12 for CYP80F1) warrants cautious interpretation and validation with larger populations. Several factors intrinsic to the CRISPR/Cas9 system could account for this disparity. The CYP80F1 target site had a higher GC content (55% vs. 45% for LS) and did not require an extra 5′ G-nucleotide for U6 promoter compatibility, unlike the LS target. The addition of a non-templated G in the LS sgRNA may have affected its stability or loading efficiency into the Cas9 complex. Additionally, uncharacterized differences in local chromatin accessibility or DNA repair dynamics at the two genomic loci could have contributed [43,44]. Regardless, the achieved efficiencies were sufficient to readily obtain biallelic mutants, demonstrating the robustness of our platform for functional genomics in Datura.
Compared with recent CRISPR/Cas9 applications in other Solanaceae plants, our work addresses a long-standing gap in Datura biotechnology. In tomato and potato, efficient Agrobacterium tumefaciens-mediated transformation and genome editing systems have been well established, enabling rapid functional genomics and trait improvement [25,26]. Similarly, in Nicotiana benthamiana and Petunia, CRISPR/Cas9 has been successfully applied for both basic research and practical applications [31,45]. More recently, base editing and prime editing have further expanded the genome editing toolbox in these species [33,34,35]. However, despite these advances in the Solanaceae family, the genus Datura has remained recalcitrant to stable transformation and genome editing. The few existing reports on Datura transformation have been limited to transient assays or reporter gene expression [21,22], and no stable, heritable genome editing has been reported prior to this study. By establishing a robust and efficient CRISPR/Cas9 platform for D. inoxia, our work not only fills this technical void but also provides a critical enabling tool for functional genomics and metabolic engineering in this economically and medicinally important genus. Furthermore, the editing efficiencies achieved here (up to 100% for CYP80F1) are comparable to or even higher than those reported in some Solanaceae models, demonstrating the reliability of our system.
The practical utility of this platform was then validated by HPLC and HRMS analyses, which confirmed the complete absence of hyoscyamine and scopolamine in the ls and cyp80f1 mutant lines. This validates LS and CYP80F1 as essential, non-redundant nodes in the TA pathway in D. inoxia. Crucially, the knockout of these downstream, pathway-specific genes did not cause any discernible pleiotropic effects on plant growth, development, or fertility under our contained growth conditions. This strategic choice—targeting dedicated branch-point genes rather than upstream, potentially more pleiotropic ones—proved effective in decoupling toxicity from normal plant physiology.
A closer examination of the ls mutant alleles revealed that, while indels not divisible by three are predicted to cause frameshifts and premature stop codons upstream of the conserved catalytic triad, an in-frame ATG located downstream of the start codon in the DiLS cDNA could potentially serve as an alternative translation initiation site. This raises the possibility that a truncated serine carboxypeptidase-like (SCPL) protein retaining the catalytic triad (Ser, His, Asp) might be produced. However, despite this possibility, no hyoscyamine or scopolamine was detected in these mutant lines. Several explanations may account for this apparent discrepancy. First, the internal in-frame ATG may not be recognized as an active translation initiation site in planta, resulting in no truncated protein being produced. Second, even if translation were to initiate from this internal start codon, the resulting truncated protein might fail to achieve a catalytically competent conformation due to the absence of N-terminal sequences required for proper folding, or it may lack critical N-terminal sorting signals necessary for correct subcellular localization to the vacuole, where LS is known to function in SCPL acyltransferases [46,47]. Any of these scenarios would prevent the truncated protein from fulfilling its enzymatic role in littorine biosynthesis, consistent with the complete loss of tropane alkaloid accumulation observed in the ls mutants.
The generation of these non-toxic mutants holds direct and significant value for horticulture. Datura species, particularly D. inoxia and D. metel, are prized for their striking floral displays and fragrance but are severely restricted in landscaping due to their toxicity. Our mutants, which are phenotypically indistinguishable from the wild type, represent a foundational step toward developing safe ornamental cultivars. This demonstrates the power of modern genome editing to address long-standing safety constraints in ornamental plant breeding.
While our T0 mutants are promising, several limitations of the present study should be acknowledged. First, off-target effects were assessed only in silico using CasOT, and experimental validation (e.g., through whole-genome sequencing or targeted amplicon sequencing of predicted off-target sites) is necessary to confirm the specificity of the selected sgRNAs. Nevertheless, for ornamental applications, the impact of potential off-target mutations is less critical than for food or pharmaceutical crops. Any off-target edits that compromise plant vigor or aesthetic value can be readily identified and discarded during phenotypic evaluation. Conversely, if an off-target mutation generates a novel and desirable ornamental trait, it could potentially be exploited to create new cultivars. Thus, while experimental validation would strengthen the characterization of our platform, its absence does not diminish the immediate value of this non-toxic germplasm for horticultural use.
Second, although multiple independent mutant lines were analyzed for each gene, the total number of lines examined was limited, and the inheritance of the edits has not yet been confirmed in the T1 generation. However, CRISPR/Cas9-induced mutations are generally stable and heritable, as the edits are permanently integrated into the genome [48,49]. Cases of instability are rare and have been associated with specific contexts such as polyploidy, active DNA repair systems, or late-stage chimeric editing events [49,50]. In our diploid D. inoxia system, the homozygous and biallelic mutations identified in T0 plants are expected to be stably transmitted to subsequent generations. Selfing the primary mutants to obtain T1 progeny will be necessary to confirm stable inheritance and to generate non-toxic, transgene-free germplasm suitable for breeding.
Third, metabolite analysis was focused primarily on leaves, and was qualitative rather than quantitative. Formal determination of the limit of detection (LOD) for hyoscyamine and scopolamine was not performed. Under the chromatographic conditions used, no peaks corresponding to these alkaloids were detected in the mutant samples (Figure 4A; Supplementary Figure S3), indicating that their levels, if present, were below the detectable threshold of the HPLC-HRMS method. Comprehensive quantitative profiling across different tissues (e.g., roots, flowers, seeds) will be required to fully assess the extent of alkaloid ablation, and more sensitive analytical methods would benefit the absolute quantification of any trace residual levels.
The non-toxic Datura germplasm developed in this study holds promise for safe ornamental use in landscapes and gardens. Before large-scale deployment, however, several aspects warrant further investigation. Field trials under diverse environmental conditions are necessary to evaluate the stability of the non-toxic phenotype and the overall agronomic performance of the edited lines. The risk of outcrossing with wild Datura relatives, although mitigable by isolation, should be assessed in relevant agro-ecological contexts. Additionally, pollinator behavior and non-target organism impacts should be monitored, as altered alkaloid profiles might influence plant–insect interactions. Importantly, because the mutant lines used for cultivation will be transgene-free and containing only small indels in the target genes, they are unlikely to pose novel environmental risks beyond those of conventionally bred varieties. Moreover, because these lines are homozygous for the target indels and lack any transgene, they would not fall under the regulatory framework for genetically modified organisms in many jurisdictions. We envision that initial applications would be in contained or semi-contained settings (e.g., private gardens, managed landscapes), where seeds can be produced under isolated conditions to prevent cross-pollination, ensuring that only non-toxic seeds are supplied for landscaping.
Finally, the established transformation and editing platform opens the door for engineering other desirable traits in Datura, such as novel flower colors, shapes, or growth habits, paving the way for the development of next-generation, safe, and enhanced ornamental varieties.

