Next Article in Journal
Short-Term Frost Prediction During Apple Flowering in Luochuan Using a 1D-CNN–BiLSTM Network with Attention Mechanism
Previous Article in Journal
Ratios of Nitrogen Forms for Substrate-Cultivated Blueberry
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 12
Issue 1
10.3390/horticulturae12010046
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Chemotherapy on the Elimination of Various Viruses and Viroids from Grapevine

by
Mihaly Turcsan
1,
Nikoletta Jaksa-Czotter
2,
Zsuzsanna Nagyne Galbacs
2,
Krisztina Olah
1,
Robert Olah
1,*,
Eva Varallyay
2 and
Diana Agnes Nyitraine Sardy
1
1
Institute for Viticulture and Oenology, Hungarian University of Agriculture and Life Sciences, Villányi Str. 29-43, HU-1118 Budapest, Hungary
2
Genomics Research Group, Department of Plant Pathology, Institute of Plant Protection, Hungarian University of Agriculture and Life Sciences, Szent-Gyorgyi Albert Str. 4, HU-2100 Godollo, Hungary
*
Author to whom correspondence should be addressed.
Horticulturae 2026, 12(1), 46; https://doi.org/10.3390/horticulturae12010046 (registering DOI)
Submission received: 25 November 2025 / Revised: 25 December 2025 / Accepted: 29 December 2025 / Published: 30 December 2025
(This article belongs to the Special Issue Innovations in Micropropagation of Horticultural Plants: Bridging Research and Industry)
Review Reports Versions Notes

Abstract

Maintaining grape cultivation requires the continuous production of healthy propagating material and the control of economically important viruses. For more effective virus eradication, it is beneficial to try chemotherapeutic agents that have not yet been used on grapevine. We therefore tested two chemotherapeutic agents with different mechanisms of action (2-thiouracil and zidovudine) in addition to ribavirin, which is already used on grapevine. Viruses and viroids were identified in the mother plants of different grapevine cultivars by small RNA HTS (High-Throughput Sequencing), and RT-PCR verified the results. After chemotherapy, the regenerated plants were tested using RT-PCR and the efficacy of the three chemotherapeutic compounds was evaluated. Among the tested agents, ribavirin had the broadest elimination effect (the virus was not detectable by RT-PCR after 8 months) on most viruses. It proved to be particularly effective (the virus was not detectable by RT-PCR in most of the tested plants) against GFkV, GLRaV-4, GPGV and GRSPaV. The use of 2-thiouracil caused high phytotoxicity and was effective against GLRaV-4 among the viruses tested, having no effect on the other viruses. Zidovudine alone failed to eliminate any of the viruses we tested. 2-thiouracil, ribavirin and zidovudine were unable to eliminate HSVd and GYSVd-1 viroids.

1. Introduction

Grapes can be infected by more than 100 viruses [1], and this number is constantly increasing. Since there are no specific methods to control viruses and viroids in vineyards, the propagating material used for establishment must be free from viruses and viroids that may have deteriorating effects. In order to remove these from the mother plants, a number of different methods have been developed and applied in recent decades, such as meristem culture, somatic embryogenesis, and chemotherapy [2,3,4].
Chemotherapy is a very important sanitation method that has been used for a long time, and it can effectively support tissue culture-based virus elimination [5]. Ribavirin has been used successfully since the 1980s to remove viruses from potatoes and other species [6,7]. In the following decades, its use became widespread for eliminating viruses in apples, pears, strawberries and roses [8,9,10]. During in vitro virus elimination, plants are exposed to various stress factors, the severity of which depends on the in vitro conditions, the degree of wounding, the toxicity and concentration of the chemotherapeutic agent used, and the duration of exposure. This can result in low survival rates, stunted growth, chlorosis, morphological changes, etc. [11].
Ribavirin is a guanosine analogue that acts through several mechanisms: It inhibits the activity of the enzyme inosine 5′-monophosphate dehydrogenase, thus indirectly reducing the intracellular GTP level in the affected cells, which slows down nucleic acid synthesis. Its metabolized, active form can also be incorporated into growing nucleic acid chains and induce mutations, as it is able to pair with cytosine and uracil. Since viral RNA-dependent RNA polymerases (RdRPs) lack error-correcting activity, these mutations remain permanent in the viral genome [11].
In grapes, ribavirin has been successfully used to eliminate Nepovirus arabis (Arabis mosaic virus, ArMV), Nepovirus foliumflabelli (grapevine fanleaf virus, GFLV), Maculavirus vitis (grapevine fleck virus, GFkV), Ampelovirus univitis (grapevine leafroll-associated viruses 1,GLRaV-1), Ampelovirus trivitis (grapevine leafroll-associated viruses 3, GLRaV-3), Trichovirus pinovitis (grapevine Pinot gris virus, GPGV), Foveavirus rupestris (grapevine rupestris stem pitting-associated virus, GRSPaV) and Vitivirus alphavitis (grapevine virus A, GVA). However, it cannot successfully eliminate viroids like Hostuviroid impedihumuli (hop stunt viroid, HSVd) and Apscaviroid alphaflavivitis (grapevine yellow speckled viroid 1, GYSVd-1) [12,13,14,15,16,17]. Its effectiveness also depends on the cultivar and the virus being eliminated [14,17].
To address this variable efficacy, the stock of useful antiviral chemicals has been expanded; 2-thiouracil and zidovudine are potential alternatives that have been demonstrated to be effective against viruses in a number of other plant species [18,19]. 2-thiouracil, a nucleobase analogue of uracil in which the C-2 oxo group is replaced by a thioxo group, has successfully been used against Carlavirus betachrysanthemi (chrysanthemum virus B, CVB) [18], Polerovirus PLRV (potato leaf roll virus, PLRV), Potyvirus plumpoxi (plum pox virus, PPV) [20,21], Carlavirus lilii (lily symptomless virus, LSV), Cucumovirus CMV (cucumber mosaic virus, CMV), Potyvirus tulipadefractum (tulip breaking virus-lily, TBV-L) [22,23], and Potexvirus citrindicum (Indian citrus ringspot virus, ICRSV) in mandarins [24]. Side effects—high phytotoxicity, chlorosis and reduced growth—were mentioned in most of these studies [24,25,26].
Zidovudine (azidothymidine) is a thymidine analogue that can terminate the synthesis of a DNA chain [11]. It has been proven to be very effective against Ilarvirus PDV (prune dwarf virus, PDV), PPV and Ilarvirus PNRSV (prunus necrotic ringspot virus, PNRSV) in peaches [19,27], Ilarvirus SnIV1 (Solanum nigrum ilarvirus 1, SnIV-1) in apples [28], PLRV [25], Sadwavirus citri (satsuma dwarf virus, SDV) in citrus [29] and Carlavirus latensascalonici (shallot latent virus (SLV)) in garlic [30]. Some of these studies also reported that zidovudine had no negative effect on the condition of the treated plants, unlike ribavirin, and that treated plants seemed to grow faster than untreated ones [27,30]. In contrast, Ohta et al. [29] observed a lower growth rate for zidovudine-treated citrus plants.
We aimed to test the efficacy of different chemotherapeutic agents—ribavirin, 2-thiouracil and zidovudine—in eliminating different viruses from infected grapevines. To test their efficiency, we selected five grapevine lines representing four clones infected with viruses and viroids in different combinations for elimination studies. Their viromes were determined using small RNA HTS (High-Throughput Sequencing).
Our results show that chemotherapeutic efficacy is virus and possibly cultivar dependent.

2. Materials and Methods

2.1. Establishment of In Vitro Cultures

For the virus elimination experiments, five mother plants were selected from the grapevine collection of Kecskemét Research Station based on a preliminary RT-PCR survey. The mother plants were selected to represent a wide range of viruses (nepoviruses, ampeloviruses, vitiviruses, maculaviruses, foveaviruses, and trichoviruses), including those that are economically significant (GFLV, GLRaV-1, GVA, and GFKV). In vitro shoot cultures were established from the newly developed green shoots of the tested clones. First, under a laminar box, they were surface sterilized via immersion in 70% ethyl alcohol solution, followed by an 8 min-long sterilization step in a solution of 1.5% sodium hypochlorite and 0.1% Tween 20. The shoots were then washed three times in sterile distilled water, and the shoot tips (about 0.5–1 cm in size) were prepared and placed on a solid MS medium consisting of half the amount of macro salts (0.826 g/L MS Macro Salt mixture, Duchefa-M0305, Haarlem, The Netherlands), microsalts (1 g/L MS Micro-Salt Mixture, Duchefa-M0301, Haarlem, The Netherlands), vitamins (MS Vitamin Mixture, Duchefa-M0409, Haarlem, The Netherlands, according to the supplier’s instructions), and 2% sucrose, solidified with 3 g/L gelrite (Duchefa-G1101, Haarlem, The Netherlands) supplemented with 0.5 mg/L BA (benzyl-adenine) or 0.5 mg/L mT (meta-Topolin, [4]). We used the above-mentioned basic MS medium (hereinafter referred to as MS medium) with minor modifications in all experiments. The growing three-week-old plantlets were then transferred into jars filled with the MS media free from growth regulators and containing only 1% sucrose for root formation and further growth. As soon as the plants reached the appropriate level of development, we commenced micropropagation using their apical shoots. The in vitro stocks were refreshed every 4–6 weeks for the experiments.
After the establishment of the in vitro shoot cultures, the virus and viroid contents of the produced in vitro plants were determined before every treatment with RT-PCR to ensure that they were still within the detectable range.

2.2. Small RNA HTS-Based Detection of the Viromes in Mother Plants

For the experiments, based on preliminary virus test information, five mother plants from four wine grape cultivars (Vitis vinifera L.)—Furmint P51 A1 and Furmint P51 ÜH2; Kadarka P131 A1; Kékfrankos Kt. 1/2 A1; and Sárfehér A1—were selected in 2022 and used to establish an in vitro culture. These cultivars are well known in Hungarian viticulture and provide excellent quality wines. The mother plants were maintained under greenhouse conditions in a mixture of peat and perlite (2:1). For nutrient supply, Genezis NPK (11:11:18 + 16 S, Bige Holding Kft., Szolnok, Hungary) was applied by irrigation. The viromes of each mother plant were determined using small RNA HTS. RNA from the leaves of the mother plants was purified using the CTAB extraction method [31]. Small RNA sequencing libraries were prepared using an Illumina TruSeq Small RNA Library Preparation Kit (Illumina, San Diego, CA, USA) and our optimized protocol [32]. Five sRNA libraries were sequenced using a single index on a HiScanSQ by UD-Genomed (Debrecen, Hungary) (50 bp, single-end sequencing). FASTQ files of the sequenced libraries were deposited in the GEO and can be accessed through the series accession number: GSE283735. For the bioinformatics analysis of the fastq files, we used CLC Genomic Workbench 20/20.0.4 version (Qiagen, Valencia, CA, USA). Adapter sequences were trimmed from the obtained reads. To assemble contigs from the nonredundant reads de novo, the assembly command (using default options: word size 20, bubble size 50, and simple contig sequences and min 35 nt length) in CLC was used. These contigs were aligned to reference genomes of grapevine viruses and viroids in the NCBI) using the NCBI Plant hosted Viral Reference genomes (downloaded at 5 December 2023) using the BLASTN (https://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 15 December 2023) algorithm. Viral hits were evaluated based on their E-value (hits with E-value below 10−2) were considered as positives. Nonredundant and redundant reads were mapped to all of the viruses and viroids, which resulted in hits during the contig blast. Normalized read counts (read/1 million reads—RPM) for these viruses were determined together with the coverage of the genome by small RNA reads. The result of the HTS was validated by RT-PCR if at least two of the following conditions were met: 1. there was at least one contig that gave a hit on that particular virus/viroid genome; 2. the RPM was over 200; 3. the consensus sequence covered more than 60% of the virus or 80% of the viroid genome.

2.3. RT-PCR-Based Detection of Viroids and Viruses

The virome of the mother plants was analyzed using small RNA HTS, and the results were verified by RT-PCR. Each in vitro plant produced directly from the mother plants were tested with RT-PCR. Before each experiment, the presence of detected viruses and viroids was verified by RT-PCR in the used in vitro plants, individually. Approximately 8 months after chemotherapy treatment, the virus content of plants developed from 2 mm shoot tips was examined by RT-PCR.
For PCR-based tests, total nucleic acids were isolated from leaves of the greenhouse-grown mother plants and in vitro propagated plants according to a simplified CTAB-based protocol [33]. Nucleic acids were used as the template for cDNA synthesis using random hexamer primers of the RevertAid First Strand cDNA kit (Thermo Scientific, #K1622, Thermo Fisher Scientific, Waltham, MA, USA) according to the supplier’s instructions. The quality of the cDNAs was assessed using previously published primers specific to the intron-containing region of the tubulin gene [34].
For the PCR reaction, a DreamTaq DNA Polymerase Kit (Thermo Scientific, #EP0703) was used. The reaction mix was prepared based on the manufacturer’s description with a final volume of 10 µL. Reactions were performed with a pre-denaturation step at 94 °C for 3 min, followed by 35 cycles of denaturation at 94 °C for 30 s, annealing at 50–60 °C (Table 1) for 30 s, and extension at 72 °C for 30 s. At the end of the protocol, a final elongation step at 72 °C for 3 min was performed. The PCR products were then separated and visualized by gel electrophoresis in 1.5% (w/v) agarose gel stained with ethidium bromide.

2.4. Treatments with Different Antiviral Agents

Chemotherapy treatments were performed on the apical shoots (1–2 cm) of the micropropagated virus-infected plants using different concentrations and combinations of antiviral agents (2-thiouracil—ACRO151841000, Acros Organics, Waltham, MA, USA; ribavirin—Duchefa R0182, Haarlem, The Netherlands; zidovudine—ACRO454980050, Acros Organics (Waltham, MA, USA), as detailed in Table 2. In the case of ribavirin, we chose a concentration of 25 mg/L based on the literature, which was confirmed by our preliminary experiments. In the case of zidovudine, very different amounts were used for different species, so we also tried to use a wider range of concentrations (10–120 mg/L). Due to its phytotoxicity described in the literature, we tested 2-thiouracil in lower concentrations in preliminary experiments. Based on preliminary results, two concentrations (10 and 20 mg/L) were used in the experiments. Apical shoots of some clones (that showed symptoms of high phytotoxicity) were pre-rooted for two weeks prior chemotherapy treatment on the MS medium (in Section 2.1) containing 0.8 mg/L IBA (isobutyric acid [12]) and 1% sucrose. Thus, freshly cut shoot tips or pre-rooted shoot tips were placed on MS medium containing the antiviral agent and 1% sucrose.
After approximately 12 weeks of chemotherapy, the 2 mm shoot tips were removed from the treated plants, and were placed on MS media free of antiviral agent in Petri dishes supplemented with 1% sucrose, 0.02 mg/L BA (benzyl-adenine) and 0.01 mg/L NAA (naphtylacetic acid) for regeneration.
After three weeks, the growing shoots were transferred to the MS medium free from growth regulators and containing 1% sucrose. These shoots were maintained and propagated on the same medium. After 8 months, these plants were then tested using RT-PCR for the presence of the viruses and viroids that were detected at the beginning of the treatment. The ratio of infection after and before treatment allowed us to determine the efficacy of the chemotherapeutic agents.

3. Results

3.1. Small RNA HTS-Based Detection of the Viromes in Mother Plants

Five mother plants representing four cultivated varieties were selected in such a way so that they contained viruses in combinations and that different virus families were represented. Their viromes were determined using small RNA HTS and validated by RT-PCR. Table 3 shows the number of contigs annotated with viruses from the different libraries (Table 3).
The contigs annotated as GFLV/ArMV/GDefV (grapevine deformation virus, Nepovirus deformationis) in Furmint P51 ÜH2 and GLRaV-4-5-6 in Sarfeher A1 were derived from divergent variants of GFLV and GLRaV-4, respectively. These variants exhibited recombination or mutation within the tested primer annealing sites, and thus we designed new primers for reliable detection.
GLRaV-4 has been characterized [37], although we did find a primer pair that can detect the presence of the GFLV/ArMV/GDefV strain; the molecular characterization of this nepovirus is currently in progress.
Thus, we detected seven viruses (GFkV, GFLV, GLRaV-1, GLRaV-4, GPGV, GRSPaV, GVA) and two viroids (HSVd and GYSVd-1) in mixed infections in the examined mother plants (Table 4). Their presence was verified by RT-PCR. The wide range of identified viruses and viroids allowed us to test viral elements of different origins and infection patterns with the selected chemotherapeutic agents.

3.2. Establishment of In Vitro Cultures

In vitro shoot cultures derived from the mother plants contained the viruses detected in the original plants, and their presence was verified by RT-PCR. These in vitro plantlets were successfully propagated for chemotherapy treatments.

3.3. Effect of Chemotherapy on Shoot Survival

Ribavirin negatively affected plant growth and rooting; shoot survival rates were between 28 and 49% in different experiments (Table 4).
Zidovudine induced growth at lower concentrations (10–40 mg/L) but inhibited it at higher concentrations (80–120 mg/L); however, the survival rate was always 100 percent, except in one experiment (Kékfrankos Kt. 1/2 A1; the survival rate was 30% at a 100 mg/L concentration (Table 5)). Since Kékfrankos was the only cultivar on which we observed phytotoxicity in the presence of zidovudine, this phenomenon is probably cultivar-dependent. 2-thiouracil at concentrations as low as 5 mg/L had already strongly inhibited plant growth, and concentrations of over 10 mg/L showed particularly strong phytotoxic effects; the survival rates ranged from 0 to 17% for shoots placed on this medium (Table 6). The majority of 2-thiouracil-treated shoots died after 1–2 months, regardless of the concentration applied in the preliminary experiments (5, 10, 15 and 20 mg/L).
Overall, compared to the other two chemotherapeutic agents tested, 2-thiouracil showed the strongest phytotoxicity, which may significantly limit its usability. In contrast, ribavirin showed moderate phytotoxicity, which facilitates its technological application. Zidovudine showed virtually no phytotoxic effect, except in the case of the Kékfrankos cultivar.

3.4. Effect of Chemotherapy on the Grape Viruses/Viroids Studied

In experiments with zidovudine, we were unable to regenerate virus-free plants (Table 5), even though zidovudine showed phytotoxicity only in the Kékfrankos cultivar. Since zidovudine is a thymidine analogue, this may explain why we did not observe any effect on the RNA viruses studied when it was used alone.
In the case of 2-thiouracil, we experienced the same phenomenon: we could not regenerate virus-free plants when this chemical was used for elimination (the virus was not detectable by RT-PCR after 8 months) alone, except in the case of GLRaV-4, when the use of 10 and 20 mg/L 2-thiouracil could successfully eliminate this virus with 25% efficiency (Table 6). This can be explained by the extremely poor growth observed due to strong phytotoxicity. Another explanation could be the virus-dependent effect of 2-thiouracil. On the 2-thiouracil-containing medium mostly only the pre-rooted plants survived (Table 6), but pre-rooting may have also inhibited the uptake of 2-thiouracil. In this case, since GLRaV-4 is a phloem-limited virus, elimination was possible even with weaker 2-thiouracil activity.
Treating the different clones with ribavirin proved to be very successful against GFkV (78%), GLRaV-4 (78%), GPGV (97–100%) and GRSPaV (50–82%), and more than 50% of plants were found to be free from the originally presenting viruses (Table 4a).
In the case GLRaV-1 and GVA, ribavirin treatment showed very low efficacies of only 3.4–5.5% and 6.5%, respectively (Table 4a). The result is surprising in the case of two phloem-limited viruses, but at the same time there is still no data on the effectiveness of ribavirin in the Sárfehér and Furmint cultivars. The results may therefore show the virus and cultivar dependence of the treatment. With our experimental setup, the elimination of GFLV proved to be unsuccessful with 25 mg/L ribavirin. Nepoviruses are not phloem-limited; these viruses enter meristem cells, which can significantly reduce elimination efficiency. Ribavirin showed no viroid elimination effect. The different replication mechanism of viroids compared to viruses is probably the reason for this failure.
The combined treatment of 25 mg/L ribavirin and 50 mg/L zidovudine (Table 4b) was also able to eliminate GFLV (12.5%), which was not achieved with ribavirin alone, and showed an efficiency of 12.5% for the GYSVd-1 viroid. In other cases, this combination did not show outstanding results, but it may indicate that the use of zidovudine has an effect on the efficacy of ribavirin treatment.
A striking finding was that a combination of 25 mg/L ribavirin and 10 mg/L 2-thiouracil was able to eliminate GPGV and GRSPaV from all of the plants (Table 4c). The results show that the combination of ribavirin and 2-thiouracil can reduce the virus dependence of ribavirin. Shoot tips were not rooted on the medium in this experiment; nevertheless, 2 mm shoot tips were isolated successfully.

3.5. The Effect of Pre-Rooted Shoots on Phytotoxicity and Chemotherapeutic Efficacy

The use of pre-rooted shoots for chemotherapeutic treatment sometimes increased the survival rate and allowed us to carry out some experiments. In the case of ribavirin, this method increased the survival rate to 80–90% (Table 4a). In the case of zidovudine, the use of pre-rooted shoots in the Kékfrankos Kt. 1/2 A1 clone also increased the survival rate to 100% at a concentration of 100 mg/L (Table 5), while the use of 2-thiouracil on pre-rooted shoots increased the survival rate to 67–100% at 10 mg/L and to 75–80% at 20 mg/L (Table 6). The data show that pre-rooting alone increases the survival rate of shoot tips. This phenomenon can be explained by the fact that rooted plants are more resistant to the effects of chemotherapeutic treatments. However, the effects of chemotherapeutic compounds may also be reduced through the roots.
In the case of Kékfrankos Kt. 1/2 A1, pre-rooting did not affect GPGV elimination, which was successful; the efficiency of the elimination of the same virus (GPGV) decreased to 75% in the case of another clone—Furmint P51 A1. The efficiency of GFkV and GRSPaV elimination from this clone also decreased, but the efficiency of GRSPaV elimination from the other four clones did not change. Our results show that the effect of pre-rooting on elimination efficiency is cultivar-dependent and generally reduces it.
Overall, pre-rooting reduces plant mortality and phytotoxicity symptoms, but it also reduces the effectiveness of virus elimination, as it can inhibit the uptake of antiviral agents or affect other physiological processes.

4. Discussion

Virus-induced diseases cause significant economic damage. For example, grapevine leafroll disease can cause losses of $2000–23,000 per hectare even in cases of moderate infections [44]. Therefore, it is extremely important to produce propagating material that is free from viruses that cause significant economic damage. Among the available virus removal methods, chemotherapy is one of the most promising procedures.
In our experiments, we tested the efficiency of three different chemotherapeutic agents—ribavirin, zidovudine and 2-thiouracil—alone or in combination for the elimination of seven viruses and two viroids. Ribavirin proved to be effective for elimination of GFkV, GPGV and GRSPaV, with results similar to those previously published for the application of ribavirin [5,16,17]. Since these are very prevalent viruses, it is important result that ribavirin effectively eliminates them. Ribavirin was also shown to be effective in eliminating GLRaV-4 (78.3%). This is an important finding, because this virus may contribute to the symptoms of grapevine leafroll disease. To the best of our knowledge, this is the first evidence of the successful use of ribavirin and other chemotherapeutic agents to eliminate GLRaV-4.
Since GFLV is not a phloem-limited virus, removal of this nepovirus proved to be the most difficult of all the viruses tested. Ribavirin alone could not eliminate GFLV in our experiments, despite studies reporting its effectiveness [13,45]. However, Dolatabadi et al. [46] reported similar results to ours, observing that GFLV could not be eliminated from the grapevine cultivar ‘Peykani’ using 25 mg/L ribavirin. These results suggest that the use of ribavirin on GFLV may be genotype-dependent, and a similar phenomenon may be the cause of failure in the Sárfehér and Furmint cultivars. In our experiments, ribavirin also showed very low efficacy against GLRaV-1 and GVA. In the case of GLRaV-1, this confirms previous results following the use of doses below 30 mg/L for several cultivars [15,46]. However, the use of 20–25 mg/L ribavirin has been shown to be effective against GLRaV-1 in Sangiovese and Riesling cultivars [14,47]. This may also indicate a genotype dependence in ribavirin. The use of ribavirin was shown to be less efficient for the elimination of GVA, similar to other studies [15,48,49]. However, for the Shine muscat cultivar (Vitis labruscana × Vitis vinifera), ribavirin-based chemotherapy of GVA was very successful (98%) [50].
Zidovudine did not remove any of the viruses we tested, while the use of 2-thiouracil proved to be highly phytotoxic, with only 25% efficacy against GLRaV-4 among the viruses tested. The combination of ribavirin and zidovudine was able to eliminate GFLV with 12.5% efficacy. The combination of ribavirin and 2-thiouracil was very effective against GRSPaV and GPGV. Only the combination of ribavirin and 2-thiouracil showed 100% effectiveness in eliminating GRSPaV. To the best of our knowledge, this is the first report of the successful combined use of zidovudine and 2-thiouracil with ribavirin for grapevines.
Viroids were found to persist following almost all chemotherapeutic treatments; we could not eliminate them from the plants. We observed only one regenerated plant in which the combination of ribavirin and zidovudine could successfully remove GYSVd-1 (Table 4b). Our results confirm those of Eichmeier et al. [14], who found the same result, i.e., that ribavirin could not successfully eliminate HSVd and GYSVd-1. Moreover, ribavirin was found to be inefficient or showed poor efficacy when it was used to eliminate apple scar skin viroid (Apscaviroid cicatricimali) from Malus pumila [51].
In conclusion, ribavirin is a widely applicable chemotherapeutic agent with moderate phytotoxicity at 25 mg/L, while the use of zidovudine and 2-thiouracil in combination with ribavirin may increase the efficiency of elimination.

5. Conclusions

The identification of the viromes in the mother plants enabled us to test antiviral agents against mixed infections, thus providing information on their effectiveness. Ribavirin is an effective tool for eliminating many viruses, but its effectiveness can be drastically reduced in certain viruses and cultivars. This suggests that other antiviral compounds should be tested alongside ribavirin in grapevines. Zidovudine and 2-thiouracil alone were not effective in eliminating the tested viruses in our experiments, but their combined use with ribavirin may increase the chances of producing healthy grapevine propagation materials. The antiviral compounds tested showed practically no effect against the viroids studied, which highlights the limitations of using antiviral compounds.

Author Contributions

Conceptualization, R.O. and E.V.; methodology, R.O. and E.V.; investigation, Z.N.G.; K.O., M.T. and N.J.-C.; resources, R.O. and D.A.N.S.; data curation, M.T., N.J.-C. and Z.N.G.; writing—original draft preparation, M.T., R.O. and E.V.; visualization, M.T., R.O. and E.V. writing—review and editing, R.O., E.V. and D.A.N.S.; project administration, R.O.; supervision, E.V.; funding acquisition, R.O. and E.V. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by National Research, Development and Innovation Office (NKFIH) grant number: K131679.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding authors.

Acknowledgments

M.T. is PhD student at the Hungarian University of Agriculture and Life Sciences in the Doctoral School of Horticultural Sciences.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
GFkVgrapevine fleck virus, Maculavirus vitis
GFLVgrapevine fanleaf virus, Nepovirus foliumflabelli
GLRaV-1grapevine leafroll associated virus 1, Ampelovirus univitis
GLRaV-4grapevine leafroll associated virus 4, Ampelovirus tetravitis
GPGVgrapevine Pinot gris virus, Trichovirus pinovitis
GRSPaVgrapevine rupestris stem pitting associated virus, Foveavirus rupestris
GVAgrapevine virus A, Vitivirus alphavitis
GYSVd-1grapevine yellow speckled viroid 1, Apscaviroid alphaflavivitis
HSVdhop stunt viroid, Hostuviroid impedihumuli

References

  1. Fuchs, M. Grapevine viruses: Did you say more than a hundred? J. Plant Pathol. 2025, 107, 217–227. [Google Scholar] [CrossRef]
  2. Miljanić, V.; Rusjan, D.; Škvarč, A.; Chatelet, P.; Štajner, N. Elimination of Eight Viruses and Two Viroids from Preclonal Candidates of Six Grapevine Varieties (Vitis vinifera L.) through In Vivo Thermotherapy and In Vitro Meristem Tip Micrografting. Plants 2022, 11, 1064. [Google Scholar] [CrossRef] [PubMed]
  3. Nuzzo, F.; Moine, A.; Nerva, L.; Pagliarani, C.; Perrone, I.; Boccacci, P.; Gribaudo, I.; Chitarra, W.; Gambino, G. Grapevine virome and production of healthy plants by somatic embryogenesis. Microb. Biotechnol. 2022, 15, 1357–1373. [Google Scholar] [CrossRef]
  4. Turcsan, M.; Demian, E.; Varga, T.; Jaksa-Czotter, N.; Szegedi, E.; Olah, R.; Varallyay, E. Hts-based monitoring of the efficiency of somatic embryogenesis and meristem cultures used for virus elimination in grapevine. Plants 2020, 9, 1782. [Google Scholar] [CrossRef] [PubMed]
  5. Skiada, F.G.; Maliogka, V.I.; Katis, N.I.; Eleftheriou, E.P. Elimination of Grapevine rupestris stem pitting-associated virus (GRSPaV) from two Vitis vinifera cultivars by in vitro chemotherapy. Eur. J. Plant Pathol. 2013, 135, 407–414. [Google Scholar] [CrossRef]
  6. Wambugu, F.M.; Secor, G.A.; Gudmestad, N.C. Eradication of potato virus Y and S from potato by chemotherapy of cultured axillary bud tips. Am. Potato J. 1985, 62, 667–672. [Google Scholar] [CrossRef]
  7. Kudell, A.R.; Buchenauer, H. Elimination of raspberry bushy dwarf virus from axillary bud cultures of red raspberry cv. Lloyd George by antiviral compounds. J. Phytopathol. 1989, 124, 332–336. [Google Scholar] [CrossRef]
  8. Cieslinska, M.; Zawadzka, B. Preliminary results of investigation on elimination of viruses from apple, pear and raspberry using thermotherapy and chemotherapy in vitro. Phytopathol. Pol. 1999, 17, 41–48. [Google Scholar]
  9. Sedlák, J.; Paprštein, F.; Suchá, J. Influence of chemotherapy on development and production of virus free in vitro strawberry plants. Hort. Sci. 2019, 46, 53–56. [Google Scholar] [CrossRef]
  10. Modarresi Chahardehi, A.; Rakhshandehroo, F.; Mozafari, J.; Mousavi, L. Efficiency of a chemo-thermotherapy technique for eliminating Arabis mosaic virus (ArMV) and Prunus necrotic ringspot virus (PNRSV) from in vitro rose plantlets. J. Crop Prot. 2016, 5, 497–506. [Google Scholar] [CrossRef]
  11. Magyar-Tábori, K.; Mendler-Drienyovszki, N.; Hanász, A.; Zsombik, L.; Dobránszki, J. Phytotoxicity and Other Adverse Effects on the in Vitro Shoot Cultures Caused by Virus Elimination Treatments: Reasons and Solutions. Plants 2021, 10, 670. [Google Scholar] [CrossRef] [PubMed]
  12. Olah, K.; Turcsán, M.; Jahnke, G.; Deak, T.; Olah, R.; Sardy, D.Á.N. The use of pre-rooted in vitro grapevine shoot segments for elimination of Arabis mosaic virus with chemotherapy. Mitt. Klosterneuburg. 2023, 73, 168–175. [Google Scholar]
  13. Aiter, N.; Lehad, A.; Haddad, B.; Taibi, A.; Meziani, S.; Rabhi, M.L.; Khelifi, L.; Chaouia, C. Sanitation of autochthonous grapevine varieties from Algeria by chemotherapy. Acta Phytopathol. Entomol. Hung. 2020, 55, 43–50. [Google Scholar] [CrossRef]
  14. Eichmeier, A.; Kominkova, M.; Pecenka, J.; Kominek, P. High-throughput small RNA sequencing for evaluation of grapevine sanitation efficacy. J. Virol. Methods 2019, 267, 66–70. [Google Scholar] [CrossRef]
  15. Guta, I.C.; Buciumeanu, E.C. Grapevine chemotherapy for elimination of multiple virus infection. Rom. Biotechnol. Lett. 2011, 16, 6535–6539. [Google Scholar]
  16. Hu, G.J.; Dong, Y.F.; Zhang, Z.P.; Fan, X.D.; Fang, R.E.N. Elimination of grapevine fleck virus and grapevine rupestris stem pitting-associated virus from Vitis vinifera 87-1 by ribavirin combined with thermotherapy. J. Integr. Agric. 2021, 20, 2463–2470. [Google Scholar] [CrossRef]
  17. Komínek, P.; Komínková, M.; Jandová, B. Effect of repeated Ribavirin treatment on grapevine viruses. Acta. Virol. 2016, 60, 400–403. [Google Scholar] [CrossRef] [PubMed]
  18. Gao, K.; Chen, Q.; Pan, B.; Sun, Y.; Xu, Y.; Chen, D.; Liu, H.; Luo, C.; Chen, X.; Li, H.; et al. Current Achievements and Future Prospects in Virus Elimination Technology for Functional Chrysanthemum. Viruses 2023, 15, 1770. [Google Scholar] [CrossRef]
  19. Szabó, L.K.; Desiderio, F.; Kirilla, Z.; Hegedűs, A.; Várallyay, É.; Preininger, É. A mini-review on in vitro methods for virus elimination from Prunus sp. fruit trees. Plant Cell Tissue Organ Cult. 2024, 156, 42. [Google Scholar] [CrossRef]
  20. Jakab-Ilyefalvi, Z.; Pamfil, D.; Clapa, D.; Fira, A. The effect of heat treatment and in vitro chemotherapy mediated by 2-thiouracil on plum pox virus (PPV) content in meristem regenerated plum plants. Ann. Rom. Soc. Cell Biol. 2012, 17, 101–110. [Google Scholar]
  21. Gong, H.; Igiraneza, C.; Dusengemungu, L. Major in vitro techniques for potato virus elimination and post eradication detection methods. A review. Am. J. Potato Res. 2019, 96, 379–389. [Google Scholar] [CrossRef]
  22. Xu, P.S.; Niimi, Y. Evaluation of virus-free bulblet production by antiviral and/or heat treatment in in vitro scale cultures of Lilium longiflorum ‘Georgia’ and L. X ‘Casablanca’. J. Jpn. Soc. Hortic. Sci. 1999, 68, 640–647. [Google Scholar] [CrossRef]
  23. Woo, J.H.; Nam, H.H.; Lee, H.S.; Choi, K.B.; Yoon, J.T.; Kim, K.W. Effect of Antivirals on the Elimination of Lily Symptomless Virus in Lilium Oriental Hybrid ‘Casa Blanca’. HortScience 2004, 39, 822–823. [Google Scholar] [CrossRef]
  24. Asghar, A.; Singh, G. Production of Indian citrus ringspot virus free plants of Kinnow employing chemotherapy coupled with shoot tip grafting. J. Cent. Eur. Agric. 2007, 8, 1–8. [Google Scholar]
  25. Singh, B. Effect of antiviral chemicals on in vitro regeneration response and production of PLRV-free plants of potato. J. Crop Sci. Biotechnol. 2015, 18, 341–348. [Google Scholar] [CrossRef]
  26. Verma, N.; Ram, R.; Zaidi, A.A. In vitro production of Prunus necrotic ringspot virus-free begonias through chemo-and thermotherapy. Sci. Hort. 2005, 103, 239–247. [Google Scholar] [CrossRef]
  27. Pavelkova, R.; Kudelkova, M.; Ondrusikova, E.; Eichmeier, A. Virus Elimination in Peach cv. ‘Red Haven’ by Chemotherapy. Agric. Commun. 2015, 3, 16–20. [Google Scholar]
  28. Sedlák, J.; Přibylová, J.; Koloňuk, I.; Špak, J.; Lenz, O.; Semerák, M. Elimination of Solanum nigrum ilarvirus 1 and Apple hammerhead viroid from apple cultivars using antivirals ribavirin, rimantadine, and zidovudine. Viruses 2023, 15, 1684. [Google Scholar] [CrossRef] [PubMed]
  29. Ohta, S.; Kuniga, T.; Nishikawa, F.; Yamasaki, A.; Endo, T.; Iwanami, T.; Yoshioka, T. Evaluation of novel antiviral agents in the elimination of satsuma dwarf virus (SDV) by semi-micrografting in citrus. J. Jpn. Soc. Hortic. Sci. 2011, 80, 145–149. [Google Scholar] [CrossRef]
  30. Kudelková, M.; Cechová, J.; Ondrusiková, E.; Baránek, M. Use of antivirals for Carlavirus elimination in Allium sativum L. In: VIII International Symposium on In Vitro Culture and Horticultural Breeding. Acta Hort. 2013, 1083, 589–594. [Google Scholar]
  31. Gambino, G.; Perrone, I.; Gribaudo, I. A Rapid and effective method for RNA extraction from different tissues of grapevine and other woody plants. Phytochem. Anal. 2008, 19, 520–525. [Google Scholar] [CrossRef]
  32. Jaksa-Czotter, N.; Nagyné Galbács, Z.; Jahan, A.; Demian, E.; Várallyay, É. Viromes of Plants Determined by High-Throughput Sequencing of Virus-Derived siRNAs. In Viral Metagenomics: Methods and Protocols; Springer: New York, NY, USA, 2023; pp. 179–198. [Google Scholar]
  33. Xu, Q.; Wen, X.; Deng, X. A simple protocol for isolating genomic DNA from chestnut rose (Rosa roxburghii Tratt) for RFLP and PCR analyses. Plant Mol. Biol. Rep. 2004, 22, 301–302. [Google Scholar] [CrossRef]
  34. Szegedi, E.; Deak, T.; Turcsan, M.; Szenasi, M.; Borde, A.; Olah, R. Evaluation of intron containing potential reference gene-specific primers to validate grapevine nucleic acid samples prepared for conventional PCR and RT-PCR. Vitis 2018, 57, 69–73. [Google Scholar]
  35. Osman, F.; Rowhani, A. Application of a spotting sample preparation technique for the detection of pathogens in woody plants by RT-PCR and real-time PCR (TaqMan). J. Virol. Methods 2006, 133, 130–136. [Google Scholar] [CrossRef] [PubMed]
  36. Engel, E.A.; Escobar, P.F.; Rojas, L.A.; Rivera, P.A.; Fiore, N.; Valenzuela, P.D. A diagnostic oligonucleotide microarray for simultaneous detection of grapevine viruses. J. Virol. Method. 2010, 163, 445–451. [Google Scholar] [CrossRef]
  37. Olah, R.; Turcsan, M.; Jaksa-Czotter, N.; Galbacs, Z.N.; Olah, K.; Sardi, D.N.; Plesko, I.M.; Varallyay, E. First Report of Grapevine Leafroll-Associated Virus 4 Infecting Grapevine in Hungary. Plant Dis. 2024, 108, 2245. [Google Scholar] [CrossRef]
  38. Nakaune, R.; Nakano, M. Efficient methods for sample processing and cDNA synthesis by RT-PCR for the detection of grapevine viruses and viroids. J. Virol. Methods 2006, 134, 244–249. [Google Scholar] [CrossRef] [PubMed]
  39. Osman, F.; Leutenegger, C.; Golino, D.; Rowhani, A. Comparison of low-density arrays, RT-PCR and real-time TaqMan® RT-PCR in detection of grapevine viruses. J. Virol. Methods 2008, 149, 292–299. [Google Scholar] [CrossRef] [PubMed]
  40. Lima, M.F.; Alkowni, R.; Uyemoto, J.K.; Golino, D.; Osman, F.; Rowhani, A. Molecular analysis of a California strain of Rupestris stem pitting-associated virus isolated from declining Syrah grapevines. Arch. Virol. 2006, 151, 1889–1894. [Google Scholar] [CrossRef]
  41. Glasa, M.; Predajňa, L.; Komínek, P.; Nagyová, A.; Candresse, T.; Olmos, A. Molecular characterization of divergent grapevine Pinot gris virus isolates and their detection in Slovak and Czech grapevines. Arch. Virol. 2014, 159, 2103–2107. [Google Scholar] [CrossRef]
  42. Farkas, E.M.; Czotter, N.; Lózsa, R.; Dula, T.; Ember, I.; Várallyay, E.; Szegedi, E. Conventional PCR primers for the detection of grapevine pathogens disseminated by propagating material. Int. J. Hort. Sci. 2014, 20, 69–80. [Google Scholar]
  43. Czotter, N.; Molnár, J.; Pesti, R.; Demián, E.; Baráth, D.; Varga, T.; Várallyay, É. Use of siRNAs for Diagnosis of Viruses Associated to Woody Plants in Nurseries and Stock Collections. Methods Mol. Biol. 2018, 1746, 115–130. [Google Scholar]
  44. Atallah, S.S.; Gómez, M.I.; Fuchs, M.F.; Martinson, T.E. Economic impact of grapevine leafroll disease on Vitis vinifera cv. Cabernet franc in Finger Lakes vineyards of New York. Am. J. Enol. Vitic. 2012, 63, 73–79. [Google Scholar] [CrossRef]
  45. Weiland, C.M.; Cantos, M.; Troncoso, A.; Perez-Camacho, F. Regeneration of virus-free plants by in vitro chemotherapy of GFLV (Grapevine fanleaf virus) infected explants of Vitis vinifera L. Cv’Zalema’. In I International Symposium on Grapevine Growing, Commerce and Research. Acta Hort. 2003, 652, 463–466. [Google Scholar]
  46. Dolatabadi, K.; Davarynejad, G.; Safarnejad, M.R.; Ghayoor, Z. Developing virus-free grapevine explants by using silver-nanoparticles and its comparison with chemo and thermotherapy-based approaches. J. Crop Prot. 2023, 12, 15–27. [Google Scholar]
  47. Panattoni, A.; Luvisi, A.; Triolo, E. Selective chemotherapy on Grapevine leafroll-associated virus-1 and-3. Phytoparasitica 2011, 39, 503–508. [Google Scholar] [CrossRef]
  48. Guta, I.C.; Buciumeanu, E.C.; VIȘOIU, E. Elimination of Grapevine fleck virus by in vitro Chemotherapy. Not. Bot. Horti Agrobo. 2014, 42, 115–118. [Google Scholar] [CrossRef]
  49. Panattoni, A.; D’Anna, F.; Cristani, C.; Triolo, E. Grapevine vitivirus A eradication in Vitis vinifera explants by antiviral drugs and thermotherapy. J. Virol. Methods 2007, 146, 129–135. [Google Scholar] [CrossRef]
  50. Yu, S.; Kan, Q.; Huang, H.; Wang, J.; Xie, Y.; Li, H.; Zhang, X.; Liu, C.; Cheng, Y. Grapevine cultivar Shine Muscat in China: Occurrence of viruses and attempts to produce certified propagation material. J. Plant Pathol. 2023, 105, 1609–1616. [Google Scholar] [CrossRef]
  51. Hu, G.; Dong, Y.; Zhang, Z.; Fan, X.; Ren, F. Inefficiency of ribavirin to eliminate apple scar skin viroid from apple plants. Plant Cell Tissue Organ Cult. 2022, 151, 189–197. [Google Scholar] [CrossRef]
Table 1. List of the virus specific primers used to detect viruses present on the mother plants.
Table 1. List of the virus specific primers used to detect viruses present on the mother plants.
VirusPrimer NamePrimer Sequence (5′-3′)Annealing TemperatureReference
GFLVGFLV CP 433VGAACTGGCAAGCTGTCGTAGAAC58 °C[35]
GFLV CP 912CGCTCATGTCTCTCTGACTTTGACC
GLRaV-1LR1CPF1CTAGCGTTATATCTCAAAATGA50 °C[36]
LR1CPR1CCCATCACTTCAGCACATAAA
GLRaV-4GLRaV456_13268FTGGACAATTTAGGTAATGTAGTAGC50 °C[37]
GLRaV456_13722RTCACAGATGCCTGACATGGTT
GVAGVA 6540UTTTGGGTACATCGCGTTGGT54 °C[38]
GVA 6880DTCTAAGCCCGACGCGAAGT
GFkVGFk V1/FGGTCCTCGGCCCAGTGAAAAAGTA58 °C[39]
GFk C1/RGGCCAGGTTGTAGTCGGTGTTGTC
GRSPaV48VAGCTGGGATTATAAGGGAGGT50 °C[40]
49CCCAGCCGTTCCACCACTAAT
GPGVGPG-6609FGAGATCAACAGTCAGGAGAG50 °C[41]
GPG-7020RGACTTCTGGTGCCTTATCAC
HSVdHSVd-FCTGGGGAATTCTCGAGTTGCC60 °C[42]
HSVd-RAGGGGCTCAAGAGAGGATCCG
GYSVd-1GYSVd-1-FTCACCTCGGAAGGCCGCCGCGG60 °C[43]
GYSVd-1-RGTGAAACCACAGGAACCACAGG
tubulintub-fw2CACGATGCTTTCAACACCTTC50 °C[34]
tub-rev2CTTCATTGTCCAAGAGCACAG
Table 2. Experimental setup of the chemotherapeutic treatments.
Table 2. Experimental setup of the chemotherapeutic treatments.
Antiviral Chemical(s)Applied Concentration(s)Treated Genotype(s)
Ribavirin25 mg/LKadarka P131 A1, Sárfehér A1, Furmint P51 ÜH2, Kékfrankos Kt 1/2 A1, Furmint P51 A1
Zidovudine10, 20, 30, 40, 80, 100, 120 mg/LSárfehér A1
50 mg/LKadarka P131 A1
100 mg/LKékfrankos Kt 1/2 A1
2-thiouracil5, 10, 15, 20 mg/LSárfehér A1
10 mg/LKadarka P131 A1, Kékfrankos Kt. 1/2 A1
20 mg/LFurmint P51 ÜH2, Furmint P51 A1
Ribavirin + zidovudine25 mg/L + 50 mg/LFurmint P51 ÜH2, Furmint P51 A1
Ribavirin + 2-thiouracil25 mg/L + 10 mg/LKékfrankos Kt 1/2 A1
Table 3. Number of virus-derived contigs in the different libraries as determined by small RNA HTS.
Table 3. Number of virus-derived contigs in the different libraries as determined by small RNA HTS.
NepovirusesAmpelovirusesViti-VirusMacula-VirusMarafivirusesFovea-VirusTricho-VirusViroids
GFLVArMVGDefVGLRaV-1GLRaV-4GLRaV-5GLRaV-6GVAGFKVGRVFVGSyV-1GRSPaVGPGVHSVdGYSVd-1
1Kadarka P131 A100011300000009044
2Sárfehér A10000926001021047
3Furmint P51 ÜH2611955000000004014
4Kékfrankos Kt. 1/2 A100000000032105347
5Furmint P51 A1000155000311385031333
Table 4. Results following the use of chemotherapy for virus elimination when ribavirin was used alone or in combination.
Table 4. Results following the use of chemotherapy for virus elimination when ribavirin was used alone or in combination.
Regeneration EfficiencyElimination Efficiency %
cultivar and cloneplant numberGFLVGLRaV-1GLRaV-4GVAGFkVGRSPaVGPGVHSVdGYSVd-1
(a) Ribavirin 25 mg/LKadarka P131 A1survived30/104x5.50xxx50.0x0.00.0
regenerated18/50
virus free %0
Kadarka P131 A1 pre-rootedsurvived40/50x3.4xxx50.0x0.00.0
regenerated61/89
virus free %5.5
Sárfehér A1survived36/76xx78.3xx77.997.10.00.0
regenerated69/81
virus free %76.5
Furmint P51 ÜH2survived34/690.0xxxx68.3xx0.0
regenerated47/84
virus free %0
Furmint P51 ÜH2 pre-rootedsurvived9/100.0xxxx87.5xx0.0
regenerated8/8
virus free %0
Kékfrankos Kt. 1/2 A1survived19/48xxxxx82.0100.00.00.0
regenerated11/29
virus free %82
Kékfrankos Kt. 1/2 A1 pre-rootedsurvived69/86xxxxx51.0100.00.00.0
regenerated127/162
virus free %51
Furmint P51 A1survived28/66x4.3x6.578.369.6100.00.00.0
regenerated47/75
virus free %1.7
Furmint P51 A1 pre-rootedsurvived8/10x0.0x0.050.025.075.00.00.0
regenerated8/8
virus free %0
(b) Ribavirin—Zidovudine 25 + 50 mg/LFurmint P51 A1 pre-rootedsurvived8/10x0.0x0.062.50.062.50.012.5
regenerated8/8
virus free %0
Furmint P51 ÜH2 pre-rootedsurvived8/1012.5xxxx25.0xx0.0
regenerated8/8
virus free %12.5
(c) Ribavirin
-2-thiouracil 25 + 10 mg/L		Kékfrankos Kt. 1/2 A1survived4/8xxxxx100.0100.00.00.0
regenerated4/4
virus free %100.0
Kékfrankos Kt. 1/2 A1 pre-rootedsurvived6/8xxxxx66.0100.00.00.0
regenerated21/23
virus free %66.0
x: the virus/viroid was not present in the mother plant. virus-free %: percentage of plantlets free from tested viruses (undetectable by RT-PCR), excluding viroids. elimination: the virus was not detectable by RT-PCR after 8 months. The green fields indicate positive results.
Table 5. Results of the use of chemotherapy for virus elimination when zidovudine was used.
Table 5. Results of the use of chemotherapy for virus elimination when zidovudine was used.
Regeneration EfficiencyElimination Efficiency %
cultivar and cloneplant numberGFLVGLRaV-1GLRaV-4GVAGFkVGRSPaVGPGVHSVdGYSVd-1
Zidovudine10 mg/LSárfehér A1survived7/7xx0.0xx0.00.00.00.0
regenerated5/5
virus free %0
20 mg/LSárfehér A1survived7/7xx0.0xx0.00.00.00.0
regenerated5/5
virus free %0
30 mg/LSárfehér A1survived7/7xx0.0xx0.00.00.00.0
regenerated5/5
virus free %0
40 mg/LSárfehér A1survived7/7xx0.0xx0.00.00.00.0
regenerated5/5
virus free %0
50 mg/LKadarka P131 A1survived10/10x0.0xxx0.0x0.00.0
regenerated4/5
virus free %0
80 mg/LSárfehér A1survived10/10xx0.0xx0.00.00.00.0
regenerated5/5
virus free %0
100 mg/mLKékfrankos Kt. 1/2 A1survived6/20xxxxx0.00.00.00.0
regenerated16/25
virus free %0
100 mg/mLKékfrankos Kt. 1/2 A1 pre-rootedsurvived8/8xxxxx0.00.00.00.0
regenerated35/44
virus free %0
120 mg/LSárfehér A1survived10/10xx0.0xx0.00.00.00.0
regenerated5/5
virus free %0
x: the virus/viroid was not present in the mother plant. virus-free %: percentage of plantlets free from tested viruses (undetectable by RT-PCR), excluding viroids. elimination: the virus was not detectable by RT-PCR after 8 months.
Table 6. Results of the use of chemotherapy for virus elimination when 2-thiouracil was used.
Table 6. Results of the use of chemotherapy for virus elimination when 2-thiouracil was used.
Regeneration EfficiencyElimination Efficiency %
cultivar and cloneplant numberGFLVGLRaV-1GLRaV-4GVAGFkVGRSPaVGPGVHSVdGYSVd-1
2-thiouracil10 mg/LKadarka P131 A1survived2/12x0.0xxx0.0x0.00.0
regenerated2/2
virus free %0
10 mg/LKadarka P131 A1 pre-rootedsurvived8/12x0.0xxx0.0x0.00.0
regenerated7/8
virus free %0
10 mg/LKékfrankos Kt. 1/2 A1survived0/11xxxxxnot testednot testednot testednot tested
regeneratedx
virus free %x
10 mg/LKékfrankos Kt. 1/2 A1 pre-rootedsurvived10/10xxxxx0.00.00.00.0
regenerated14/14
virus free %0
10 mg/LSárfehér A1survived0/12xxnot testedxxnot testednot testednot testednot tested
regeneratedx
virus free %x
10 mg/LSárfehér A1 pre-rootedsurvived10/12xx25.0xx0.00.00.00.0
regenerated8/10
virus free %0
20 mg/LSárfehér A1 pre-rootedsurvived8/10xx25.0xx0.00.00.00.0
regenerated8/8
virus free %0
20 mg/LFurmint P51 ÜH2 pre-rootedsurvived9/120.0xxxx0.0xx0.0
regenerated5/9
virus free %0
x: the virus/viroid was not present in the mother plant. virus-free %: percentage of plantlets free from tested viruses (undetectable by RT-PCR), excluding viroids. elimination: the virus was not detectable by RT-PCR after 8 months. The green fields indicate positive results.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Turcsan, M.; Jaksa-Czotter, N.; Nagyne Galbacs, Z.; Olah, K.; Olah, R.; Varallyay, E.; Nyitraine Sardy, D.A. Effects of Chemotherapy on the Elimination of Various Viruses and Viroids from Grapevine. Horticulturae 2026, 12, 46. https://doi.org/10.3390/horticulturae12010046

AMA Style

Turcsan M, Jaksa-Czotter N, Nagyne Galbacs Z, Olah K, Olah R, Varallyay E, Nyitraine Sardy DA. Effects of Chemotherapy on the Elimination of Various Viruses and Viroids from Grapevine. Horticulturae. 2026; 12(1):46. https://doi.org/10.3390/horticulturae12010046

Chicago/Turabian Style

Turcsan, Mihaly, Nikoletta Jaksa-Czotter, Zsuzsanna Nagyne Galbacs, Krisztina Olah, Robert Olah, Eva Varallyay, and Diana Agnes Nyitraine Sardy. 2026. "Effects of Chemotherapy on the Elimination of Various Viruses and Viroids from Grapevine" Horticulturae 12, no. 1: 46. https://doi.org/10.3390/horticulturae12010046

APA Style

Turcsan, M., Jaksa-Czotter, N., Nagyne Galbacs, Z., Olah, K., Olah, R., Varallyay, E., & Nyitraine Sardy, D. A. (2026). Effects of Chemotherapy on the Elimination of Various Viruses and Viroids from Grapevine. Horticulturae, 12(1), 46. https://doi.org/10.3390/horticulturae12010046

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Article metric data becomes available approximately 24 hours after publication online.
Back to TopTop