Next Article in Journal
Effect of Plant Growth Regulators on the Physiological Response and Yield of Cucumis melo var. inodorus Under Different Salinity Levels in a Controlled Environment
Next Article in Special Issue
Mass Modeling of Six Loquat (Eriobotrya japonica Lindl.) Varieties for Post-Harvest Grading Based on Physical Attributes
Previous Article in Journal
Impact of Reduced Chemical Fertilizer and Organic Amendments on Yield, Nitrogen Use Efficiency, and Soil Microbial Dynamics in Chinese Flowering Cabbage
Previous Article in Special Issue
Impact of Prolonged Frozen Storage on ‘Mejhoul’ Date Palm Cultivar Based on Selected Qualitative Characteristics
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Functional Analysis of Penicillium expansum Glucose Oxidase-Encoding Gene, GOX2, and Its Expression Responses to Multiple Environmental Factors

College of Food Science and Engineering, Qilu University of Technology (Shandong Academy of Sciences), Jinan 250353, China
*
Author to whom correspondence should be addressed.
Horticulturae 2025, 11(7), 860; https://doi.org/10.3390/horticulturae11070860
Submission received: 20 May 2025 / Revised: 30 June 2025 / Accepted: 7 July 2025 / Published: 21 July 2025

Abstract

Penicillium expansum is an acidogenic fungal species that belongs to the phylum Ascomycota. During the infection and colonization of host fruits, P. expansum can efficiently express glucose oxidase (GOX) and oxidize β-D-glucose to generate gluconic acid (GLA). In this study, the bioinformatics analysis method was employed to predict and analyze the function of the GOX protein. In addition, a comprehensive assessment was conducted on the P. expansum GOX coding gene GOX2, and the expression response rules of GOX2 under different external stress environments were explored. The results show that GOX is an unstable hydrophilic protein. It is either an integrated membrane protein (such as a receptor or channel) that is directly anchored to the membrane through a transmembrane structure or a non-classical secreted protein that is secreted extracellularly. RNA-seq data analysis shows that the GOX2 gene is regulated by multiple environmental factors, including pH, temperature, carbon base, and chemical fungicides. The expression level of GOX2 reaches its maximum value under alkaline conditions (pH 8–10) and at approximately 10 °C. Using starch as the carbon source and adding sodium propionate or potassium sorbate has the effect of inhibiting the expression of the GOX2 gene. The analysis of the function of the GOX protein and the characteristics of the GOX2 gene in P. expansum provides new insights into the glucose oxidase-encoding gene GOX2. The research results provide significant value for the subsequent development of new disease resistance strategies by targeting the GOX2 gene and reducing post-harvest disease losses in fruits.

1. Introduction

Penicillium expansum, a prominent filamentous fungus with a global natural distribution, demonstrates a broad host range for fruit infection. It primarily targets pome fruits, stone fruits and berries. P. expansum mainly infects fruits through mechanical wounds generated by pre-harvest bird pests or during harvesting or post-harvest processing. It can also enter the fruit tissue through natural openings and come into contact with healthy fruits for infection [1,2]. Blue mould caused by P. expansum is one of the significant diseases of fruits such as apples, pears and cherries [3]. It has been reported that global post-harvest rot caused by P. expansum accounts for 10–30% of fruit losses, with annual losses exceeding USD 1 billion in the apple industry alone [4,5]. The incidence of P. expansum disease in apple storage in North China often reaches over 20%, sometimes resulting in complete warehouse spoilage. Based on extensive research findings, patulin (PAT) is a mycotoxin produced primarily by P. expansum. Furthermore, it poses significant threats to both food quality and human health [6]. When fruits contaminated by P. expansum are processed into products, PAT, as a carcinogenic mycotoxin, poses a threat to human health [7]. Studies have shown that the intake of PAT can affect human organs such as the kidneys, liver and intestines [8].
During the process of pathogenic fungi infecting the host, they can secrete acidic or alkaline substances to alter the environmental pH value, thereby enhancing the expression and activity of their pathogenic factors, and thus accelerating the infection of the host [9]. The ability of fungi to alter pH values can be manifested in two directions, with fungi that increase or decrease pH values, respectively, being called “alkaliphilic fungi” or “acidophilic fungi” [1]. P. expansum is a typical acidifying fungus. During colonization, it can secrete gluconic acid and citric acid to acidify the infected environment and lower the pH value of the host tissue [10]. Citric acid and gluconic acid also exhibit strong Ca2+ chelating activity by altering the mineral balance of the plant cell wall to weaken the cell wall and thereby affect the stability of the cell membrane and cell wall pectin acid polymer [11]. Furthermore, due to the acidic pH of fruits, most fruits are more prone to being infected by P. expansum, resulting in fruit spoilage [12]. Studies have shown that fungi have a complex system for sensing and adapting to environmental pH [13]. The Pal/Rim signaling pathway, as the main mechanism for pH response, has been widely documented in various pathogenic fungi [13,14]. The PlaF modification promotes the assembly of downstream PalA, PalB and PalC in the membrane-associated complex, thereby initiating the pH signal transduction [15].
GOX is a glycoprotein, which is mainly found in the Aspergillus and Penicillium genera in fungi. GOX is a flavin-dependent oxidoreductase that can catalyze the oxidation of β-D-glucose to gluconolactone and hydrogen peroxide (H2O2) using molecular oxygen as the electron acceptor [16]. Gluconolactone can be converted into GLA under non-enzymatic reactions [17]. During the process of infecting and colonizing fruits, P. expansum can efficiently express GOX and oxidize D-glucose to produce GLA. It has been reported that there are two glucose oxidase-encoding genes, namely GOX1 and GOX2, in P. expansum (Pe-21) [18]. GLA is secreted into the fruit tissue and accumulates, which acidifies the host and lowers the pH value of the infection environment, thereby accelerating the rate of infection and colonization [16].
This research analyzed the expression levels of GOX-related genes at 0, 24, 48 and 72 h after inoculation. It was found that the expression of GOX2 was significantly up—regulated, and its relative expression level was significantly higher than that of GOX1,3. GOX2 played an important role in the infection of P. expansum hosts. However, the bioinformatic characteristics of GOX2 in the P. expansum genome are still unclear. In this study, bioinformatics analyses were performed for GOX2 and its encoded GOX protein. The gene sequence was first translated into an amino acid sequence. Then, comprehensive analyses were conducted, including predictions of physicochemical properties (molecular weight, isoelectric point, amino acid composition) and structural features of the GOX protein, such as transmembrane domains, signal peptides, hydrophobicity, secondary and tertiary structures, as well as conserved domains. Finally, phylogenetic analysis was carried out to explore the evolutionary relationships of GOX2 and the GOX protein. These analyses aim to provide insights into the structural characteristics, functional domains and evolutionary history of the GOX protein, laying a foundation for further experimental studies on GOX2 and the GOX protein. Additionally, the expression level of the GOX2 gene in P. expansum under different growth environmental stresses was quantitatively analyzed. This study provides a comprehensive understanding of the gene’s role in fungal adaptation and pathogenicity and contributes to the development of fungicides targeting this gene.