5. Conclusions

In conclusion, we have developed a functional genome editing platform for Datura inoxia and applied it to disrupt the LS and CYP80F1 genes. Preliminary results show that this strategy successfully abolished the accumulation of toxic tropane alkaloids in edited T0 plants analyzed without compromising their normal growth or ornamental morphology. While the number of independent lines examined was limited, our findings provide a proof-of-concept for the generation of non-toxic Datura germplasm. Our work provides both a methodological framework for Datura functional genomics and an initial genetic resource for the safe horticultural exploitation of this genus. Future efforts will focus on expanding the analysis to additional independent lines, field evaluation, comprehensive metabolic profiling across different tissues, and extending this platform to other Datura species and related Solanaceous ornamentals.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/horticulturae12040495/s1, Figure S1. Schematic diagram of the tropane alkaloid biosynthetic pathway in Datura; Figure S2. Comparison of the predicted amino acid sequences of LS (A) and CYP80F1 (B) between wildtype (WT) and representative mutant lines; Figure S3. HPLC analysis of hyoscyamine and scopolamine in additional independent mutant lines; Document S1. Fast NGS library construction and sequencing protocol; Table S1. Hormone combinations tested for adventitious shoot regeneration from leaf explants of D. inoxia.

Author Contributions

Conceptualization, Y.G., T.Y. and X.Z. (Xianfang Zou); methodology, G.N.; validation, Y.G. and X.Z. (Xianfang Zou); formal analysis, Y.G. and T.Y.; investigation, X.Z. (Xianfang Zou), T.Y., Y.Z. and X.Z. (Xiaohan Zhang); resources, G.N.; writing—original draft preparation, X.Z. (Xianfang Zou) and Y.Z.; writing—review and editing, Y.G.; visualization, X.Z. (Xianfang Zou) and Y.Z.; supervision, Y.G. and G.N.; funding acquisition, X.Z. (Xianfang Zou) and Y.G. All authors have read and agreed to the published version of the manuscript.

Funding

This research was partially funded by National Training Program of Innovation and Entrepreneurship for Undergraduates, grant number 202410635120.

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Material. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

Abbreviations

The following abbreviations are used in this manuscript:
TDZthidiazuron
6-BA6-benzylaminopurine
KTkinetin
ZTzeatin
NAAα-naphthaleneacetic acid
HRMShigh-resolution mass spectrometry
HPLCHigh-Performance Liquid Chromatography
CRISPRClustered Regularly Interspaced Short Palindromic Repeats
SCPLserine carboxypeptidase-like

References

  1. Blakeslee, A.F.; Belling, J.; Farnham, M.E.; Bergner, A.D. A Haploid Mutant in the Jimson Weed, “Datura stramonium”. Science 1922, 55, 646–647. [Google Scholar] [CrossRef]
  2. Sanders, M.E. Embryo Development in Four Datura Species Following Self and Hybrid Pollinations. Am. J. Bot. 1948, 35, 525–532. [Google Scholar] [CrossRef]
  3. Buchholz, J.T.; Williams, L.F.; Blakeslee, A.F. Pollen-Tube Growth of Ten Species of Datura in Interspecific Pollinations. Proc. Natl. Acad. Sci. USA 1935, 21, 651–656. [Google Scholar] [CrossRef]
  4. Pabón-Mora, N.; Litt, A. Comparative Anatomical and Developmental Analysis of Dry and Fleshy Fruits of Solanaceae. Am. J. Bot. 2011, 98, 1415–1436. [Google Scholar] [CrossRef]
  5. Knapp, S. Tobacco to Tomatoes: A Phylogenetic Perspective on Fruit Diversity in the Solanaceae. J. Exp. Bot. 2002, 53, 2001–2022. [Google Scholar] [CrossRef]
  6. Susan, M.  Datura. In Wisconsin Horticulture; University of Wisconsin-Madison: Madison, WI, USA, 2026; Available online: https://hort.extension.wisc.edu/articles/datura/ (accessed on 4 February 2026).
  7. Yang, J.; Zhang, W.W.; Gong, L. Datura: An Enigmatic and Checkered Past. In The Great Botanical Migration: Invasive Alien Species in Chinese History, 1st ed.; China Machine Press: Beijing, China, 2024; pp. 46–55. [Google Scholar]
  8. Cinelli, M.A.; Jones, A.D. Alkaloids of the Genus Datura: Review of a Rich Resource for Natural Product Discovery. Molecules 2021, 26, 2629. [Google Scholar] [CrossRef]
  9. Sharma, M.; Dhaliwal, I.; Rana, K.; Delta, A.; Kaushik, P. Phytochemistry, Pharmacology, and Toxicology of Datura Species—A Review. Antioxidants 2021, 10, 1291. [Google Scholar] [CrossRef] [PubMed]
  10. Mahdeb, N.; Benouadah, Z.; Zebiche, T.; Hadjadj, R.; Bouzidi, A. Acute Datura Stramonium Poisoning in East of Algeria—Three Cases. Annu. Res. Rev. Biol. 2016, 11, 1–4. [Google Scholar] [CrossRef]
  11. Trancă, S.D.; Szabo, R.; Cociş, M. Acute Poisoning Due to Ingestion of Datura stramonium—A Case Report. Rom. J. Anaesth. Intensive Care 2017, 24, 65–68. [Google Scholar] [CrossRef] [PubMed][Green Version]
  12. Kerchner, A.; Farkas, Á. Worldwide Poisoning Potential of Brugmansia and Datura. Forensic Toxicol. 2020, 38, 30–41. [Google Scholar] [CrossRef]
  13. Huang, J.P.; Wang, Y.J.; Tian, T.; Wang, L.; Yan, Y.; Huang, S.X. Tropane Alkaloid Biosynthesis: A Centennial Review. Nat. Prod. Rep. 2021, 38, 1634–1658. [Google Scholar] [CrossRef]
  14. Zhang, F.; Qiu, F.; Zeng, J.; Xu, Z.; Tang, Y.; Zhao, T.; Gou, Y.; Su, F.; Wang, S.; Sun, X.; et al. Revealing Evolution of Tropane Alkaloid Biosynthesis by Analyzing Two Genomes in the Solanaceae Family. Nat. Commun. 2023, 14, 1446. [Google Scholar] [CrossRef]
  15. Moyano, E.; Jouhikainen, K.; Tammela, P.; Palazon, J.; Cusido, R.M.; Pinol, M.T.; Teeri, T.H.; Oksman-Caldentey, K.-M. Effect of PMT Gene Overexpression on Tropane Alkaloid Production in Transformed Root Cultures of Datura metel and Hyoscyamus muticus. J. Exp. Bot. 2003, 54, 203–211. [Google Scholar] [CrossRef]
  16. Zhang, L.; Ding, R.; Chai, Y.; Bonfill, M.; Moyano, E.; Oksman-Caldentey, K.-M.; Xu, T.; Pi, Y.; Wang, Z.; Zhang, H.; et al. Engineering Tropane Biosynthetic Pathway in Hyoscyamus niger Hairy Root Cultures. Proc. Natl. Acad. Sci. USA 2004, 101, 6786–6791. [Google Scholar] [CrossRef]
  17. Li, R.; Reed, D.W.; Liu, E.; Nowak, J.; Pelcher, L.E.; Page, J.E.; Covello, P.S. Functional Genomic Analysis of Alkaloid Biosynthesis in Hyoscyamus niger Reveals a Cytochrome P450 Involved in Littorine Rearrangement. Chem. Biol. 2006, 13, 513–520. [Google Scholar] [CrossRef] [PubMed]
  18. Amdoun, R.; Khelifi, L.; Khelifi-Slaoui, M.; Amroune, S.; Benyoussef, E.-H.; Thi, D.V.; Assaf-Ducrocq, C.; Gontier, E. Influence of Minerals and Elicitation on Datura stramonium L. Tropane Alkaloid Production: Modelization of the in Vitro Biochemical Response. Plant Sci. 2009, 177, 81–87. [Google Scholar] [CrossRef]
  19. Hasebe, F.; Yuba, H.; Hashimoto, T.; Saito, K.; Funa, N.; Shoji, T. CRISPR/Cas9-Mediated Disruption of the PYRROLIDINE KETIDE SYNTHASE Gene Reduces the Accumulation of Tropane Alkaloids in Atropa belladonna Hairy Roots. Biosci. Biotechnol. Biochem. 2021, 85, 2404–2409. [Google Scholar] [CrossRef]
  20. Biswas, D.; Chakraborty, A.; Mukherjee, S.; Ghosh, B. Hairy Root Culture: A Potent Method for Improved Secondary Metabolite Production of Solanaceous Plants. Front. Plant Sci. 2023, 14, 1197555. [Google Scholar] [CrossRef] [PubMed]
  21. Rahman, R.A.; El-Din, E.-W.H.; El-Said, A.G.A. Agrobacterium-Mediated Transformation of Datura metel (L.) and Tropane Alkaloids Determination. Res. J. Cell Mol. Biol. 2008, 2, 62–66. Available online: https://www.academia.edu/3025974/ (accessed on 4 February 2026).
  22. Rajewski, A.C.; Elkins, K.B.; Henry, A.; Van Eck, J.; Litt, A. In Vitro Plant Regeneration and Agrobacterium tumefaciens–Mediated Transformation of Datura stramonium (Solanaceae). Appl. Plant Sci. 2019, 7, e01220. [Google Scholar] [CrossRef]
  23. Yamamoto, T.; Kashojiya, S.; Kamimura, S.; Kameyama, T.; Ariizumi, T.; Ezura, H.; Miura, K. Application and Development of Genome Editing Technologies to the Solanaceae Plants. Plant Physiol. Biochem. 2018, 131, 37–46. [Google Scholar] [CrossRef]
  24. D’Orso, F.; Hill, L.; Appelhagen, I.; Lawrenson, T.; Possenti, M.; Li, J.; Harwood, W.; Morelli, G.; Martin, C. Exploring the Metabolic and Physiological Roles of HQT in S. lycopersicum by Gene Editing. Front. Plant Sci. 2023, 14, 1124959. [Google Scholar] [CrossRef]
  25. Thomazella, D.P.D.T.; Seong, K.; Mackelprang, R.; Dahlbeck, D.; Geng, Y.; Gill, U.S.; Qi, T.; Pham, J.; Giuseppe, P.; Lee, C.Y.; et al. Loss of Function of a DMR6 Ortholog in Tomato Confers Broad-Spectrum Disease Resistance. Proc. Natl. Acad. Sci. USA 2021, 118, e2026152118. [Google Scholar] [CrossRef] [PubMed]
  26. Clasen, B.M.; Stoddard, T.J.; Luo, S.; Demorest, Z.L.; Li, J.; Cedrone, F.; Tibebu, R.; Davison, S.; Ray, E.E.; Daulhac, A.; et al. Improving Cold Storage and Processing Traits in Potato through Targeted Gene Knockout. Plant Biotechnol. J. 2016, 14, 169–176. [Google Scholar] [CrossRef]
  27. Liu, Y.; Merino, I.; Gutensohn, M.; Johansson, A.I.; Johansson, K.; Andersson, M.; Hofvander, P.; Sitbon, F. Glycoalkaloid-Free Starch Potatoes Generated by CRISPR /Cas9-Mediated Mutations of Genes in the Glycoalkaloid Biosynthesis Pathway Enable More Sustainable Uses of By-Products From Starch Production. Plant Biotechnol. J. 2026, 24, 1344–1358. [Google Scholar] [CrossRef]
  28. Ferrero, M.; Valentino, D.; Milani, A.M.; Comino, C.; Lanteri, S.; Acquadro, A.; Moglia, A. Enhancing Tolerance to Phytophthora spp. in Eggplant through DMR6–1 CRISPR/Cas9 Knockout. Plant Stress 2024, 14, 100691. [Google Scholar] [CrossRef]
  29. Zhao, C.; Lou, H.; Liu, Q.; Pei, S.; Liao, Q.; Li, Z. Efficient and Transformation-free Genome Editing in Pepper Enabled by RNA Virus-mediated Delivery of CRISPR/Cas9. J. Integr. Plant Biol. 2024, 66, 2079–2082. [Google Scholar] [CrossRef]
  30. Zeng, L.; Zhang, Q.; Jiang, C.; Zheng, Y.; Zuo, Y.; Qin, J.; Liao, Z.; Deng, H. Development of Atropa belladonna L. Plants with High-Yield Hyoscyamine and without Its Derivatives Using the CRISPR/Cas9 System. Int. J. Mol. Sci. 2021, 22, 1731. [Google Scholar] [CrossRef]
  31. Schachtsiek, J.; Stehle, F. Nicotine-free, Nontransgenic Tobacco (Nicotiana tabacum L.) Edited by CRISPR-Cas9. Plant Biotechnol. J. 2019, 17, 2228–2230. [Google Scholar] [CrossRef] [PubMed]
  32. Heo, J.; Bang, W.Y.; Jeong, J.C.; Park, S.-C.; Lee, J.M.; Choi, S.; Lee, B.; Lee, Y.K.; Kim, K.; Park, S.J. The Comparisons of Expression Pattern Reveal Molecular Regulation of Fruit Metabolites in S. nigrum and S. lycopersicum. Sci. Rep. 2022, 12, 5001. [Google Scholar] [CrossRef]
  33. Shimatani, Z.; Kashojiya, S.; Takayama, M.; Terada, R.; Arazoe, T.; Ishii, H.; Teramura, H.; Yamamoto, T.; Komatsu, H.; Miura, K.; et al. Targeted Base Editing in Rice and Tomato Using a CRISPR-Cas9 Cytidine Deaminase Fusion. Nat. Biotechnol. 2017, 35, 441–443. [Google Scholar] [CrossRef] [PubMed]
  34. Veillet, F.; Chauvin, L.; Kermarrec, M.-P.; Sevestre, F.; Merrer, M.; Terret, Z.; Szydlowski, N.; Devaux, P.; Gallois, J.-L.; Chauvin, J.-E. The Solanum Tuberosum GBSSI Gene: A Target for Assessing Gene and Base Editing in Tetraploid Potato. Plant Cell Rep. 2019, 38, 1065–1080. [Google Scholar] [CrossRef]
  35. Vu, T.V.; Nguyen, N.T.; Kim, J.; Song, Y.J.; Nguyen, T.H.; Kim, J.-Y. Optimized Dicot Prime Editing Enables Heritable Desired Edits in Tomato and Arabidopsis. Nat. Plants 2024, 10, 1502–1513. [Google Scholar] [CrossRef] [PubMed]
  36. Murashige, T.; Skoog, F. A Revised Medium for Rapid Growth and Bio Assays with Tobacco Tissue Cultures. Physiol. Plant. 1962, 15, 473–497. [Google Scholar] [CrossRef]
  37. Xie, X.; Ma, X.; Zhu, Q.; Zeng, D.; Li, G.; Liu, Y.G. CRISPR-GE: A Convenient Software Toolkit for CRISPR-Based Genome Editing. Mol. Plant 2017, 10, 1246–1249. [Google Scholar] [CrossRef]
  38. Xiao, A. CasOT: A Genome-Wide Cas9/gRNA off-Target Searching Tool. Bioinformatics 2014, 30, 1180–1182. [Google Scholar] [CrossRef]
  39. Zhang, B.; Yang, X.; Yang, C.; Li, M.; Guo, Y. Exploiting the CRISPR/Cas9 System for Targeted Genome Mutagenesis in Petunia. Sci. Rep. 2016, 6, 20315. [Google Scholar] [CrossRef]
  40. Liu, W.; Xie, X.; Ma, X.; Li, J.; Chen, J.; Liu, Y.G. DSDecode: A Web-Based Tool for Decoding of Sequencing Chromatograms for Genotyping of Targeted Mutations. Mol. Plant 2015, 8, 1431–1433. [Google Scholar] [CrossRef]
  41. Schlesinger, D.; Davidovich Rikanati, R.; Faigenboim, A.; Vendramin, V.; Cattonaro, F.; Inbar, M.; Lewinsohn, E. Tropane Alkaloid Biosynthesis in Datura innoxia Mill. Roots and Their Differential Transport to Shoots. Phytochem. Lett. 2021, 43, 219–225. [Google Scholar] [CrossRef]
  42. Wang, F.; Sun, Y.; Zhang, H.; Cheng, M.; Zhang, L.; Sun, M. Plant Regeneration and Clonal Propagation System of Datura metel. J. Chin. Med. Mater. 2014, 37, 179–182. [Google Scholar] [CrossRef]
  43. Jensen, K.T.; Fløe, L.; Petersen, T.S.; Huang, J.; Xu, F.; Bolund, L.; Luo, Y.; Lin, L. Chromatin Accessibility and Guide Sequence Secondary Structure Affect CRISPR-Cas9 Gene Editing Efficiency. FEBS Lett. 2017, 591, 1892–1901. [Google Scholar] [CrossRef]
  44. Verkuijl, S.A.; Rots, M.G. The Influence of Eukaryotic Chromatin State on CRISPR–Cas9 Editing Efficiencies. Curr. Opin. Biotechnol. 2019, 55, 68–73. [Google Scholar] [CrossRef]
  45. Zhang, B.; Qin, X.; Han, Y.; Li, M.; Guo, Y. Dorsoventrally Asymmetric Expression of miR319/TCP Generates Dorsal-Specific Venation Patterning in Petunia Corolla Tube. J. Exp. Bot. 2024, 75, 3401–3411. [Google Scholar] [CrossRef]
  46. Mugford, S.T.; Qi, X.; Bakht, S.; Hill, L.; Wegel, E.; Hughes, R.K.; Papadopoulou, K.; Melton, R.; Philo, M.; Sainsbury, F.; et al. A Serine Carboxypeptidase-Like Acyltransferase Is Required for Synthesis of Antimicrobial Compounds and Disease Resistance in Oats. Plant Cell 2009, 21, 2473–2484. [Google Scholar] [CrossRef]
  47. Stehle, F.; Brandt, W.; Stubbs, M.T.; Milkowski, C.; Strack, D. Sinapoyltransferases in the Light of Molecular Evolution. Phytochemistry 2009, 70, 1652–1662. [Google Scholar] [CrossRef] [PubMed]
  48. Pal, S.; Krishna, R.; Dedhia, L.; Panwar, H.S.; Karkute, S.G.; Rai, N.; Kumar, R.; Pandey, S.; Singh, A.K. CRISPR Mediated Gene Editing for Economically Important Traits in Horticultural Crops: Progress and Prospects. Transgenic Res. 2025, 34, 26. [Google Scholar] [CrossRef]
  49. Bertier, L.D.; Ron, M.; Huo, H.; Bradford, K.J.; Britt, A.B.; Michelmore, R.W. High-Resolution Analysis of the Efficiency, Heritability, and Editing Outcomes of CRISPR/Cas9-Induced Modifications of NCED4 in Lettuce (Lactuca sativa). G3 Genes Genomes Genet. 2018, 8, 1513–1521. [Google Scholar] [CrossRef] [PubMed]
  50. Sun, X.; Li, M.; Wang, H.; Yang, Y.; Kang, Y.; Sun, P.; Dong, J.; Jin, M.; Jin, W. Possible Reversion of CRISPR-Cas9-Edited Sequences in Octoploid Strawberry. CRISPR J. 2025, 8, 375–389. [Google Scholar] [CrossRef] [PubMed]
Horticulturae 12 00495 g001
Figure 1. Establishment of an efficient regeneration system and transgenic recovery process for Datura inoxia. (A) Adventitious shoot regeneration from leaf-derived callus after 42 days of culture. (B) Average number of adventitious shoots per leaf explant after 42 days of culture under different hormone treatments. Different lowercase letters indicate statistically significant differences (p < 0.05, Kruskal–Wallis test) between treatments. (C) Distribution of callus induction grades (+, ++, +++, and ++++) and the corresponding Callus Induction Index (CII) for leaf explants cultured for 21 days on different media. (D–F) Progression of transgenic shoot regeneration from pGEKls T-DNA transformed explants: (D) callus formation after 2 weeks on selection medium, (E) emergence of glufosinate-resistant shoots after 5 weeks, and (F) rooting of a resistant shoot. (G–I) Progression of transgenic shoot regeneration from pGEKcyp80f1 T-DNA transformed explants: (G) callus formation after 2 weeks on selection medium, (H) emergence of glufosinate-resistant shoots after 5 weeks, and (I) rooting of a resistant shoot.
Figure 1. Establishment of an efficient regeneration system and transgenic recovery process for Datura inoxia. (A) Adventitious shoot regeneration from leaf-derived callus after 42 days of culture. (B) Average number of adventitious shoots per leaf explant after 42 days of culture under different hormone treatments. Different lowercase letters indicate statistically significant differences (p < 0.05, Kruskal–Wallis test) between treatments. (C) Distribution of callus induction grades (+, ++, +++, and ++++) and the corresponding Callus Induction Index (CII) for leaf explants cultured for 21 days on different media. (D–F) Progression of transgenic shoot regeneration from pGEKls T-DNA transformed explants: (D) callus formation after 2 weeks on selection medium, (E) emergence of glufosinate-resistant shoots after 5 weeks, and (F) rooting of a resistant shoot. (G–I) Progression of transgenic shoot regeneration from pGEKcyp80f1 T-DNA transformed explants: (G) callus formation after 2 weeks on selection medium, (H) emergence of glufosinate-resistant shoots after 5 weeks, and (I) rooting of a resistant shoot.
Horticulturae 12 00495 g001
Horticulturae 12 00495 g002
Figure 2. Gene structures and CRISPR/Cas9 vector design for targeting LS and CYP80F1 in Datura inoxia. (A) Schematic of the LS and CYP80F1 genomic loci, showing exon-intron organization. The locations of the CRISPR target sites and genotyping primers are indicated. (B) Diagrams of the T-DNA regions in the binary knockout vectors (pGEKls and pGEKcyp80f1), featuring the Cas9 and sgRNA expression cassettes and the plant selectable marker (PAT).
Figure 2. Gene structures and CRISPR/Cas9 vector design for targeting LS and CYP80F1 in Datura inoxia. (A) Schematic of the LS and CYP80F1 genomic loci, showing exon-intron organization. The locations of the CRISPR target sites and genotyping primers are indicated. (B) Diagrams of the T-DNA regions in the binary knockout vectors (pGEKls and pGEKcyp80f1), featuring the Cas9 and sgRNA expression cassettes and the plant selectable marker (PAT).
Horticulturae 12 00495 g002
Horticulturae 12 00495 g003
Figure 3. Molecular and phenotypic characterization of ls and cyp80f1 mutants in Datura inoxia. (A) Phenotypic comparison between representative T0 mutant plants (ls and cyp80f1) and a wild-type (WT) plant at a comparable developmental stage, showing no discernible morphological differences. (B) PCR analysis confirming the integration of the Cas9 transgene in glufosinate-resistant (Basta-resistant) plants. Wild-type (WT) DNA served as a negative control. (C) Sequence chromatograms and aligned target site sequences from representative mutant alleles. The wild-type (WT) sequence is shown at the top, with the target site underlined and the PAM sequence highlighted. Indel mutations in the mutant alleles are indicated, with dashes representing deletions and red letters indicating insertions.
Figure 3. Molecular and phenotypic characterization of ls and cyp80f1 mutants in Datura inoxia. (A) Phenotypic comparison between representative T0 mutant plants (ls and cyp80f1) and a wild-type (WT) plant at a comparable developmental stage, showing no discernible morphological differences. (B) PCR analysis confirming the integration of the Cas9 transgene in glufosinate-resistant (Basta-resistant) plants. Wild-type (WT) DNA served as a negative control. (C) Sequence chromatograms and aligned target site sequences from representative mutant alleles. The wild-type (WT) sequence is shown at the top, with the target site underlined and the PAM sequence highlighted. Indel mutations in the mutant alleles are indicated, with dashes representing deletions and red letters indicating insertions.
Horticulturae 12 00495 g003
Horticulturae 12 00495 g004
Figure 4. Detection and confirmation of tropane alkaloids in wild-type and mutant Datura inoxia leaves. (A) HPLC chromatograms (226 nm detection) of leaf extracts from wild-type (WT), ls mutant, and cyp80f1 mutant plants. Peaks corresponding to scopolamine (Scop, 9.4 min) and hyoscyamine (Hyos, 11.4 min) are labeled. (B) High-resolution mass spectrometry (HRMS) analysis of the HPLC fraction corresponding to the scopolamine peak. The extracted ion chromatogram (EIC) for the [M+H]+ ion of scopolamine is shown, with the peak corresponding to this mass indicated by an asterisk (*) in the wild-type (WT) sample and the scopolamine standard.
Figure 4. Detection and confirmation of tropane alkaloids in wild-type and mutant Datura inoxia leaves. (A) HPLC chromatograms (226 nm detection) of leaf extracts from wild-type (WT), ls mutant, and cyp80f1 mutant plants. Peaks corresponding to scopolamine (Scop, 9.4 min) and hyoscyamine (Hyos, 11.4 min) are labeled. (B) High-resolution mass spectrometry (HRMS) analysis of the HPLC fraction corresponding to the scopolamine peak. The extracted ion chromatogram (EIC) for the [M+H]+ ion of scopolamine is shown, with the peak corresponding to this mass indicated by an asterisk (*) in the wild-type (WT) sample and the scopolamine standard.
Horticulturae 12 00495 g004
Table 1. Primers used in this study.
Table 1. Primers used in this study.
Primer IDSequence (5′→3′)Aplication
LS-F1AACGACACATATGCGTGAACTls mutant genotyping
LS-R1GAGCCATTTGTAGATTATCTGAGTG
CYP80F1-F1CCCATGTCCTTCTCCCTCTTcyp80f1 mutant genotyping
CYP80F1-R1TTGTATGTTCCTTGGAAATCCC
LS-sgF1gTCCTTAGCATCAAGTAGCACgttttagagctagaaatagcConstruction of pGEKls
LS-sgR1GTGCTACTTGATGCTAAGGACaatcactacttcgactctag
CYP-sgF1GACCTCATGTCCATACGGCTgttttagagctagaaatagcConstruction of pGEKcyp80f1
CYP-sgR1AGCCGTATGGACATGAGGTCaatcactacttcgactctag
Cas9-FCGCTGTTGTTGGAACCGCTCTTAAmplification of the Cas9 gene
Cas9-RGCTGCTTCTGCTCGTTATCCTCTG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zou, X.; Yuan, T.; Zhang, Y.; Zhang, X.; Niu, G.; Guo, Y. Development of a CRISPR/Cas9 Platform in Datura inoxia for Disrupting Tropane Alkaloid Biosynthesis to Generate Non-Toxic Germplasm. Horticulturae 2026, 12, 495. https://doi.org/10.3390/horticulturae12040495

AMA Style

Zou X, Yuan T, Zhang Y, Zhang X, Niu G, Guo Y. Development of a CRISPR/Cas9 Platform in Datura inoxia for Disrupting Tropane Alkaloid Biosynthesis to Generate Non-Toxic Germplasm. Horticulturae. 2026; 12(4):495. https://doi.org/10.3390/horticulturae12040495

Chicago/Turabian Style

Zou, Xianfang, Tianxing Yuan, Yuxin Zhang, Xiaohan Zhang, Guoqing Niu, and Yulong Guo. 2026. "Development of a CRISPR/Cas9 Platform in Datura inoxia for Disrupting Tropane Alkaloid Biosynthesis to Generate Non-Toxic Germplasm" Horticulturae 12, no. 4: 495. https://doi.org/10.3390/horticulturae12040495

APA Style

Zou, X., Yuan, T., Zhang, Y., Zhang, X., Niu, G., & Guo, Y. (2026). Development of a CRISPR/Cas9 Platform in Datura inoxia for Disrupting Tropane Alkaloid Biosynthesis to Generate Non-Toxic Germplasm. Horticulturae, 12(4), 495. https://doi.org/10.3390/horticulturae12040495

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop