WUSCHEL Transcription Factor Regulates Floral Development in ‘Jizaomi’ Grapevine

Abstract

Carpel number has been recognized as a critical factor influencing fruit size, ultimately determining yield and economic efficiency. The WUSCHEL (WUS) protein is essential for maintaining stem cell homeostasis in the floral meristem. Its expression level directly influences the size of the floral meristem (FM), thereby determining the number of floral organs in Arabidopsis thaliana, Solanum lycopersicum, and Cucumis sativus. While its role remained largely unexplored in grapevine (Vitis vinifera). This study cloned the VvWUS gene from the polycarpic grape cultivar ‘Jizaomi’. Transgenic tomato lines expressing VvWUS heterologously exhibited accelerated floral transition, enhanced carpel/floral organ initiation, and had significantly higher locule numbers relative to wild type. Furthermore, direct binding of VvWUS to the VvAGAMOUS (VvAG) promoter and activation of VvAG expression were demonstrated through yeast one-hybrid (Y1H) and dual-luciferase (LUC) assays. These findings elucidated the molecular function of VvWUS in grape carpel development, providing a foundational basis for molecular breeding strategies targeting large-berry grape varieties.

1. Introduction

Grapevine (Vitis vinifera), one of the oldest fruit crops globally, holds significant economic value and is extensively cultivated worldwide. Berry size and morphology serve as critical determinants of visual quality and market value in grape production while also constituting essential traits for cultivar selection in breeding programs [1]. Berry size in grapevine results from complex physiological interactions during ovary and fruit development, exhibiting close correlation with carpel number in the ovary. Consequently, elucidating the mechanisms governing carpel formation holds considerable significance for breeding superior large-berry grape cultivars.

Current research indicates that the shoot apical meristem (SAM) serves as the foundation for aerial development in plants. Within the SAM, stem cells exhibit indefinite proliferation capacity, generating the entire aerial plant structure through cell division and differentiation [2]. The floral meristem (FM) differentiates from the SAM. Within the FM, four whorls of floral organs form sequentially during floral development. Following the specification of these four organ whorls, the FM undergoes rapid termination. At this developmental stage, the carpel number becomes established, and the quantity and fusion patterns of carpels determine the locule number in fruits [3,4]. In summary, carpel number depends on FM size, while the transcription factor WUSCHEL (WUS) determines FM size.

WUS, belonging to the modern clade of the WOX (WUSCHEL-related homeobox) family, constitutes a plant-specific group of transcription factors harboring a homeodomain [5]. In Solanum lycopersicum, WUS exhibits expression confined to the organizing center (OC) within the SAM and FM. The WUS protein plays an essential role in maintaining stem cell homeostasis in both shoot and floral meristem systems [6]. WUS also plays critical roles in regulating floral development, reproductive organ formation, cellular totipotency, and diverse cellular processes. In Arabidopsis thaliana, WUS has been demonstrated to be a key regulator essential for maintaining the integrity of stem and floral organ primordia by determining cell fate through the regulation of cellular dedifferentiation processes [7]. Research in Arabidopsis thaliana has revealed that WUS and CLAVATA3(CLV3) establish a negative feedback regulatory loop to maintain SAM size. WUS promotes stem cell identity and activates CLV3 expression within the central zone, while the CLV3 peptide ligand and CLAVATA1/CLAVATA2 (CLV1/CLV2) receptor complex collectively repress WUS transcription in the OC [8,9]. In wus mutant plants, FM activity fails to establish and be maintained properly. These mutants develop only one to two stamens and completely fail to produce carpels [10,11]. In tomato, RNAi-mediated silencing of WUS resulted in reduced size of flowers and fruits along with decreased locule number [12]. Conversely, lc and fas mutant plants exhibited expanded WUS expression domains with elevated transcript levels during carpel primordia development, consequently increasing the locule number [13].

While research on WUS has extensively characterized model species like A. thaliana, tomato, and rice, functional studies in grapevine remain limited. Our laboratory previously demonstrated that the grape VvSUPERMAN (VvSUP) gene negatively regulates carpel number by repressing VvWUS and VvAGAMOUS (VvAG), consequently reducing locule formation [14]. Furthermore, VvAG directly bound the VvCRC promoter and activated its robust expression, thereby modulating carpel development [15]. VvWUS was hypothesized to play a critical role in multicarpellate development in grapevine. In this study, the grape ‘Jizaomi’ was utilized as experimental material. VvWUS was cloned and subjected to bioinformatic analysis, subcellular localization, and expression profiling. Its function was further validated through heterologous overexpression in Solanum lycopersicum. Phenotypic analysis of transgenic lines, combined with yeast one-hybrid (Y1H) and dual-luciferase (LUC) reporter assays, established preliminary insights into VvWUS-mediated regulation of locule development.

2. Materials and Methods

2.1. Experimental Materials

‘Jizaomi’ grapevines: Cultivated in vertical trellising systems at the Horticultural Station of Shanxi Agricultural University (greenhouse conditions). Plant spacing: 2 m between rows × 1 m within rows. Routine management followed standard viticultural protocols.

Nicotiana benthamiana: Seeds preserved in our laboratory. Grown in the LED light incubator under 25 °C, 60–70% RH, 20,000 lux illumination, and 16 h light/8 h dark photoperiods. The LED light incubator (GLD 450E-4) was purchased from Ningbo Ledian Instrument Manufacturing Co., Ltd., Ningbo, China.

Transgenic tomato material: Solanum lycopersicum ‘Micro Tom’ seeds commercially sourced from PanAmerican Seed Company (Chicago, IL, USA).

2.2. Cloning of VvWUS

Total RNA was isolated from inflorescences of V. vinifera ‘Jizaomi’ using a modified CTAB protocol. Reverse transcription was performed to synthesize first-strand cDNA [16]. Gene-specific primers targeting the full-length coding sequence of VvWUS (NCBI reference sequence) were designed for PCR amplification using cDNA as template. Amplified products were purified with a DNA Gel Extraction Kit (YouKang, Hangzhou, China) and ligated into the pMD™19-T cloning vector (TaKaRa, Beijing, China). Ligation products were transformed into Escherichia coli Trans-5α competent cells (TransGen, Beijing, China) via heat shock. Positive clones were verified by colony PCR and subjected to bidirectional Sanger sequencing at Sangon Biotech (Shanghai, China).

2.3. Phylogenetic Tree, Multiple Sequence Alignment, and Promoter Cis-Acting Element Analysis

Amino acid sequences with high homology to the VvWUS protein in other species were retrieved using the BLAST+ 2.16.0 tool available on NCBI (https://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 1 December 2024). Multiple sequence alignment of these amino acid sequences was performed using DNAMAN 7.0 software. For phylogenetic tree construction, MEGA 7.0 software was employed, and the neighbor-joining (NJ) method was applied to infer evolutionary relationships. To evaluate the reliability and stability of the phylogenetic tree, 1000 bootstrap resampling replicates were conducted [17]. The promoter sequence spanning 2000 bp upstream of the VvWUS start codon was analyzed for cis-acting elements using the PlantCARE database (http://bioinformatics.psb.ugent.be/webtools/plantcare/html, accessed on 1 December 2024).

2.4. Expression Profiling of VvWUS

Total RNA was extracted from inflorescences at various developmental stages and multiple tissues of Vitis vinifera using a modified CTAB protocol. RNA concentration was quantified, and integrity was verified by 1.2% agarose gel electrophoresis. Reverse transcription was performed with a commercial kit (TaKaRa, Beijing, China) to synthesize cDNA. Gene-specific primers were designed and analyzed using BLAST against the tomato genome to verify their specificity. In silico validation was rigorously performed to ensure no significant off-target binding to SlWUS or any other tomato genes. For qRT-PCR analysis of VvWUS, primers were designed with Primer 6 software and synthesized by Sangon Biotech (Shanghai, China). PCR reactions were carried out using the SYBR Green PCR Master Mix Kit (Juhemei, Beijing, China), with grape UBIQUITIN (UBQ) serving as the reference gene. Three technical replicates were included per sample, and relative gene expression was calculated using the 2^−ΔΔCT method [18].

2.5. Subcellular Localization Analysis of VvWUS

The recombinant fusion vector pCAMBIA1300-35S-GFP-VvWUS was transformed into Agrobacterium tumefaciens GV3101 competent cells (Coolaber, Beijing) via the freeze–thaw method [19]. Transformed cells were resuspended in infiltration buffer and dark-incubated for 2 h. Suspensions were infiltrated into the abaxial surface of 4-week-old Nicotiana benthamiana leaves until complete tissue water-soaking was achieved. After 12 h dark incubation followed by 48 h light cultivation, 4–6 leaf disks were excised using a cork borer. Epidermal cell layers were mounted for confocal laser scanning microscopy (CLSM) imaging (Leica, Wetzlar, Germany) [20].

2.6. Agrobacterium-Mediated Tomato Transformation and Phenotypic Analysis of Transgenic Plants

The recombinant pCAMBIA1300-35S-GFP-VvWUS construct was transformed into Agrobacterium tumefaciens GV3101 competent cells (Coolaber, Beijing, China) via freeze–thaw method. Tomato (Solanum lycopersicum ‘Micro-Tom’) transformation was subsequently performed using Agrobacterium-mediated gene transfer. Genomic DNA was extracted from leaves of putative transgenic plants. The extracted DNA was subjected to PCR amplification using primers specific to the hygromycin resistance gene (Hyg) to confirm successful transformation. VvWUS expression levels in independent transgenic lines were quantified by qRT-PCR with SlActin as the endogenous reference gene. Triplicate technical replicates were analyzed, and relative expression was calculated using the 2^−ΔΔCT method [14].

2.7. Yeast One-Hybrid (Y1H) Assay

The full-length VvWUS CDS was ligated into the pGADT7 vector and sequence-verified to confirm correct insertion. Based on established knowledge that WUS binds the TTAATGG motif in AG promoters, the pGADT7-VvWUS (prey) and pAbAi-VvAG (bait) constructs were generated. Yeast competent cells (Saccharomyces cerevisiae Y1H-Gold) were prepared using the PEG/LiAc method. Autoactivation analysis was performed by transforming bait strains with empty pGADT7, determining the minimum inhibitory concentration of Aureobasidin A (AbA). For interaction validation, bait strain competent cells were co-transformed with pGADT7-VvWUS, using pGADT7 empty vector + pAbAi-VvAG as the negative control [21].

2.8. Dual-Luciferase (LUC) Assay

A 1489 bp promoter fragment upstream of the VvAG start codon was amplified from grape genomic DNA and ligated into the pGreenII0800-LUC reporter vector using Gibson Assembly. The pre-constructed pCAMBIA1300-35S-GFP-VvWUS served as the effector vector. Both vectors were transformed into Agrobacterium tumefaciens GV3101 (pSoup). Bacterial suspensions were adjusted to OD600 = 1.0 and mixed at a 1:1 volume ratio. The experimental mixture (effector + reporter) and control (empty effector + reporter) were separately infiltrated into contralateral sides of the same Nicotiana benthamiana leaf. After 3 days of cultivation, luciferase signals were visualized using the PlantView100 (BLT Photon Technology, Guangzhou, China) in vivo imaging system. Infiltrated leaf tissues were homogenized, and Firefly (LUC) and Renilla (REN) luciferase activities were quantified with the Dual Luciferase Reporter Assay Kit (Vazyme, Nanjing, China) using a microplate reader. Promoter activity was calculated as the relative activity ratio of experimental to control groups. At least three independent biological replicates were performed for each experiment [22].

2.9. Statistical Analysis

All experimental data were analyzed using GraphPad Prism 10.1.2 software for statistical significance assessment and graphical representation. Significant differences between groups were determined through one-way ANOVA followed by Duncan’s multiple range test and Student’s t-test. Error bars represent mean values ± standard error (SE). Statistical significance is denoted by asterisks (*) or lowercase letters above data points in figures.

2.10. Primers

The primers used for gene cloning, vector construction, and qRT-PCR analysis were listed in Appendix A 

Table A1. Primer sequences used in this study.

Primer Name		Primer Sequence (5′-3′)
VvWUS	F	ATGGAACCTCAACAACAGCTCCA
	R	TCAGGGGGAATCCGGGGACCT
qVvWUS	F	ATCAGCAGGTGGTGGTCGTG
	R	AGTGGGAGCGTTTCAATCT
Hyg	F	CGACAGATCCGGTCGGCATCTACTCTATTTCTT
	R	TCTCGTGCTTTCAGCTTCGATGTAGGAGGG
qVvUBQ	F	GCTCGCTGTTTTGCAGTTCTAC
	R	AACATAGGTGAGGCCGCACTT
1300-VvWUS	F	GGGGTACCATGGAACCTCAACAAC
	R	GCTCTAGAGGGGGAATCCGGG
qSlAG	F	GGTTCAGTATCCGAGGCCAATGC
	R	AATTGCTGAGGTGGAGGCACAAG
Slactin	F	GCACCCTGTTCTGCTTACTG
	R	CAAAGCATAACCCTCGTAAATAG
AD-VvWUS	F	CGGAATTCATGGAACCTCAACAACAGCTCCA
	R	CGGGATCCTCAGGGGGAATCCGG
AbAi-VvAG	F	CCCAAGCTTACCCCATTAAAAATCGCTTTCAG
	R	GCGTCGACTATTCTCTCTCTAATTAGCTCTGTATTTATGT
0800-VvAG	F	ACTCACTATAGGGCGAATTGGGTACCGGTTGAATCAGACCAAAGGGAT
	R	GCGGCCGCTCTAGAACTAGTGGATCCTTTTCTCTGGGGGGAGACCT

.

3. Results

3.1. VvWUS Expression Profiling Across Vitis vinifera Tissues and Floral Development Stages

To detect differences in VvWUS expression among various tissues of grapevine plants, we took ‘Jizaomi’ grape roots, stems, young leaves, old leaves, young fruits, ripe fruits, buds, tendrils, and flowers for fluorescence quantitative PCR. The results showed that the expression of VvWUS was higher in young fruits and buds and lower in roots and stems, and it was not significantly expressed in young leaves and mature fruits (Figure 1A). We hypothesized that VvWUS is activated during the expansion stage of the ovary in young fruits to promote cell division to maintain early fruit morphogenesis, and its high expression in shoots might be for the formation of floral organ primordia, whereas the expression of VvWUS was significantly decreased and almost absent in roots, stems, young leaves, old leaves, mature fruits, tendrils, and opened flowers, suggesting that it is lowly expressed in mature tissues or not expressed at all.

In order to further explore the expression of VvWUS on the developmental process of grapevine flowers, we quantitatively analyzed the fluorescence of inflorescences at different developmental periods. The results showed that VvWUS expression was lowest when the inflorescence length of ‘Extremely Early Nectar’ grapes was 1–2 cm, at which time the development of stamens was completed (Figure 1B). When the inflorescence length was 2–3 cm, VvWUS expression was the highest, at which time the stamens entered the stage of spore-bearing tissue differentiation, and the carpel primordium began to form and continue to grow. This indicates that VvWUS plays an important role in the process of carpel formation.

3.2. Phylogenetic, Sequence, and cis-Regulatory Element Analyses

The reverse transcription product of grape inflorescence RNA was used as a template for cloning to obtain VvWUS, which has a CDS length of 843 bp and encodes 280 amino acids.

To elucidate the evolutionary relationships of VvWUS, BLASTP analysis against the NCBI database identified orthologous WUS proteins from Arabidopsis thaliana, Solanum lycopersicum, Theobroma cacao, Juglans regia, Hevea brasiliensis, Glycine max, Abrus precatorius, Prunus persica, and Vitis vinifera. A neighbor-joining phylogenetic tree constructed with MEGA6 (bootstrap = 1000 replicates) revealed that VvWUS exhibits closest evolutionary affinity to Hevea brasiliensis, followed by Theobroma cacao (Figure 2A). Multiple sequence alignment of these ten orthologs demonstrated conserved HOX domains across all species (Figure 2B), with minimal structural domain sequence divergence, indicating potential functional conservation of WUS proteins in these taxa.

The promoter sequence of 2000 bp upstream of the CDS of the VvWUS gene downloaded from the Grapevine Genome Database was analyzed for promoter cis-acting elements using PlantCARE, and as can be seen in Figure 2C, there were ten light-responsive elements (4cl-CMA2b, chs-CMA1a, TCT-motif, Box 4, AE-box, and TCCC-otif), three cis-regulatory elements essential for anaerobic induction (ARE), two MYB-binding sites (MBS and MRE), one gibberellin-responsive element (P-box), one salicylic acid-responsive element (TCA-element), one wound-responsive element (WUN-motif), and one cis-regulatory element in the metabolic regulation of maize alkyloin (O2-site). This suggests that VvWUS expression may be regulated by MYB family genes and influenced by phytohormones.

3.3. Subcellular Localization of the VvWUS Transcription Factor

To determine the subcellular localization of VvWUS, tobacco leaf epidermal cells were transiently transformed with a VvWUS-GFP fusion construct. As shown in Figure 3, confocal microscopy revealed green fluorescence exclusively in the nuclei of cells expressing the recombinant construct, while empty vector controls showed diffuse cytoplasmic localization. This nuclear localization indicates that VvWUS functions as a transcription factor.

3.4. Functional Validation of VvWUS Through Heterologous Overexpression in Solanum lycopersicum

To investigate the function of VvWUS, heterologous overexpression of VvWUS was performed in ‘Micro Tom’ under the control of the 35S promoter. The VvWUS transgenic tomato plants were characterized, and the results showed that transgenic plants contained a target band approximately 1000 bp in length, while no band was detected in WT (Figure 4B). Analysis of VvWUS expression in transgenic plants by qRT-PCR revealed that, compared with the wild type, the expression of VvWUS was upregulated approximately 7.5-fold in the overexpression line OE-WUS-2 and 5.5-fold in OE-WUS-3. Based on these results, OE-WUS-2 and OE-WUS-3 were selected for subsequent phenotypic analysis (Figure 4C).

Observations of flowers and fruits in tomato plants with overexpression revealed that, as shown in Figure 4A, the OE-WUS-2 and OE-WUS-3 overexpression lines exhibited significantly more branches and flowers, along with earlier flowering, compared to the WT line. Furthermore, it was observed that the OE-WUS-2 and OE-WUS-3 overexpression lines developed more numerous and larger floral organs, including an increased number of petals, larger petal size, and a relatively higher number of ovaries (Figure 4D). Although WUS regulated the development and number of floral organ changes in tomato, we only saw flowers with eight petals that did not develop into fruits, and thus we did not see fruits with more than three ventricles. The sepals developed abnormally, with a phenomenon of inconspicuous disintegration between the two sepals, and the fruits developed in a gourd-like shape, which may be due to the difficulty in fruit formation caused by the increase in the number of floral organs.

To verify whether overexpression of OE-WUS would have an effect on locule numbers, fruit size and weight, locule numbers, longitudinal fruit transverse meristem, and fruit weight were counted in the overexpression lines. The results showed that the number of locules increased 31.52% in the VvWUS transgenic lines compared to WT, fruit transverse diameter increased by 14.06%, longitudinal diameter increased by 13.22%, and fruit weight increased by 54.70% in the transgenic plants (Figure 5A–D). It indicated that VvWUS affected tomato fruit size and weight, and it was hypothesized that it might be possible that VvWUS increased the transverse diameter of the fruit by increasing the number of ventricles and thus made the fruit larger. The results showed that VvWUS transgenic lines had a 2.2-fold increase in the number of branches and a 2.5-fold increase in the number of flowers compared with the WT (Figure 5E,F), which further suggests that WUS plays an important role in the process of branching and flower formation.

3.5. Molecular Regulation of VvAG by the VvWUS Transcription Factor in Grapevine

To further clarify the relationship between VvWUS and VvAG, we determined the relationship between VvWUS protein and VvAG by yeast single-heterozygote assay and luciferase assay, respectively. The results of the yeast one-hybrid assay showed that the empty vector successfully inhibited the growth of yeast on SD/-Leu+50 ng AbA plate, while the experimental group could continue to grow on SD/-Leu+50 ng AbA plate (Figure 6B), suggesting that VvWUS could bind to the TTAATGG site on the VvAG promoter. In order to clarify the specific roles of VvWUS and VvAG, dual-luciferase expression vectors were constructed and verified using the tobacco transient expression system. The results of the dual-luciferase assay showed that VvWUS was able to significantly activate the activity of the promoter of the VvAG gene, and the ratio of LUC/REN in its experimental group was 1.45-fold higher than the ratio in the control group (Figure 6C). The above results indicate that VvWUS can specifically bind to the promoter of VvAG and activate its expression.

4. Discussion

Carpels function as the female reproductive organs in flowering plants, with most developing into fruits following fertilization, thus conferring significant economic importance [23]. During late floral development, carpels form the locules of fruits, where the number of locules ultimately determines fruit size, with greater locule numbers correlating with larger fruit size [19]. Carpel number is regulated not only by genetic factors but also by environmental conditions [24]. Increasing the carpel number to enhance yield and economic returns holds significant research value. However, strategies to augment carpel numbers through environmental modulation or molecular interventions remain a key objective in grape breeding, with limited approaches currently available. The molecular regulatory mechanisms underlying this process are poorly understood. WOX genes constitute a plant-specific subfamily within the eukaryotic homeobox transcription factor superfamily. Members of this family play pivotal roles in plant evolution, growth, and developmental processes [7]. Consequently, functional characterization of WUS in Vitis vinifera is considered scientifically essential.

As a key member of the WOX family, WUS functions as a critical regulator maintaining stem cell populations in the SAM through interactions with the HAM protein family [25]. The WUS transcription factor plays a critical role in floral meristem differentiation and organ formation. It maintains stem cell homeostasis within the floral meristem to ensure proper flower development and organogenesis [26]. In tomato, loss of WUS function leads to arrested SAM growth, failure to produce floral organs, and, consequently, an inability to flower and set fruit [27]. Previous studies in cucumber detected CsWUS expression in the subapical regions of both SAM and FM [28], while overexpression of CpWUS was found to promote early flowering [29]. Homology analysis revealed that WUS orthologs in grapevine contain conserved domains identical to those in model species such as Arabidopsis and tomato, further supporting the functional conservation of WUS proteins. Based on this evolutionary conservation, we cloned VvWUS from grapevine and demonstrated that its heterologous overexpression in transgenic plants resulted in increased numbers of floral organs and fruit locules. This phenotype suggests that VvWUS may play a similar role in grapevine by promoting carpel primordium initiation or influencing floral meristem determinacy, thereby regulating gynoecium development.

To elucidate the molecular mechanism by which VvWUS increases carpel number, we further investigated its biochemical properties. Previous studies have documented the nuclear localization of WUS orthologs, such as PgWUS in pomegranate [30] and CpWUS in wintersweet [29]. Consistent with these reports, our subcellular localization analysis showed that the VvWUS-GFP fusion protein was exclusively expressed in the nucleus. This result supports its identity as a transcription factor and provides a fundamental prerequisite for its function in regulating downstream target genes. Gene expression levels often reflect functional relevance. In Arabidopsis, WUS is predominantly expressed in the SAM, where it plays a crucial role in maintaining pluripotent stem cells. Similarly, TaWUS was found to be highly expressed in pistils of wheat [31], while CaWUS expression in pepper was most abundant in leaves [32]. In our study, VvWUS exhibited high expression in young fruits and buds, with minimal detection in roots, stems, young leaves, and mature fruits. Notably, its expression peaked when the grape inflorescence reached 2–3 cm in length, coinciding with the carpel development stage. These findings suggest that VvWUS may primarily function in maintaining stem cell activity and promoting normal carpel development, which is consistent with previous reports in other species.

The WUS-AG feedback regulatory pathway plays a pivotal role in determining the final number of stamens and carpels. Following floral induction, elevated expression of LEAFY (LFY) and WUS activates AG expression in stamen and carpel primordia, thereby initiating reproductive development [33]. Subsequently, AG promotes the expression of its downstream gene KNUCKLES (KNU), which represses WUS expression and terminates its activity, leading to the cessation of FM activity and ultimately facilitating carpel formation [34]. In the grape cultivar ‘Xiangfei’, VvWUS positively regulates carpel number by interacting with VvSHOOT MERISTEMLESSa (VvSTMa) and VvSTMb and upregulating the expression of VvAG2 [35]. In our study, Y1H assays confirmed that VvWUS directly binds to the promoter region of AG, a key gene governing floral organ identity. Furthermore, LUC reporter assays demonstrated that this binding activates AG expression. Given that AG is a central regulator of stamen and carpel development, our data support a model in which high expression of VvWUS during critical floral developmental stages activates AG expression, thereby positively regulating carpel development. This mechanism provides a direct molecular explanation for the increased carpel number observed in transgenic tomato plants. This model is strongly consistent with our observed expression pattern of VvWUS, which peaks at the 2–3 cm inflorescence stage in grape—a period corresponding to the initiation and development of carpel primordia.

In summary, our study not only cloned the VvWUS gene from grapevine but also demonstrated its role in promoting carpel development through the activation of AG expression, as evidenced by heterologous expression and biochemical assays. Future work will involve constructing vectors using the promoter of VvWUS to achieve spatiotemporally precise control of VvWUS expression, which may further validate our current findings. Additionally, gene editing approaches such as CRISPR/Cas9-mediated knockout of VvWUS in grapevine could provide direct evidence of its biological functions in this species and yield new insights into the regulation of floral development in grape.

5. Conclusions

In conclusion, our study demonstrates that VvWUS is a nuclear-localized transcription factor that exhibits its highest expression during a critical stage of grapevine floral development—the 2–3 cm inflorescence stage—coinciding with the initiation and development of carpel primordia. Heterologous expression of VvWUS in tomato increased carpel number, supporting its functional role in promoting carpel development. Furthermore, we showed that VvWUS directly binds to the promoter of AG and activates its expression, providing mechanistic evidence for its involvement in floral organ patterning. These findings enhance our understanding of WUS-mediated regulatory mechanisms in perennial fruit crops and establish a foundation for further functional characterization of grapevine floral development.