2. Materials and Methods

2.1. Isolation and Identification of Fungal Strains

The rotten apples came from the apple planting base in Changqing District, Jinan City, Shandong Province, China. The fungus was isolated by the author on 5 September 2024. The typical parts of the apples were dug out with sterilized surgical blades. The fungi on the collected diseased apple fruit were isolated using Potato Dextrose Agar (PDA, Bejing Aoboxing Bio-tech Co., Ltd., Beijing, China) medium and purified by the streak plate method. Single fungal strains were obtained by incubating in a dark environment at 25 °C for 3 days. After multiple purifications, the morphology was first observed under a microscope, and then the strain was identified using the 18S rDNA sequence analysis technique. The identified strain was preserved on slant culture medium at −4 °C.
The pathogenic fungi were inoculated on PDA medium after 3 days of cultivation at 25 °C. The spore suspension was washed with sterile distilled water and filtered through a sterile four-layer gauze. The spore suspension (1 × 106 spores mL−1) was prepared using a blood cell counting plate [19].

2.2. GOX2 Gene Sequence Acquisition and Retrieval in P. expansum

In this study, the GOX2 gene sequence was sequenced by Sangon Biotech (Shanghai) Co., Ltd. (Shanghai, China). The NCBI (https://www.ncbi.nlm.NIh.gov, accessed on 10 April 2025) Blastx alignment was used, and the nucleotide sequence was translated into the amino acid sequence by the software SnapGene 6.0.2 for subsequent research. The default parameters of the online tool were used.

2.3. Composition and Physicochemical Properties of GOX Amino Acids

The larger identified protein sequence was uploaded to the ExPASy website (https://web.expasy.org/protparam/, accessed on 18 April 2025) to analyze the physical and chemical properties. The default parameters of the online tool were used. It mainly includes amino acid composition, molecular weight (MW), theoretical isoelectric point (pI), instability coefficient, etc.

2.4. Relative Expression Analysis of GOX Protein Expression Genes GOX1, GOX2 and GOX3

The primers used in this study were designed by Primer Premier 5.0 software and synthesized by Sangon Biotech (Shanghai) Co., Ltd. The GOX genes used in this study are shown in Table 1. The fungal RNA was extracted using the EASY Plant/Fungal RNA Quick Extraction Kit (centrifugal column type) from Wuhan Junonuo Bio-Technology Co., Ltd. (Wuhan, China), then cDNA was synthesizd using the M5 Super qPCR RT kit. FQD-96A (Hangzhou Bodi Technology Co., Ltd., Hangzhou, China) was used for the analysis of reverse transcription quantitative polymerase chain reaction (RT-qPCR). The fluorescence quantitative reaction system comprised 10 µL of 2 × M5 HiPer SYBR Premix ES Taq (with Tli RNaseH), 6 μL of cDNA template, 1.2 μL each of forward and reverse primers, and an appropriate amount of water, with a total volume of 60 μL. The reaction program conditions for RT-qPCR were as follows: a constant temperature stage at 95 °C for 20 s, then a cycling stage with 40 cycles (95 °C for 5 s followed by 60 °C for 30 s), and finally a denaturation stage (95 °C for 5 s followed by 60 °C for 30 s followed by 95 °C for 5 s) [20]. A melting curve was also plotted to evaluate the specificity of the primers (Figure S1). Fresh apples (Malus pumila Mill., Red Fuji) were purchased at commercial maturity from a local supermarket in the Changqing district of Jinan, Shandong Province, China and immediately transported to our laboratory. Fruits without physiological or pathological diseases were soaked in a 0.1% (v/v) NaClO solution for 2 min, then washed with tap water. After that, the fruits were air-dried at room temperature. Sterile steel needles were used to make two symmetrical small holes (3 mm deep and 2 mm wide) on both sides of the equator of each fruit. Then, 10 μL of P. expansum spore suspension (1 × 106 spores mL−1) was punched into the hole and dried at room temperature. All the fruits were placed in plastic baskets, wrapped in polyethylene bags (<0.04 mm), then stored at 25 °C, 80–90% RH. The samples were collected at 24 h, 48 h and 72 h from the wounds of the infected fruits caused by P. expansum, then frozen rapidly with liquid nitrogen for preservation at −80 °C. The tissue samples from the rotten regions contain abundant fungal mycelial RNA. There were three replicate groups, and each group contained at least ten fruits. The experiment was performed at least twice. A spore suspension of a certain concentration was regarded as the control sample at 0 h. Subsequently, the relative expression levels of GOX1, GOX2 and GOX3 genes were measured. 28S was used as the reference gene. The GOX1 sample at 0 h was used as the negative control. The gene primers used in this study are shown in Table 1. Each experiment was repeated three times. The relative quantitative expression levels of the genes were determined using the 2−ΔΔCT method [21].

2.5. Phylogenetic and Conserved Domains Analysis of the GOX2 Gene

The Clustai W algorithm was used to compare the P. expansum GOX2 gene, and it was assembled using MEGA11.0.13 software. The phylogenetic tree was constructed by applying the neighbor-joining (NJ) method, and the parameters were set as follows: The neighbor-joining (NJ) method and the non-parameter Bootstrap analysis was performed 1000 times. Another NJ tree was also constructed using only the GOX protein with the same parameters. The gene structure of GOX2 was visualized using the NCBI (https://www.ncbi.nlm.NIh.gov, accessed on 20 April 2025) genome sequence and its associated annotation files, and the Gene Structure View tool included in TBtools v1.098769 was used to analyze the gene structure. Using the MEME motif search tool, 10 unique conserved motifs were predicted.

2.6. Hydrophobicity, Transmembrane Helix Structure, and Signal Peptide Prediction Analysis of GOX Protein

The identified GOX protein sequences were uploaded to the ProtScale website (https://web.expasy.org/protscale/, accessed on 18 April 2025), the TMHMM website (https://services.healthtech.dtu.dk/services/TMHMM-2.0/, accessed on 18 April 2025) and the SignalP 4.1 website (https://services.healthtech.dtu.dk/services/SignalP-4.1/, accessed on 18 April 2025) hydrophilicity, transmembrane helical structure and signal peptide prediction. Signal peptide prediction was applicable to eukaryotes. The D-cutoff values and other parameters were set to the default. The default parameters of the online tool for hydrophilicity and transmembrane helical structure were used.

2.7. Prediction and Analysis of GOX Secondary Structure

The identified GOX protein sequences were uploaded to the PredictProtein website (https://npsa.lyon.inserm.fr/, accessed on 20 April 2025) for GOX secondary structure prediction (the SOPMA method was used). The default parameters of the online tool were used.

2.8. GOX Conserved Domain Analysis and GOX Tertiary Structure Prediction Analysis

The identified protein sequences of the GOX gene were uploaded to Conserved Domains of NCBI (NCBI Conserved Domain Search) for CD-search. SWISS MODEL modeling website (https://www.ncbi.nlm.nih.gov/, accessed on 22 April 2025) was applied to analyze the GOX protein information and predict its tertiary structure model. The default parameters of the online tool were used.

2.9. Analysis of Relative Expression Quantities of GOX2 Gene Under Different Temperature, pH, Carbon Source and Antifungal Agent Conditions

According to Section 2.1, the preparation of the spore suspension has been completed. 0.2 mL of spore suspension was added to every 20 mL of Potato Dextrose Broth (PDB, Beijing Aoboxing Bio-tech Co., Ltd., Beijing, China) medium (concentration of 1 × 106 spores/mL), and the shaking parameters were set at 180 rpm at 28 °C for 72 h of cultivation. After the mycelium grew to an appropriate extent, the strains were placed in different temperature conditions (4 °C, 10 °C, 25 °C, 30 °C), different pH levels (4, 6, 8, 10), different carbon sources (glucose, starch, xylose) and different antifungal agents (potassium sorbate, sodium benzoate, sodium propionate and oxysophorine) for 3 days of cultivation. RNA extraction, cDNA synthesis and RT-qPCR were carried out following the protocol in Section 2.3.
Carbon-based culture medium formula:
Glucose 2%, peptone 1%, potassium dihydrogen phosphate 0.1%, magnesium sulfate 0.05%, plus distilled water to 1000 mL; adjust pH to natural (generally between 5.0 and 6.0; many fungi grow well in a slightly acidic environment).
Soluble starch 2%, peptone 1%, potassium dihydrogen phosphate 0.1%, magnesium sulfate 0.05%, plus distilled water to 1000 mL; adjust pH to natural (generally between 5.0 and 6.0; many fungi grow well in a slightly acidic environment).
Xylose 2%, peptone 1%, potassium dihydrogen phosphate 0.1%, magnesium sulfate 0.05%; make up to 1000 mL with distilled water; adjust pH naturally (generally between 5.0 and 6.0; many fungi grow well in a slightly acidic environment).

2.10. Statistical Analysis

Each experiment was performed three times. Data were analyzed using IBM SPSS Statistics 26 (SPSS Inc., Chicago, IL, USA). Mean separations were performed using Duncan’s multiple range tests, and significance was accepted at p < 0.05.

3. Results

3.1. Sequence Comparison of GOX Gene and Analysis of Physicochemical Properties of GOX Protein

In this study, the GOX gene sequence was sequenced by Sangon Biotech (Shanghai) Co., Ltd. The open reading frame of the GOX2 sequence is 1928 bp in length. It was compared using NCBI (https://www.ncbi.nlm.nih.gov, accessed on 2 November 2024) Blastx and translated into nucleotide sequences by SnapGene 6.0.2 software. The nucleotide sequence encodes 567 amino acids. The sequencing sequences were compared using NCBI (https://www.ncbi.nlm.nih.gov, accessed on 2 November 2024) Blastx. From the comparison results, it can be seen that the sequencing sequences have a high degree of homology with glucose-methanol-choline oxidoreductase (XP_016596803.1).
It was predicted that the molecular weight of GOX is 63.88 KDa and its isoelectric point is 5.72 (Table 2). It is a protein rich in leucine and glycine (Table 3). The total number of positively charged residues (Arg + Lys) of GOX is 47, and the total number of negatively charged residues (Asp + Glu) is 60. The hydrophilicity of GOX is less than 0, and the instability coefficient of GOX is greater than 40 (Table 3). The fatty acid amino acid index is less than 100, indicating that the GOX protein is an unstable hydrophilic protein.

3.2. Gene Expression Analysis and RT-qPCR Validation

As shown in Figure 1, the relative expression levels of the GOX1, GOX2 and GOX3 genes at the lesion sites of apple fruits inoculated with P. expansum were measured using RT-qPCR technology. The results reveal differential regulation of GOX1, GOX2 and GOX3 at the interaction site between pathogens and fungi. It was observed that the expression level of the GOX2 gene was continuously higher than that of the GOX1 and GOX3 genes during infection. Notably, the expression level of GOX2 increased rapidly, accompanied by a slight decline at 48 h. Subsequently, it rose again and reached a relatively high level after 72 h post-inoculation. The upregulation of GOX2 during infection and colonization suggests its critical role in adapting to the host environment. Therefore, for subsequent studies, the GOX2 gene was selected as the target gene.

3.3. Phylogenetic and Conserved Structural Domain Analysis of the P. expansum GOX2 Gene

From the phylogenetic analysis, the GOX2 gene belongs to the same subgroup as PEX2_038230. Under the same parameters, the phylogenetic relationships of proteins among Penicillium spp., such as Penicillium digitatum and Penicillium camemberti, were studied. The results indicated that the GOX protein was highly clustered with the homologous proteins of Penicillium digitatum and Penicillium camemberti. Moreover, phylogenetic analysis of the GOX2 amino acid sequence of Penicillium species indicated that the GOX protein was closely related to many Penicillium spp. The relationship between GOX and the homologous proteins of Penicillium digitatum is closer (Figure 2B).
Gene conserved domain analysis was conducted on the GOX2 gene and homologous sequences. By setting the motif parameter in MEME to 10 conserved motifs, they were named motifs 1–10, and motifs 1–10 were proven to be conserved (Figure 2C). The results showed that motifs 3–8 were widely distributed in GOX genes. In addition, the GOX2 and PEX2_038230 motifs were similar in composition and distribution (Figure 2A,B). Taken together, the fact that the same clade has similar gene structure and conserved motif composition strongly suggests the reliability of phylogenetic analyses for subfamily classification.

3.4. Extended Analysis of Hydrophilicity, Transmembrane Helical Structure and Signal Peptide Prediction of the P. expansum GOX

The minimum value of GOX hydrophobic index was −2.411, and the maximum value was 1.656. The results were consistent with the analysis of physicochemical property proteins. GOX has a transmembrane helical structure and no signal peptide. It can be seen through the analysis of the transmembrane helical structure. GOX is an integrated membrane protein (such as a receptor or channel) that is directly anchored to the membrane through a transmembrane structure or a non-classical secretory protein that is secreted extracellularly through a special mechanism (Figure 3).

3.5. GOX Secondary Structure Forecast Analysis

GOX protein secondary structure elements are mainly Extended strand, Alpha helix, Random coil, Beta turn. Extended strand, Alpha helix, Random coil and Beta turn in GOX accounted for 18.96%, 26.09%, 54.96% and 0%, respectively (Figure 4A,B). Among them, irregular curl and α-helix were the most frequent structures, which verified the richness of glycine and leucine.

3.6. Analysis of Conserved Structural Domains and Tertiary Structure Prediction Analysis of P. expansum GOX

GOX contains a specific domain BetA, which is mainly related to the catalytic function of choline dehydrogenation and flavin adenine dinucleotide binding as well as two non-specific GMC and PRK domains. The molecular function is redox activity, acting on the donor CH-OH group and binding to flavin adenine dinucleotide (Figure 5A). The GOX protein information was analyzed using the SWISS MODEL modeling software, and its three-dimensional structure model is shown in Figure 5B.

3.7. Analysis of Relative Expression Levels of GOX2 Under Different Conditions of Temperature, pH, Carbon Substrate and Bacteriostatic Agents

In order to explore the corresponding rules of the relative expression of the key regulatory gene GOX2 of P. expamsum under multiple environmental conditions, the relative expression experiments of the GOX2 gene were conducted, respectively. Figure 6 shows the relative expression results of GOX2 in multiple environments. The expression of GOX2 was the highest at pH 10, and decreased by 70.13%, 83.6% and 90.78%, respectively, at pH 8, 6 and 4 (Figure 6A). The relative expression level of GOX2 was significantly upregulated under alkaline conditions. The relative expression of GOX2 was significantly upregulated at 4–10 °C, downregulated at 10–30 °C and reached the maximum value at 10 °C. The relative expression levels decreased by 19.64%, 41.98% and 79.38%, respectively, at temperatures of 4 °C, 25 °C and 30 °C (Figure 6B) compared to that of 10 °C. The expression of GOX2 was significantly higher when using glucose as the carbon-based group than when using starch and xylose as the carbon-based group and decreased by 71.91% and 50.30%, respectively, when using starch and xylose as the carbon-based group (Figure 6C). As shown in Figure 6D, the addition of sodium propionate and potassium sorbate significantly inhibited the expression of the GOX2 gene compared with the control group, reducing it by 76.7% and 92.14%, respectively.

4. Discussion

P. expansum is the main pathogen of apple blue mold [22]. P. expansum not only causes apples to rot, resulting in huge economic losses, but also may secrete PAT and Citrinin (CIT) and accumulate within apples [23]. These two toxins have mutagenic toxicity, neurotoxicity and genotoxicity, posing a huge safety hazard to consumers’ health. Furthermore, GLA produced by the oxidation of GOX is an important pathogenic factor secreted by P. expansum. P. expansum, as an acidic fungus, can enhance its pathogenicity by secreting GLA to locally reduce the pH value of the host [24]. Studies have shown that when the expression level of GOX is downregulated, the expression levels of each gene in the PAT synthesis gene cluster are downregulated, and the yield and pathogenicity of PAT are significantly reduced [25]. Research on the pathogenic factors of P. expansum is a research hotspot in post-harvest fruit and vegetable pathology.
The oxidation of D-glucose by GOX to produce GLA contributes to the infection of P. expansum in its host and the subsequent colonization process [16], which plays a key role in the pathogenicity of P. expansum. However, the bioinformation characteristics of GOX2 in the P. expansum genome are still unclear. In this study, we isolated a Penicillium strain from the diseased apple fruits using the tissue isolation method, which was identified as a P. expansum strain. Afterwards, we measured the relative expression levels of three GOX-encoding genes, GOX1, GOX2 and GOX3 at the wounds of the infected fruits caused by P. expansum at 0, 24, 48 and 72 h, respectively. It was found that the GOX2 gene was continuously highly expressed in P. expansum-infected fruits (Figure 1). Similar phenomena had been found in the study of Pe-21 by Hadas et al. (2006) [16], who reported that the expression of GOX2 was higher than that of GOX1 [16]. This result suggests that GOX2 might play an important role in the pathogenicity of P. expansum. However, there have been some research data in recent years on the production of organic acids by P. expansum. However, the bioinformatics features of GOX encoded in the P. expansum genome remain elusive. In order to systematically explore this issue, this study performed the phylogenetic analysis of the GOX2 gene and explored the functions of the GOX protein. Additionally, the expression levels of the GOX2 gene in P. expansum under various growth-related environmental stresses were quantitatively measured.
P. expansum reduces the pH of the host wound by secreting GLA. GOX plays an important role in P. expansum acidifying the host and enhancing pathogenicity. In this study, we conducted biological information analysis on GOX proteins, and the different molecular weights and isoelectric point ranges will help to understand their biochemistry and function [26]. The analysis of amino acid composition, molecular weight, isoelectric point and hydrophilicity of GOX protein showed that GOX was an unstable hydrophilic protein (Table 1 and Table 2). In addition, hydrophilic and hydrophobic prediction analysis also showed that GOX was a hydrophilic protein (Figure 3A). Signaling peptide (SP) is a peptide sequence located at the N-terminal of a newly synthesized protein, mainly known for its role in targeting proteins to the endoplasmic reticulum (ER) [27]. SP is like a zip code that marks protein secretion pathways and protein target locations [28]. Across membrane domains, they have important biological functions, such as protein anchoring, signal transduction and ligand recognition [29]. The analysis results showed that GOX had no signal peptide and its transmembrane domain was located outside the cell membrane (Figure 3A,B). Based on the available evidence, it can be deduced that GOX was an integrated membrane protein (such as receptor and channel) directly anchored to the membrane through the transmembrane structure, or a non-classical secreted protein was secreted into the extracellular space by a special mechanism [30]. Protein secondary structure prediction (PSSP) is a fundamental task in protein science and computational biology, which can be used to understand the three-dimensional (3-D) structure of proteins and further understand their biological functions [31]. The secondary structure of GOX can be seen to exhibit a high percentage of irregular curls (Figure 4A,B), and therefore it is hypothesized that GOX contains hydrophilic and charged amino acids (e.g., glycine), which promotes dynamic changes, consistent with the physicochemical properties and amino acid composition (Table 1 and Table 2). Prediction of the structural domains of the GOX protein showed that GOX contains the specific structural domain BetA (Figure 5A). BetA is mainly associated with the catalytic function of choline dehydrogenation oxidation and flavin adenine dinucleotide binding. Flavin Adenine Dinucleotide (FAD) is a universal cellular cofactor involved in biological redox and free radical metabolism reactions [32]. It has been reported that the crystal structure of GOX can be divided into five parts: the FAD-binding structural domain, the FAD coverage region, the FAD extended binding structural domain, the flavin attachment loop and intermediate region and the substrate-binding structural domain [33]. In particular, the FAD-binding structural domain, the flavin attachment loop and the intermediate region and the substrate-binding structural domain are the main structures of GOX [34]. Clarifying the function and action location of the GOX protein is of great significance for the subsequent study of host pathogenic factors acidified by P. expansum.
The growth and pathogenicity of P. expansum are regulated by multiple environmental factors. Exploring the influence of environmental factors on the pathogenic factor of P. expansum plays an important role in controlling post-harvest diseases. In an acidic environment, the transcription and translation levels of GOX2 are inhibited, and the expression level of GOX2 reaches the highest level under alkaline conditions (Figure 6A). Studies have shown that pH regulates the expression of GOX2 by affecting the activity of transcription factors and the stability of mRNA [18]. The expression of pH-regulating genes expressed by filamentous fungi under different pH values is mediated by the comprehensive function of seven genes (pacC, palA, palB, palC, palF, palH and palI) [35]. The pH response system of fungi (such as pacC and palA devices) can regulate pathogenic factors [36]. Studies have shown that PacC regulates the expression of the virulence factor glucose oxidase (GOX) in P. expansum, as well as the expression of two new potential virulence factors—calreticulin (CRT) and sulfate adenylyltransferase (SAT) [37]. Under alkaline conditions, PacC is activated and promotes the expression of GOX2, thereby leading to the production of GLA and the acidification of the host tissue [7,38,39]. The regulatory roles of other transcription factors on the expression of GOX2 under alkaline pH conditions still require further exploration in the future. P. expansum affects the differential regulation of GOX2 gene expression in different pH environments. This is likely to be an adaptive response of the fungus to maintain the appropriate pH balance for its growth and the activity of other pathogenicity-related factors. Among other pathogenic fungi, Aspergillus nidulans, Bacillus anthracis and Aspergillus niger also exhibit the expression of pathogenic factors regulated by pH [40,41,42]. Metabolomics analysis showed that when the temperature decreased (from 20 °C to 10 °C or 4 °C), the contents of glucolactone and gluconic acid metabolites of the pentose phosphate pathway increased [43]. GOX oxidizes β-D-glucose to gluconolactone, where gluconolactone is capable of being converted to GLA in a non-enzymatic reaction [17], and we hypothesized that low temperatures induced GOX2 gene expression, leading to an increase in gluconolactone metabolism (Figure 6B). Studies have shown that when glucose is used as a carbon source, the expression of most P. expansum-related genes (such as PatA, PatC, PatE, PatL, etc.) is upregulated. On the contrary, when P. expansum T01 is cultured under an unfavorable carbon source, the expression of these genes is sharply downregulated [44]. Therefore, glucose, as a carbon source and energy substance, has an important impact on the expression of GOX2. Appropriate concentrations of glucose may stimulate signal transduction in Penicillium cells, bind transcription factors related to GOX2 expression to the gene promoter region and enhance the transcription of the GOX2 gene. To promote the production of gluconic acid, taking glucose as a carbon source is more conducive to the expression of the GOX2 gene (Figure 6C). After treatment with potassium sorbate and sodium propionate, the relative expression levels of the GOX2 gene in P. expansum were significantly downregulated. Studies have shown that potassium sorbate is converted into sorbic acid and enters cells, where it dissociates into sorbic acid ions and H+, leading to a decrease in intracellular pH and inhibition of intracellular basal metabolism, thereby achieving antibacterial effects [45]. In addition, propionic acid molecules not only disrupt the transport and uptake processes of substrate molecules in fungal cell membranes by interfering with the electrochemical gradient but also damage the biological processes that are crucial for the survival and growth of fungi by lowering the pH value of the cytoplasm and by dissociating and concentrating weakly acidic anions within the cells [46,47]. Therefore, it is reasonable to infer that sodium propionate and potassium sorbate may inhibit the expression of pathogenic genes related to fungi by suppressing their growth. Both sodium propionate and potassium sorbate can cause a decrease in the pH environment of fungi. The expression of GOX2 may be related to the regulation of the pH response of fungi (Figure 6D). Studies have shown that environmental factors regulate the expression of GOX2, which is of great significance for subsequent exploration of control strategies to reduce acidification by pathogenic fungi. The above research results indicate that the expression of GOX2 in P. expansum is regulated by multiple environmental factors.
Although online tools for biological information analysis can predict the functional properties of proteins, their development still faces multiple limitations. For instance, the accuracy and interpretability of the algorithms still need to be improved. The prediction results require further experiments for verification, such as subcellular localization experiments, gene knockout and overexpression experiments, etc. The expression response of GOX2 to multiple environments and its prediction for the function of regulatory proteins provide a basis for future targeted inhibition of GOX2 expression and artificial intervention in protein functions, thereby reducing the damage caused by post-harvest pathogenic fungi.

5. Conclusions

In this study, the functional prediction of the GOX protein was conducted through bioinformatics analysis. GOX2, a key gene that encodes the GOX protein, was screened out by inoculating apple fruits. The functional prediction results of the GOX protein indicate that the GOX protein is an unstable hydrophilic protein and is an integral membrane protein (such as receptors and channels) anchored directly to the membrane through a transmembrane structure or a non-classical secretory protein secreted to the extracellular space. It contains a FAD-binding domain and participates in biological redox and free radical metabolism reactions. The relative expression analysis of RT-qPCR shows that the expression level of the GOX2 gene reaches the maximum at pH 8–10 and 10 °C temperature. The expression of the GOX2 gene with starch as the carbon-based substrate was suppressed. In addition, the relative expression of the GOX2 gene was also inhibited by the addition of sodium propionate or potassium sorbate. These results will contribute to formulating more effective new strategies to control the acidification process of fungi, providing significant value for reducing post-harvest physiological diseases of fruits.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/horticulturae11070860/s1, Figure S1. RT-qPCR primer dissociation curve. Table S1. Biological information analysis results.

Author Contributions

Conceptualization, W.J.; methodology, Y.Y.; software, Y.Y.; validation, Y.Y. and Y.R.; formal analysis, Y.Y. and W.J.; investigation, Y.Y.; resources, W.J. and M.F.; data curation, X.Y. and Y.Y.; writing—original draft preparation, M.F. and D.Y.; writing—review and editing, S.H.; visualization, Y.Y.; supervision, W.J.; project administration, W.J.; funding acquisition, W.J. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (32202126 and 32302160), the Natural Science Foundation of Shandong Province (ZR2023MC018) and the Agricultural Industrial Technology System of Shandong Province (SDAIT-05) in China.

Data Availability Statement

The data presented in this study are available in this article.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
GOXGlucose oxidase
GLAGluconic acid
PATPatulin
FADFlavin Adenine Dinucleotide

References

  1. Prusky, D.; Lichter, A. Mechanisms Modulating Fungal Attack in Post-Harvest Pathogen Interactions and Their Control. Eur. J. Plant Pathol. 2008, 121, 281–289. [Google Scholar] [CrossRef]
  2. Van Zeebroeck, M.; Van Linden, V.; Ramon, H.; De Baerdemaeker, J.; Nicolaï, B.M.; Tijskens, E. Impact Damage of Apples during Transport and Handling. Postharvest Biol. Technol. 2007, 45, 157–167. [Google Scholar] [CrossRef]
  3. Li, Y.; Jiao, W.; Du, Y.; Wang, M.; Fu, M. Involvement of Organic Acid in the Control Mechanism of ε-Poly-L-Lysine (ε-PL) on Blue Mold Caused by Penicillium expansum in Apple Fruits. Horticulturae 2022, 8, 468. [Google Scholar] [CrossRef]
  4. Vico, I.; Duduk, N.; Vasic, M.; Nikolic, M. Identification of Penicillium expansum Causing Postharvest Blue Mold Decay of Apple Fruit. Pestic. I Fitomedicina 2014, 29, 257–266. [Google Scholar] [CrossRef]
  5. Ballester, A.-R.; Marcet-Houben, M.; Levin, E.; Sela, N.; Selma-Lázaro, C.; Carmona, L.; Wisniewski, M.; Droby, S.; González-Candelas, L.; Gabaldón, T. Genome, Transcriptome, and Functional Analyses of Penicillium expansum Provide New Insights Into Secondary Metabolism and Pathogenicity. MPMI 2015, 28, 232–248. [Google Scholar] [CrossRef]
  6. Wang, K.; Zheng, X.; Zhang, X.; Zhao, L.; Yang, Q.; Boateng, N.A.S.; Ahima, J.; Liu, J.; Zhang, H. Comparative Transcriptomic Analysis of the Interaction between Penicillium expansum and Apple Fruit (Malus pumila Mill.) during Early Stages of Infection. Microorganisms 2019, 7, 495. [Google Scholar] [CrossRef]
  7. Luciano-Rosario, D.; Keller, N.P.; Jurick, W.M. Penicillium expansum: Biology, Omics, and Management Tools for a Global Postharvest Pathogen Causing Blue Mould of Pome Fruit. Mol. Plant Pathol. 2020, 21, 1391–1404. [Google Scholar] [CrossRef]
  8. Mahato, D.K.; Kamle, M.; Sharma, B.; Pandhi, S.; Devi, S.; Dhawan, K.; Selvakumar, R.; Mishra, D.; Kumar, A.; Arora, S.; et al. Patulin in Food: A Mycotoxin Concern for Human Health and Its Management Strategies. Toxicon 2021, 198, 12–23. [Google Scholar] [CrossRef]
  9. Prusky, D.; McEvoy, J.L.; Saftner, R.; Conway, W.S.; Jones, R. Relationship Between Host Acidification and Virulence of Penicillium spp. on Apple and Citrus Fruit. Phytopathology 2004, 94, 44–51. [Google Scholar] [CrossRef]
  10. Barad, S.; Horowitz, S.B.; Kobiler, I.; Sherman, A.; Prusky, D. Accumulation of the Mycotoxin Patulin in the Presence of Gluconic Acid Contributes to Pathogenicity of Penicillium expansum. MPMI 2014, 27, 66–77. [Google Scholar] [CrossRef]
  11. Cunningham, J.E.; Kuiack, C. Production of Citric and Oxalic Acids and Solubilization of Calcium Phosphate by Penicillium bilaii. Appl. Environ. Microbiol. 1992, 58, 1451–1458. [Google Scholar] [CrossRef] [PubMed]
  12. Jimdjio Kouasseu, C.; Yang, X.; Xue, H.; Bi, Y.; Liu, Z.; Xi, J.; Nan, M.; Prusky, D. Reactive Oxygen Species Metabolism Modulation on the Quality of Apple Fruits Inoculated with Penicillium expansum under Different Ambient pHs. Horticulturae 2023, 9, 538. [Google Scholar] [CrossRef]
  13. Li, B.; Chen, Y.; Tian, S. Function of pH-dependent Transcription Factor PacC in Regulating Development, Pathogenicity, and Mycotoxin Biosynthesis of Phytopathogenic Fungi. FEBS J. 2022, 289, 1723–1730. [Google Scholar] [CrossRef] [PubMed]
  14. Selvig, K.; Alspaugh, J.A. pH Response Pathways in Fungi: Adapting to Host-Derived and Environmental Signals. Mycobiology 2011, 39, 249–256. [Google Scholar] [CrossRef]
  15. Lucena-Agell, D.; Galindo, A.; Arst, H.N.; Peñalva, M.A. Aspergillus Nidulans Ambient pH Signaling Does Not Require Endocytosis. Eukaryot. Cell 2015, 14, 545–553. [Google Scholar] [CrossRef]
  16. Hadas, Y.; Goldberg, I.; Pines, O.; Prusky, D. Involvement of Gluconic Acid and Glucose Oxidase in the Pathogenicity of Penicillium expansum in Apples. Phytopathology 2007, 97, 384–390. [Google Scholar] [CrossRef]
  17. Gu, L.; Zhang, J.; Du, G.; Chen, J. Multivariate Modular Engineering of the Protein Secretory Pathway for Production of Heterologous Glucose Oxidase in Pichia Pastoris. Enzym. Microb. Technol. 2015, 68, 33–42. [Google Scholar] [CrossRef]
  18. Barad, S.; Horowitz, S.B.; Moscovitz, O.; Lichter, A.; Sherman, A.; Prusky, D. A Penicillium expansum Glucose Oxidase–Encoding Gene, GOX2, Is Essential for Gluconic Acid Production and Acidification During Colonization of Deciduous Fruit. MPMI 2012, 25, 779–788. [Google Scholar] [CrossRef]
  19. Qianqian, L.; Qingmin, C.; Hu, L.; Yamin, D.; Wenxiao, J.; Fei, S.; Maorun, F.; Subo, T.; Xiaofei, X. Direct Antifungal Activity of Methyl Salicylate on Soft Rot Caused by Rhizopus Stolonifer and Its Membrane Targeting Mechanism. Postharvest Biol. Technol. 2024, 218, 113169. [Google Scholar] [CrossRef]
  20. Wang, Y.; Yuan, L.; Wang, Y.; Lang, J.; Ye, M.; Liu, Q.; Ma, Q.; Zhou, N. Phosphorus-Solubilizing Fungi Promote the Growth of Fritillaria taipaiensis P. Y. Li by Regulating Physiological and Biochemical Reactions and Protecting Enzyme System–Related Gene Expression. Front. Genet. 2025, 15, 1459191. [Google Scholar] [CrossRef]
  21. Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  22. Barad, S.; Sela, N.; Kumar, D.; Kumar-Dubey, A.; Glam-Matana, N.; Sherman, A.; Prusky, D. Fungal and Host Transcriptome Analysis of pH-Regulated Genes during Colonization of Apple Fruits by Penicillium expansum. BMC Genom. 2016, 17, 330. [Google Scholar] [CrossRef]
  23. Lai, T.; Yu, Q.; Pan, J.; Wang, J.; Tang, Z.; Bai, X.; Shi, L.; Zhou, T. The Identification and Comparative Analysis of Non-Coding RNAs in Spores and Mycelia of Penicillium expansum. JoF 2023, 9, 999. [Google Scholar] [CrossRef]
  24. Jiao, W.; Liu, X.; Li, Y.; Li, B.; Du, Y.; Zhang, Z.; Chen, Q.; Fu, M. Organic Acid, a Virulence Factor for Pathogenic Fungi, Causing Postharvest Decay in Fruits. Mol. Plant Pathol. 2022, 23, 304–312. [Google Scholar] [CrossRef]
  25. Alkan, N.; Meng, X.; Friedlander, G.; Reuveni, E.; Sukno, S.; Sherman, A.; Thon, M.; Fluhr, R.; Prusky, D. Global Aspects of pacC Regulation of Pathogenicity Genes in Colletotrichum Gloeosporioides as Revealed by Transcriptome Analysis. MPMI 2013, 26, 1345–1358. [Google Scholar] [CrossRef]
  26. Mohanta, T.K.; Khan, A.; Hashem, A.; Abd_Allah, E.F.; Al-Harrasi, A. The Molecular Mass and Isoelectric Point of Plant Proteomes. BMC Genom. 2019, 20, 631. [Google Scholar] [CrossRef]
  27. Ono, K. Signal Peptides and Their Fragments in Post-Translation: Novel Insights of Signal Peptides. Int. J. Mol. Sci. 2024, 25, 13534. [Google Scholar] [CrossRef]
  28. Owji, H.; Nezafat, N.; Negahdaripour, M.; Hajiebrahimi, A.; Ghasemi, Y. A Comprehensive Review of Signal Peptides: Structure, Roles, and Applications. Eur. J. Cell Biol. 2018, 97, 422–441. [Google Scholar] [CrossRef]
  29. Zeng, X.; Wu, P.; Yao, C.; Liang, J.; Zhang, S.; Yin, H. Small Molecule and Peptide Recognition of Protein Transmembrane Domains. Biochemistry 2017, 56, 2076–2085. [Google Scholar] [CrossRef]
  30. Kang, Q.; Zhang, D. Principle and Potential Applications of the Non-Classical Protein Secretory Pathway in Bacteria. Appl. Microbiol. Biotechnol. 2020, 104, 953–965. [Google Scholar] [CrossRef]
  31. Jiang, Q.; Jin, X.; Lee, S.-J.; Yao, S. Protein Secondary Structure Prediction: A Survey of the State of the Art. J. Mol. Graph. Model. 2017, 76, 379–402. [Google Scholar] [CrossRef] [PubMed]
  32. Yatsyshyn, V.Y.; Fedorovych, D.V.; Sibirny, A.A. Metabolic and Bioprocess Engineering of the Yeast Candida Famata for FAD Production. J. Ind. Microbiol. Biotechnol. 2014, 41, 823–835. [Google Scholar] [CrossRef] [PubMed]
  33. Holland, J.T.; Harper, J.C.; Dolan, P.L.; Manginell, M.M.; Arango, D.C.; Rawlings, J.A.; Apblett, C.A.; Brozik, S.M. Rational Redesign of Glucose Oxidase for Improved Catalytic Function and Stability. PLoS ONE 2012, 7, e37924. [Google Scholar] [CrossRef]
  34. Witt, S.; Singh, M.; Kalisz, H.M. Structural and Kinetic Properties of Nonglycosylated Recombinant Penicillium amagasakiense Glucose Oxidase Expressed in Escherichia Coli. Appl. Environ. Microbiol. 1998, 64, 1405–1411. [Google Scholar] [CrossRef]
  35. Peñalva, M.A.; Arst, H.N. Regulation of Gene Expression by Ambient pH in Filamentous Fungi and Yeasts. Microbiol. Mol. Biol. Rev. 2002, 66, 426–446. [Google Scholar] [CrossRef]
  36. Prusky, D.; Yakoby, N. Pathogenic Fungi: Leading or Led by Ambient pH? Mol. Plant Pathol. 2003, 4, 509–516. [Google Scholar] [CrossRef]
  37. Serrano, C.Z. Development and Secondary Metabolism in Penicillium expansum: Implication of Global Transcription Factors VeA and BrlA. Doctoral Dissertation, Institut National Polytechnique de Toulouse-INPT, Toulouse, France, 2020. [Google Scholar]
  38. Chen, Y.; Li, B.Q.; Xu, X.D.; Zhang, Z.Q.; Tian, S.P. The pH-responsive PacC transcription factor plays pivotal roles in virulence and patulin biosynthesis in Penicillium expansum. Environ. Microbiol. 2018, 20, 4063–4078. [Google Scholar]
  39. He, X.; Chen, Y.; Tian, S.; Li, B. PePalA/B/C Are Required for Virulence and Patulin Biosynthesis by Regulating the PePacC-Processing Proteolytic Activity in Penicillium expansum. Food Qual. Saf. 2025, 9, fyae045. [Google Scholar] [CrossRef]
  40. Yin, X.; Shin, H.-D.; Li, J.; Du, G.; Liu, L.; Chen, J. P Gas, a Low-pH-Induced Promoter, as a Tool for Dynamic Control of Gene Expression for Metabolic Engineering of Aspergillus niger. Appl. Environ. Microbiol. 2017, 83, e03222-16. [Google Scholar] [CrossRef]
  41. Orejas, M.; Espeso, E.A.; Tilburn, J.; Sarkar, S.; Arst, H.N.; Penalva, M.A. Activation of the Aspergillus PacC Transcription Factor in Response to Alkaline Ambient pH Requires Proteolysis of the Carboxy-Terminal Mmety. Genes Dev. 1995, 9, 1622–1632. [Google Scholar]
  42. Barad, S.; Sela, N.; Dubey, A.K.; Kumar, D.; Luria, N.; Ment, D.; Cohen, S.; Schaffer, A.A.; Prusky, D. Differential Gene Expression in Tomato Fruit and Colletotrichum Gloeosporioides during Colonization of the RNAi–SlPH Tomato Line with Reduced Fruit Acidity and Higher pH. BMC Genomics 2017, 18, 579. [Google Scholar] [CrossRef]
  43. Yang, J.; Fan, Y.; Liu, F.; Ding, Y.; Yu, L.; Wang, Y.; Wu, A.; Jiao, Z.; Wang, C. Temperature-Induced Metabolic Changes of Apples Infected with Penicillium expansum Characterized by Non-Targeted High-Resolution Mass Spectrometry. Postharvest Biol. Technol. 2024, 209, 112700. [Google Scholar] [CrossRef]
  44. Zong, Y.; Li, B.; Tian, S. Effects of Carbon, Nitrogen and Ambient pH on Patulin Production and Related Gene Expression in Penicillium expansum. Int. J. Food Microbiol. 2015, 206, 102–108. [Google Scholar] [CrossRef] [PubMed]
  45. Gould, G.W. Methods for Preservation and Extension of Shelf Life. Int. J. Food Microbiol. 1996, 33, 51–64. [Google Scholar] [CrossRef]
  46. O’Connell, C.A.; Dollimore, D. A Study of the Decomposition of Calcium Propionate, Using Simultaneous TG-DTA. Thermochim. Acta 2000, 357–358, 79–87. [Google Scholar] [CrossRef]
  47. Sequeira, S.O.; Phillips, A.J.L.; Cabrita, E.J.; Macedo, M.F. Antifungal Treatment of Paper with Calcium Propionate and Parabens: Short-Term and Long-Term Effects. Int. Biodeterior. Biodegrad. 2017, 120, 203–215. [Google Scholar] [CrossRef]
Figure 1. The relative expression level of the GOX coding gene. (A) Apple fruits were wound-inoculated with 10 µL spore suspension of P. expansum at 1 × 106 spores/mL. (B) The relative expression levels of GOX1, GOX2 and GOX3 genes in the fruit lesion areas of P. expansum inoculated at different times. Columns labeled with different letters demonstrate statistically significant differences (p < 0.05).
Figure 1. The relative expression level of the GOX coding gene. (A) Apple fruits were wound-inoculated with 10 µL spore suspension of P. expansum at 1 × 106 spores/mL. (B) The relative expression levels of GOX1, GOX2 and GOX3 genes in the fruit lesion areas of P. expansum inoculated at different times. Columns labeled with different letters demonstrate statistically significant differences (p < 0.05).
Horticulturae 11 00860 g001
Figure 2. Phylogenetic analysis and characterization of GOX2 gene. (A) Phylogenetic analysis of GOX2. (B) Motif location in the GOX proteins. (C) Motif sequence logo of the protein conserved domains. (D) Phylogenetic relationship between P. expansum and other Penicillium species.
Figure 2. Phylogenetic analysis and characterization of GOX2 gene. (A) Phylogenetic analysis of GOX2. (B) Motif location in the GOX proteins. (C) Motif sequence logo of the protein conserved domains. (D) Phylogenetic relationship between P. expansum and other Penicillium species.
Horticulturae 11 00860 g002
Figure 3. GOX transmembrane domain, signal peptide, hydrophobicity prediction. (A) Hydrophobicity, (B) signal peptide and (C) transmembrane domain, The upper yellow line indicates the color designation of the lower line segment.
Figure 3. GOX transmembrane domain, signal peptide, hydrophobicity prediction. (A) Hydrophobicity, (B) signal peptide and (C) transmembrane domain, The upper yellow line indicates the color designation of the lower line segment.
Horticulturae 11 00860 g003
Figure 4. GOX secondary structure. (A) The existence of secondary structures at different positions in the protein amino acid sequence, (B) A curve graph showing the existence of secondary structures at different positions in the protein amino acid sequence.
Figure 4. GOX secondary structure. (A) The existence of secondary structures at different positions in the protein amino acid sequence, (B) A curve graph showing the existence of secondary structures at different positions in the protein amino acid sequence.
Horticulturae 11 00860 g004
Figure 5. The conserved domain and tertiary structure of the GOX protein. (A) GOX protein conserved domain. (B) GOX tertiary structure.
Figure 5. The conserved domain and tertiary structure of the GOX protein. (A) GOX protein conserved domain. (B) GOX tertiary structure.
Horticulturae 11 00860 g005
Figure 6. Effects of environmental factors on the expression level of the GOX2 gene. (A) pH affects the expression quantity of GOX2. (B) Temperature affects the expression quantity of GOX2. (C) Carbon base affects the expression quantity of GOX2. (D) Antifungal agents affect the expression quantity of GOX2. Columns labeled with different letters demonstrate statistically significant differences (p < 0.05).
Figure 6. Effects of environmental factors on the expression level of the GOX2 gene. (A) pH affects the expression quantity of GOX2. (B) Temperature affects the expression quantity of GOX2. (C) Carbon base affects the expression quantity of GOX2. (D) Antifungal agents affect the expression quantity of GOX2. Columns labeled with different letters demonstrate statistically significant differences (p < 0.05).
Horticulturae 11 00860 g006
Table 1. Primers for GOX coding genes.
Table 1. Primers for GOX coding genes.
PrimerPrimer Sequences (5′–3′)
28S-FGGAACGGGACGTCATAGAGG
28S-RAGAGCTGCATTCCCAAACAAC
GOX1-FCACCACTGTTGACCACGCCTATG
GOX1-RCCAAGACCATTGCCAGATCGGATG
GOX2-FCCGCACCGAGATTGTTAGATCAGG
GOX2-RTCCCAGTTCCACCCTTCCATTCC
GOX3-FGGCACTTGGAGGAACATCGA
GOX3-RTGGTCTCCCATGCGTCAAT
Table 2. Protein physicochemical properties.
Table 2. Protein physicochemical properties.
Protein NameMolecular Weigh (kDa)Theoretica (PI)Instability IndexGrand Average of Hydropathicity (GRAVY)(Arg + Lys)(Asp + Glu)Aliphatic Inde
GOX63.885.7242.16−0.225604782.77
Table 3. Amino acid composition.
Table 3. Amino acid composition.
Amino Acid CompositionGOX (%)Amino Acid CompositionGOX (%)
Ala7.3Lys3.3
Arg5.2Met1.0
Asn6.1Phe4.4
Asp5.8Pro5.0
Cys1.0Ser5.8
Gln4.2Thr7.1
Glu4.6Trp2.1
Gly9.4Tyr2.9
His3.1Val6.7
Ile5.4Pyl0.0
Leu9.4Sec0.0
Note: The amino acid composition was obtained using the ExPASy online tool. Biological replicates were conducted at least four times.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yuan, Y.; Ru, Y.; Yuan, X.; Huang, S.; Yuan, D.; Fu, M.; Jiao, W. Functional Analysis of Penicillium expansum Glucose Oxidase-Encoding Gene, GOX2, and Its Expression Responses to Multiple Environmental Factors. Horticulturae 2025, 11, 860. https://doi.org/10.3390/horticulturae11070860

AMA Style

Yuan Y, Ru Y, Yuan X, Huang S, Yuan D, Fu M, Jiao W. Functional Analysis of Penicillium expansum Glucose Oxidase-Encoding Gene, GOX2, and Its Expression Responses to Multiple Environmental Factors. Horticulturae. 2025; 11(7):860. https://doi.org/10.3390/horticulturae11070860

Chicago/Turabian Style

Yuan, Yongcheng, Yutong Ru, Xiaohe Yuan, Shuqi Huang, Dan Yuan, Maorun Fu, and Wenxiao Jiao. 2025. "Functional Analysis of Penicillium expansum Glucose Oxidase-Encoding Gene, GOX2, and Its Expression Responses to Multiple Environmental Factors" Horticulturae 11, no. 7: 860. https://doi.org/10.3390/horticulturae11070860

APA Style

Yuan, Y., Ru, Y., Yuan, X., Huang, S., Yuan, D., Fu, M., & Jiao, W. (2025). Functional Analysis of Penicillium expansum Glucose Oxidase-Encoding Gene, GOX2, and Its Expression Responses to Multiple Environmental Factors. Horticulturae, 11(7), 860. https://doi.org/10.3390/horticulturae11070860

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop