Next Article in Journal
Secondary Metabolite-Induced Osmo-Protection and Host Antioxidant Systems in Banana in Waterlogged Sodic Soils
Previous Article in Journal
Effects of Mesophyll Conductance and Nitrogen Content on Carbon Assimilation During Low-Water Stress in Leaf Lettuce Cultivars
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 11
Issue 4
10.3390/horticulturae11040415
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Exploring Heat Stress Response in Genetically and Nutraceutically Diverse Tuscan Potato Landraces Using the Innovative Microcosmo Platform

by
Sara Parri
1,
Chiara Piccini
2,
Giampiero Cai
1,*,
Claudio Cantini
2,
Marco Romi
1 and
Veronica Conti
1
1
Department of Life Science, University of Siena, 53100 Siena, Italy
2
Institute for BioEconomy (IBE), National Research Council (CNR), 58022 Follonica, Italy
*
Author to whom correspondence should be addressed.
Horticulturae 2025, 11(4), 415; https://doi.org/10.3390/horticulturae11040415
Submission received: 27 February 2025 / Revised: 3 April 2025 / Accepted: 11 April 2025 / Published: 13 April 2025
(This article belongs to the Section Biotic and Abiotic Stress)
Browse Figures
Versions Notes

Abstract

:
The study investigated the physiological response to heat exposure of three potato landraces (Biancona del Faggeto, Rossa delle Macchie, and Quarantina delle Macchie), which are primarily grown in the rural area of Mount Amiata (Grosseto, Tuscany) and are distinguished by specific phylogenetic relationships and nutraceutical composition. Nutraceutical and genetic analyses were performed on tubers collected from the field, whereas physiological assessments were conducted on plants grown in Microcosmo simulators. Overall, nutraceutical analyses revealed tissue-specific differences in the distribution of starch and antioxidants, with ‘Biancona del Faggeto’ and ‘Quarantina delle Macchie’ accumulating more starch in the pulp than in the peel. The level of polyphenols and antioxidants differed between the pulp and the peel, but they accumulated most in the peel of ‘Biancona’. Phylogenetic analysis revealed that ‘Rossa’ and ‘Quarantina’ were more closely related than ‘Biancona’. Given that ‘Biancona’ also contained more starch and antioxidants than the others, this suggests a strong relationship between the phylogeny of the potato varieties and their nutritional content. Heat stress reduced net carbon assimilation and stomatal conductance in all landraces, with ‘Quarantina’ showing the greatest reductions, indicating that stomatal closure is the primary limitation of CO2 uptake. However, both the maximum and actual quantum yields of photosystem II remained stable under heat stress, indicating that the primary limitation was not caused by damage to photosynthesis light-dependent reactions. These findings highlight the complex interplay between the genetic background and nutraceutical capacity of potato plants, as well as their physiological adaptability to withstand environmental stressors, and provide valuable insights for breeding healthier and more heat-tolerant potato landraces.

1. Introduction

Potatoes (Solanum tuberosum L.) are one of the most important crops globally, serving as a fundamental source of nutrition for millions of people. The potato is native to the Andean region of South America, but numerous varieties of the genus Solanum have evolved, leading to the selection of the varieties known today [1]. More than 2000 species of Solanum are known, of which only 160–180 produce tubers. Most of these are used for food, with S. tuberosum being the most cultivated worldwide. Today, potatoes are grown in more than a hundred countries. According to the Food and Agriculture Organization (FAO), potatoes are the most widely grown crop after cereals (wheat, rice, and corn) and are part of the diet in almost all countries. In 2023, global potato production reached 375 million tons, growing on more than 19 million hectares. Of this production, 50.4% will come from Asia (China and India), 31.4% from Europe, 11.4% from the Americas, and 6.4% from Africa. In recent years, the potato cultivation area in Italy has been around 50,000 hectares, with an average total national production of around 1,400,000 tons per year and an average yield of around 30 tons per hectare, with the Piemonte, Emilia-Romagna, and Lombardia regions being the most productive [2]. The number of potato varieties is impossible to define, although some authors estimate a list close to 7000. Cultivated species are well documented, including several such as Solanum tuberosum L., Solanum curtilobum, Solanum ajanhuiri, and Solanum juzepczukii, along with S. tuberosum, Chilotanum, and Andigenum. These species are characterized by different evolutionary trajectories and biogeographic distributions [1].
This diversity within cultivated potato species reflects the broader genetic diversity of crops, which is critical for agricultural sustainability and resilience to climate change. Crop genetic diversity allows for the development of varieties that are resistant to a variety of environmental conditions. As a result, agrobiodiversity serves as an important genetic reservoir for both agriculture and humans. In the plant domain, genetic resources include wild species (plants that have not been domesticated and are used directly or indirectly), wild relatives (wild plants closely related to domesticated plants that can be used in genetic improvement programs), ecotypes (spontaneous populations that have adapted to specific environments independently of human influence), local varieties (traditional varieties that reproduce sexually or asexually and represent variable populations identifiable by local names), and improved varieties (derived from genetic improvement programs) [3].
Local varieties, or landraces, are not subject to genetic improvement programs because they are specifically adapted to the environmental conditions and agricultural practices of specific areas, thanks to reproduction/conservation by farmers. In addition, the conservation of potato germplasm can facilitate the incorporation of traits from wild relatives into cultivated varieties to restore lost genetic diversity or to introduce new traits to improve breeding qualities. This includes the identification and introduction of desirable traits, such as disease resistance and processing quality, with the aim of identifying and transferring beneficial alleles, thereby accelerating the genetic improvement of potato [4]. Therefore, in an era of global production and trade, the rediscovery and valorization of landraces is increasingly necessary. These landraces benefit production economies, help to prevent depopulation in agricultural regions, and contribute to their revitalization. They also help mitigate climate change caused by factors such as increased CO2 levels and deforestation due to intensive farming practices. Furthermore, valuing agrobiodiversity reduces diet homogeneity, which is beneficial to human health, and makes agrifood production less susceptible to pathogens and environmental stresses. Landraces can play an important role in agriculture because they possess distinct characteristics that make them valuable for sustainable agriculture. Genetic, physiological, and heat stress response characterization of these landraces is essential for their conservation and future use [5,6].
Given that the agrobiodiversity reservoir is also tested for tolerance to abiotic stressors, we attempted to differentiate potato varieties based on their tolerance to heat stress, which is widely regarded as one of the most important abiotic stressors for plants worldwide. It is also widely acknowledged that potato crops are extremely sensitive to high temperatures. At the physiological level, photosynthetic rates are already significantly impaired at temperatures of 31/22 °C (day/night) [7] and 35 °C [8], with Havaux [9] identifying 38 °C as the threshold temperature above which photosystem II function is rapidly and permanently lost. High temperatures also accelerate respiration rates [10,11], resulting in a significant reduction in the photosynthesis/respiration ratio, depletion of stored carbon, and decreased plant biomass. The optimal day temperature for potato photosynthesis is typically around 24 °C, and keeping the night temperature below 22 °C is critical for tuber growth [12]. Higher nighttime temperatures inhibit tuber growth, lowering yield and quality [13]. Given the significance of photosynthetic impairment as a primary cause of reduced growth and productivity, investigating gas exchange and chlorophyll fluorescence parameters is critical for understanding the physiological responses of potato plants to heat stress. These parameters are useful tools for assessing the impact of sublethal temperatures and developing strategies to reduce the effects of thermal stress in potato cultivation. Heat stress caused by climate change is a global issue, but its consequences are being experienced at a local level [14], as evidenced by numerous studies on the effects of climate change in Italy on crops such as maize [15], rice [16], and olive trees [15].
A small number of studies have investigated the local potato agrobiodiversity in Italy, with a particular emphasis on mountain areas. Giupponi et al. [17] studied the Ligurian Apennines, characterizing three local varieties (Quarantina Bianca, Quarantina Prugnona, and Rubra Spes) and comparing them to commercial varieties. The results indicated good adaptability to various altitudes. To distinguish local potato accessions from commercial varieties, Di Donato et al. [18] used ATR-FTIR spectroscopy in conjunction with morphological and molecular analyses. This method proved to be effective for distinguishing between varieties based on pulp composition. Finally, Pacifico [19] investigated the quality of Italian mountain potatoes, discussing how altitude affects the sensory and nutritional value of tubers, as well as the environmental and socioeconomic implications of mountain farming. All manuscripts emphasized the importance of preserving and valorizing local varieties, as well as the need for additional research to fully understand the interaction of genetics, environment, and product quality.
In this study, three local potato landraces from Mount Amiata (Italy) were investigated: ‘Biancona del Faggeto’ (characterized by its elongated shape and light beige skin), ‘Quarantina delle Macchie’ (with a round shape and yellow skin, medium deep eyes, and cream-colored flesh), and ‘Rossa delle Macchie’ (with an oval shape and reddish-brown skin, shallow red eyes, and pale-yellow pulp). The unique orographic conditions of the lava dome of Mount Amiata have historically created a form of isolation that has favored the development of local species, while the ancient lava flows, rich in minerals, have contributed significantly to the fertility of the soil [20]. The extensive investigation in the area led to the identification of only these landraces; they have been cultivated despite their lower productivity characteristics, primarily for the superior taste of the pulp and the ability to be stored and used as food for several months after harvesting without any chemical treatment or refrigeration. The three landraces were evaluated for their nutraceutical potential, such as starch concentration, antioxidant capacity, and polyphenol content, in addition to their tolerance to heat stress conditions. We designed the experimental approach with physiological and chemical analyses that were faster, more direct, and measurable, allowing us to gain a comprehensive understanding of the response of the three varieties to heat stress. Systematic measurements of physiological parameters were made during plant growth in controlled environments (Microcosmo) under heat stress conditions. The Microcosmo proved to be an invaluable tool in this study, providing a highly controlled environment that allowed for accurate and reproducible analyses of plant responses to abiotic stress while minimizing the impact of the external environment on genotypes. By utilizing these controlled systems, the study ensures a solid framework for interpreting physiological responses with greater accuracy and relevance; thus, we preferred to study the landraces under well-controlled conditions in a cutting-edge growth chamber like the Microcosmo. The results of this study will provide a deeper understanding of the unique characteristics of these landraces and their potential use for conservation and sustainable agriculture. We anticipate that our findings will help to improve food security, promote agricultural resilience in the face of climate change, and increase cultivation of these ancient landraces in a region in need of economic development.

2. Materials and Methods

2.1. Plant Materials

A long and detailed survey was first carried out in the Mount Amiata area, interviewing farmers and locals to gather evidence of the presence of local potato landraces. In two years of research, only three presumed landraces were found to be present at the local level, cultivated by three different families, preserved by the memory of the ancestors, and grown in small family gardens. Tubers of the three potato landraces were collected from different sources and planted in the same field in the Le Macchie area of Mount Amiata (4285269 N, 1151911 E) during 2023. Figure 1 shows the temperature (A) and precipitation (B) recorded by the nearest weather station in Santa Fiora (4747824 N, 708815 E). The experimental design was carried out using a split-plot design with three plots. The field was 30 square meters divided into three subplots, each containing one of the landraces in an experimental unit of ten plants (three plants per square meter with a row distance of 0.9 m and a plant distance of 0.3 m). The soil was kept weed-free between the rows by two passages with a small harrow and irrigated twice during the season. All the landraces were harvested on the same day, and the nutritional analysis was performed immediately after harvesting. Five tubers from each landrace were selected and planted in a controlled environment (Microcosmo; FOS Spa, Genoa, Italy) with Vigor Plant substrate. Physiological and genetic analyses were performed on the leaves of these grown plants. Microcosmo is an innovative high-tech field simulator developed by FOS and ENEA to simulate plant growth in controlled environments, both indoors and under extreme conditions. The 5 individuals per genotype grown in Microcosmo were the same as those used for phenotypic observations, based on the guidelines of the Germplasm Bank of the Tuscany Region (http://germoplasma.regione.toscana.it (accessed on 11 April 2025)).

2.2. Nutraceutical Analyses

For bioactive compounds extraction, 0.5 g of peel and flesh from tubers of each landrace were weighed and transferred to tubes containing 3 mL of 70% acetone; samples were homogenized using a homogenizer (Ultra-Turrax® T25-based IKA, Saint Louis, MO, USA) for 3 min. To facilitate more efficient extraction of compounds, all samples were placed in the sonicator (Elma Transsonic T 460/H, Wezikon, Switzerland) for 15 min and vortexed for 30 s. Finally, samples were centrifuged at 2000 g for 5 min, and the supernatant was collected to obtain the extract for subsequent colorimetric assays.
The FRAP method was used to measure the antioxidant capacity [21]. The following method was applied to three technical replicates for each sample. Each test tube contained 2040 µL acetate buffer pH 3.6, 200 µL TPTZ, 200 µL 0.2 M ferric chloride, and 20 µL extract (diluted 1:20). After incubation for one hour at 37 °C, the absorbance was read at 593 nm using a spectrophotometer (Shimadzu UV-1280; Shimadzu Corporation, Kyoto, Japan). Results were expressed as mmol Fe2+ equivalents per 100 g of fresh material.
Total polyphenols were determined by the Folin-Ciocalteau assay [21]. Three replicates were run for each sample. Each test tube contained 5 µL extract (diluted 1:100), 3000 µL H2O, 250 µL Folin reagent, 750 µL sodium carbonate, and 950 µL distilled H2O. For blank preparation, the sample volume was replaced with an identical volume of distilled water. Samples were incubated in a thermostatically controlled oven at 37 °C for 30 min. After 30 min of incubation, the absorbances were read at 765 nm using a spectrophotometer (Shimadzu UV-1280). The results were expressed as mg gallic acid per 100 g fresh material.
The spectrophotometric method using Lugol’s reagent was used to quantify the starch present in the peel and pulp of the tubers [22]. 50 mg of pulp and peel were weighed and separately placed in a tube with 2 mL of dimethyl sulfoxide (DMSO). After two minutes of homogenization, 500 μL of 8 M HCl was then added to the mixture. Samples were incubated at 60 °C for 30 min. Then, 500 μL of 8 M NaOH and 7 mL of distilled water were added. After a centrifugation at 2000 g for 8 min, 0.167 mL of supernatant was collected, to which 0.333 mL of distilled H2O and 2.5 mL of Lugol’s reagent were added. Absorbances were read at 605 nm with a spectrophotometer (Shimadzu UV-1280).

2.3. DNA Extraction

A pool of leaves taken from 3 plants for each genotype was collected in the field and used for DNA extraction. Upon collection, the samples were frozen in liquid nitrogen and stored at −80 °C. The DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany) was used for DNA extraction and purification. Briefly, leaves of each landrace were pulverized in liquid nitrogen using a mortar and pestle. Next, 100 mg of sample for each landrace was weighed and transferred to 2 mL Eppendorf tubes following the subsequent instructions of the QIAGEN protocol. DNA was quantified using the Eppendorf BIOPHOTOMER spectrophotometer (Eppendorf AG, Hamburg, Germany).

2.4. SSR Genotyping

The characterization of the genotypes of the three potato landraces was carried out using 6 primer pairs for SSR amplification, as shown in Table 1.

2.5. Amplification by PCR and Detection of Fragments

PCR was performed in triplicate for each of the three potato varieties. The reaction was performed separately for each primer using Taq DNA Polymerase with 25 mM MgCl2 (Thermofisher Scientific, Waltham, MA, USA), 2 μL of DNA at a concentration of 30 ng/mL, and the primers at 0.3 μM according to the maximum efficiency, in a final volume of 25 μL. The PCR (Eppendorf AG 5341 Mastercycler PCR Thermal Cycler; Eppendorf AG, Hamburg, Germany) was run using a program with the parameters shown in Table 2. A single PCR protocol was optimized for the simultaneous amplification of the six selected SSR primers. An annealing temperature of 57 °C was determined to be optimal for all primers, based on prior temperature gradient PCR experiments.
For allelic fragment size analysis, PCR products were diluted 1:10. For each sample, 1 μL DNA and 0.5 μL standard (GeneScanTM 600 LIZTM Dye Size Standard v2.0, ThermoFisher, USA) were added to a total volume of 10 μL and brought to volume with formamide. The amplicons were then automatically sequenced using the SeqStudio Genetic Analyzer tool with SeqStudioTM Cartridge v2 (ThermoFisher, Waltham, MA, USA). Next, the amplicons were analyzed using GeneMarker® V3.0.1 software (https://softgenetics.com/ (accessed on 11 April 2025); SoftGenetics, State College, Centre County, PA, USA), which allows the determination of allele size. Finally, GeneAlEx version 6.5 (developed by Rod Peakall and Peter Smouse at the Australian National University in Canberra, Australia) was used to calculate genetic similarity coefficients to assess the degree of genetic relationship among the different genotypes. The phylogenetic tree was inferred using the neighbor-joining method with the MEGA7 program (https://www.megasoftware.net/ (accessed on 11 April 2025)).

2.6. Controlled Growth in Microcosmo Simulators

The Microcosmo (FOS S.p.A, Genova, Italy, and ENEA, Rome, Italy) is a mobile closed structure, which can be used as a field simulator for the growth of plants in a controlled environment (https://pianogreen.com/en/microcosmo/ (accessed on 11 April 2025)). The Microcosmo allows control of environmental parameters such as epigeal temperature, light conditions/photoperiod, humidity, and hypogeal temperature [25]. Figure 2 shows a schematic of the simulator and an image of the plants grown in Microcosmo.
The light conditions in the chamber were a PPFD of 100 µmol m−2 s−1 at canopy level and a red–blue–white ratio of 70:20:10 [26]. Regarding temperature setting, eight individuals for each landrace were grown under control temperature conditions (CTRL) of 24/20 °C (day/night) in the epigeal chamber and 22/18 °C in the hypogeal chamber, which had been individually determined to be optimal for gas exchange and tuber development [7,11,12,13]. After 30 days of growth, four individuals were maintained under the same conditions (CTRL), while another four for each landrace were subjected to sublethal heat stress for 4 days (HS). During HS, the temperature in the epigeal and hypogeal chambers reached 35 °C and 24 °C, respectively, during the hottest hours, as this is the temperature at which a reduction in gas exchange should occur [7,8] without reaching photosystem impairment [9]. Temperatures remained unchanged compared to CTRL for the rest of the day. Plots of temperature trends in CTRL and HS conditions are shown in Figure 3.

2.7. Physiological Analysis

Physiological analyses of mature leaves were performed in vivo under CTRL and HS conditions simulated in Microcosmo using a portable gas exchange analyzer (LI-6800, LICOR Environmental, Lincoln, NE, USA) equipped with a leaf chamber fluorometer. For gas exchange measurements, the following conditions were set: photosynthetically active radiation at 1200 µmol m−2 s−1, reference CO2 at 400 ppm, block temperature at the corresponding Microcosmo temperature, and relative humidity at 60% inside the leaf chamber. In this study, stomatal conductance (gs, mmol H2O/m−2 s−1), net carbon assimilation (A, µmol m−2 s−1), and effective photosynthetic efficiency (phiPSII) were recorded. The water use efficiency (WUE, mm CO2/mmol H2O) was calculated from the parameters A and gs. Finally, the maximum quantum yield of PSII (Fv/Fm) was determined for dark-adapted leaves covered with aluminum foil for at least 20 min. Five measurements were taken on fully expanded mature leaves of each landrace before heat stress and on the fourth and last day of treatment at 10 am when the temperature was 30 °C and at 3 pm when the temperature had reached 35 °C for 4 h. At the same time, the same parameters were recorded on the control plants (at 25 °C).

2.8. Statistical Analysis

Data were analyzed by one-way ANOVA followed by Tukey’s post hoc test for significant differences (p < 0.05), using GraphPad Prism 10.0 (GraphPad Software, San Diego, CA, USA). Differences detected by post hoc comparisons were indicated between pulp and peel or CTRL and HS groups of the same landrace.

3. Results

3.1. Phenotypic Traits

The morphological characteristics of different potato varieties showed different features. As for the structure of the canopy, the varieties varied from semi-open with partially visible stems, as in ‘Biancona del Faggeto’, to closed foliage with barely visible stems, as in ‘Rossa delle Macchie’, to open foliage with clearly visible stems, as in ‘Quarantina delle Macchie’. The growth habit of the plant varied from upright, as in the case of the ‘Biancona del Faggeto’, to semi-upright, as in the case of the ‘Rossa delle Macchie’, and open, as in the case of the ‘Quarantina delle Macchie’. The anthocyanin pigmentation of the stem varied from absent (‘Biancona del Faggeto’) to strong (‘Rossa delle Macchie’) and low (‘Quarantina delle Macchie’). The leaf opening also showed variation, from narrow (‘Biancona del Faggeto’, ‘Quarantina delle Macchie’) to intermediate (‘Rossa delle Macchie’), while the leaf color was dark in ‘Biancona’, intermediate in ‘Rossa’, and clear in ‘Quarantina’. The tubers had different shapes, including elongated (‘Biancona del Faggeto’), oval (‘Rossa delle Macchie’), and round (‘Quarantina delle Macchie’). The color of the epidermis varied from pale beige (‘Biancona del Faggeto’) to reddish brown (‘Rossa delle Macchie’) and yellow (‘Quarantina delle Macchie’), while the color of the pulp varied from white to pale yellow and cream, depending on the variety. A representative picture of the potato tubers is shown in Figure 4.

3.2. Genetic Diversity

Genetic analysis of the three potato landraces was performed by amplification of six microsatellite loci using specific primers for each locus. Of the six SSRs analyzed, only two, STM1049 and STM0019a, were found to be polymorphic but sufficient to discriminate between the three landraces. The polymorphism of these two microsatellites is clearly observed by the allele sizes measured in the three landraces, as shown in Table 3. For STM1049, both Quarantina and Rossa showed the same allele sizes, ranging from 176 to 186 bp, indicating a heterozygous state. In contrast, ‘Biancona’ showed a homozygous state with a single allele size peak at 176 bp. For STM0019a, allele sizes varied among the three landraces. Quarantina’ showed allele sizes ranging from 193 to 203 bp, ‘Rossa’ from 203 to 231 bp, and ‘Biancona’ from 187 to 203 bp. The observed allele size ranges are consistent with previously published data [23,24], where STM0019a exhibits a range of 155 to 241 bp, and STM1049 spans 184 to 254 bp. The variations observed in our study may reflect further genetic differentiation within these specific potato genotypes compared to broader populations. Notably, the remaining SSR markers analyzed, including STM1106, showed no polymorphism among the three varieties studied. This lack of polymorphism for STM1106 is consistent with the findings of Bhardwaj et al. [27], who also noted its ineffectiveness in variety discrimination. Conversely, the allele lengths detected for STM1052 and STM1104 were consistent with those reported by Tillault et al. [28], showing identical ranges of 208–224 bp and 166–176 bp, respectively. This study demonstrates the feasibility of genetic differentiation among the three potato genotypes studied, thanks to the results obtained with the two polymorphic markers. It is clear that further analyses with a larger number of markers and populations will be necessary for an effective differentiation analysis.
Figure 5 shows a phylogenetic tree constructed using the neighbor-joining method. The tree illustrates the genetic relationships between the three potato landraces based on allele lengths. The branch lengths, proportional to genetic dissimilarity, indicate that ‘Quarantina’ and ‘Rossa’ were more closely related and branched together, while ‘Biancona’ represented a more distinct lineage, more distant from the other two landraces.

3.3. Starch Content

As shown in Figure 6, the starch content was higher in the pulp than in the peel of two of the three landraces analyzed. In fact, the difference between pulp and peel content was significantly different in ‘Biancona del Faggeto’ (p < 0.001) and ‘Quarantina delle Macchie’ (p < 0.01). ‘Rossa delle Macchie’, on the other hand, showed no significant difference in starch between pulp and peel.

3.4. Nutraceutical Analysis

The total polyphenol content (Figure 7A) was higher and significantly different in the peel compared to the pulp of all three local landraces. The highest value was measured in the peel of ‘Biancona del Faggeto’ (181.7 mg gallic acid equivalents 100 g−1), while similar contents were found in the peel of ‘Rossa’ and ‘Quarantina delle Macchie’ (96.2 and 87.9 mg gallic acid equivalents 100 g−1, respectively). The same trend of polyphenol content was observed for the antioxidant capacity (Figure 7B), with the highest value recorded in the peel of ‘Biancona del Faggeto’ (4.6 mmol Fe2+ 100 g−1), while lower and similar values were found in the peel of ‘Rossa’ and ‘Quarantina delle Macchie’ (both 1.8 mmol Fe2+ 100 g−1). However, all the peels of the three landraces showed higher and significantly different antioxidant power compared to the pulp.

3.5. Physiological Responses to Heat Stress

As shown in Figure 8A, the potato landraces showed a reduction in stomatal conductance after 4 days of exposure to high temperatures. However, a statistically significant difference was found only between the control and treated samples of ‘Quarantina delle Macchie’. The highest stomatal conductances at 10 am (30 °C) and at 3 pm (35 °C) were recorded in ‘Biancona del Faggeto’ (0.267 and 0.302 mmol H2O m−2 s−1, respectively). Similarly to the stomatal conductance, ‘Quarantina delle Macchie’ also showed a decrease in net carbon assimilation rate when exposed to heat (Figure 8B). Therefore, the exposed samples were significantly different from the control at both times. Again, the highest values were measured in ‘Biancona del Faggeto’ at 10 am and 3 pm (13.3 and 18.9 µmol CO2 m−2 s−1, respectively).
For the other physiological parameters analyzed, there were no significant differences between the control and treated groups of the three landraces; for this reason, no graph was displayed. In particular, Fv/Fm showed a consistent pattern across landraces and treatments: the maximum quantum yield of photosystem II remained high (~0.8) regardless of heat exposure. The actual quantum yield of photosystem II ranged from 0.217 to 0.346 in ‘Biancona del Faggeto’, from 0.165 to 0.246 in ‘Rossa delle Macchie’, and from 0.120 to 0.222 in ‘Quarantina delle Macchie’, with no significant differences between treatments. Finally, heat exposure also promoted a slight increase in WUE, although no significant difference was found.

4. Discussion

The study investigated the phylogenetic relationships, nutraceutical composition, and physiological response to heat exposure of three potato landraces (Biancona del Faggeto, Rossa delle Macchie, and Quarantina delle Macchie), which are primarily grown in the rural area of Mount Amiata (Grosseto, Tuscany). Our goal was to understand how the distinct genetic characteristics of landraces correlate to their nutritional value and resilience to environmental stressors, thereby providing valuable insights for sustainable agriculture practices in the region.
Firstly, phylogenetic analysis revealed the distinct genotype identity of these potato landraces, indicating that ‘Quarantina’ and ‘Rossa’ were more closely related than ‘Biancona’. Because the differences between potato varieties are primarily due to genetic variability, this finding supported the differences found in the nutraceutical content and physiological responses of landraces [12,29,30,31]. The genetic differences are reflected in the higher starch content of the ‘Biancona del Faggeto’ pulp and the higher total polyphenol content and antioxidant capacity of its peel in comparison to the pulp; however, the other two landraces follow the same content diversity between pulp and peel. The tissue-specific allocation revealed that the higher starch content in the pulp is consistent with the literature, identifying the pulp as the primary tissue for carbohydrate storage in potato tubers [32]. This resource allocation pattern, which is typical of potato cultivars, suggests metabolic roles and different patterns of starch accumulation that are unique to each potato landrace. Furthermore, the higher total polyphenols and antioxidant capacity in the peel observed across all landraces is consistent with previous research. The peel is known to serve as a protective layer rich in antioxidant compounds, helping to protect against environmental stress and reactive oxygen species [33]. Consequently, the findings suggest that ‘Biancona’ exhibits a higher concentration of antioxidant compounds, which could potentially result in greater defensive activity. However, it is essential to emphasize that a high antioxidant content does not necessarily associate with an enhanced defensive capability—this is a possibility that requires further corroboration and may or may not occur. Overall, these results underscore the distinct roles played by pulp and peel tissues in nutrient storage and protective functions, respectively. Potato genetic diversity is essential for creating stress-tolerant cultivars, especially against heat and drought [12,29,30,31]. Different potato genotypes, including wild relatives, exhibit varying stress responses, as evidenced by yield and physiological traits such as chlorophyll content and membrane stability [12,34]. Breeding efforts should prioritize genotypes that can withstand both heat and drought stress, reflecting real-world climate change scenarios. Wild potato relatives like S. chacoense and S. commersonii have proven to be valuable gene sources for stress resistance breeding [30]. These diverse responses to abiotic stresses are driven by genetic variability, as revealed by transcriptomic and physiological analyses of stress-related molecular and biochemical reactions. For example, different cultivars exhibit different expression patterns of stress-related genes, such as the histone modifiers StPRMT and StHDMA [35], microRNAs [31,36], and heat shock proteins [12,37]. Aside from genetic mechanisms of diversification, geographical differentiation of potato varieties must be considered. Studies in South Africa, Ethiopia, and Peru have shown that landraces adapt to specific environmental conditions, giving them advantages in drought or heat tolerance. These adaptations are critical for ensuring potato crop survival and productivity in harsh climates, ultimately contributing to food security and agricultural sustainability [36,38]. Statistical methods such as restricted maximum likelihood (REML)/best linear unbiased predicted (BLUP), relative performance of predicted genotypic values (RPGV), harmonic mean of relative performance of genotypic values (HMRPGV) and harmonic mean of genotypic values (HMGV) help to identify and select superior, stable and adaptable genotypes for breeding programs [30]. These tools allow breeders to make informed decisions based on the performance and genetic potential of various genotypes, ultimately leading to the development of more resilient and high-yielding crop varieties, making agriculture more adaptable to changing environments.
Regarding high temperature exposure and physiological responses, the main results showed a reduced stomatal conductance and, possibly, a reduction in CO2 uptake, which is consistent with the extensive literature showing that plants often close their stomata to limit water loss during heat stress, thereby also limiting CO2 uptake for photosynthesis [39]. These findings are consistent with the well-established link between stomatal closure and decreased CO2 assimilation, which is a common occurrence under various abiotic stresses. In response to stress, plants clearly prioritize water conservation over carbon uptake, which can have a significant impact on overall plant growth and productivity [40]. These effects were more pronounced in the landrace ‘Quarantina delle Macchie’, making it the most vulnerable. However, not all parameters were affected by temperature. The consistent and stable values of both actual and maximum quantum yield of photosystem II suggest that temperature did not affect photosystem II functionality, as damage typically occurs under more extreme or prolonged conditions [30]. The observed PSII stability suggests that the primary limitation to photosynthesis in this study was stomatal conductance and CO2 diffusion, rather than light capture. This is consistent with previous research highlighting how stomatal closure creates a bottleneck for carbon assimilation [40]. It should be noted that the temperature of 35 °C is below the critical threshold identified for providing biochemical impairments in potato leaves, which was found to be 38 °C [9].
The agreement between the phylogenetic tree and the observed physiological responses supports the idea that evolutionary history influences a plant’s ability to cope with environmental stress, as discussed in Koornneef et al. [41]. However, it is important to note that physiological responses to heat stress are complex and can be influenced by a variety of genes. The phylogenetic tree is based on a small number of genetic markers, which may not include all relevant genetic variation. As a result, the phylogenetic tree and the physiological responses to heat stress in these potato landraces are somewhat comparable. The genetically close landraces (Quarantina and Rossa) showed more similar reductions in CO2 uptake and stomatal conductance, implying more conservative water management, whereas the more genetically distinct ‘Biancona’, which was less affected by the stress, may have evolved a better photosynthesis maintenance mechanism. This suggests that genetic background influences the various responses to heat stress. It is also possible that similar responses are the result of different processes. For example, Quarantina and Rossa may share a common genetic pathway that leads to their similar responses, while Biancona may have developed a unique mechanism to cope with heat stress.

5. Conclusions

The study shows that combining genetic and physiological data can reveal significant differences in crop performance. It demonstrates that molecular analyses (SSR profiling) can distinguish between potato landraces, which are associated with differences in nutritional composition and stress responses. For example, ‘Biancona del Faggeto’ was genetically distant and had higher starch and antioxidant levels, as well as a stronger physiological response to heat stress, than the more sensitive ‘Quarantina delle Macchie’. This combination of genetic markers and physiological measurements improves our understanding of how genetic variation influences traits like stress tolerance—an important insight for crop improvement. From a practical point of view, the study makes concrete suggestions to farmers. It suggests that in heat-prone areas, more heat-tolerant varieties such as ‘Biancona del Faggeto’ or ‘Rossa delle Macchie’ should be planted, with ‘Quaran-tina delle Macchie’ reserved for cooler climates. Furthermore, the superior nutritional profile of ‘Biancona del Faggeto’ creates opportunities in the nutraceutical market. The study also emphasizes the importance of using advanced agronomic practices like optimized irrigation and microclimate monitoring in controlled environments to better understand and mitigate heat stress. Finally, maintaining cultivation of all three landraces is critical to preserving local biodiversity and agricultural heritage.

Author Contributions

Conceptualization, V.C., C.C., G.C. and M.R.; methodology, S.P., C.P. and V.C.; formal analysis, S.P. and V.C.; data curation, G.C. and C.P.; writing—original draft preparation, S.P., G.C. and V.C.; writing—review and editing, S.P. and C.P.; project administration, M.R. and C.C. All authors have read and agreed to the published version of the manuscript.

Funding

This work was carried out within the framework of the M.A.C.O.CI.PAT project (Methods of Agro Organoleptic Characterization of the Onion of Selva and the Potato of Macchie, funded by the Regione Toscana, Italy; https://www.genomamiata.it/macocipat/ (accessed on 11 April 2025), which aims at valorizing typical products of the Amiata area.

Data Availability Statement

Data will be made available on request.

Acknowledgments

We thank the Santa Chiara Lab of the University of Siena (https://santachiaralab.unisi.it/it (accessed on 11 April 2025)) for providing access to the “Microcosmo” facility and for technical support. This work was partially supported by the PNRR Metrofood project (https://www.metrofood.it/ (accessed on 11 April 2025)).

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. de Haan, S.; Rodriguez, F. Chapter 1—Potato Origin and Production. In Advances in Potato Chemistry and Technology, 2nd ed.; Singh, J., Kaur, L., Eds.; Academic Press: San Diego, CA, USA, 2016; pp. 1–32. ISBN 978-0-12-800002-1. [Google Scholar]
  2. FAOSTAT. Available online: https://www.fao.org/faostat/en/#data (accessed on 19 March 2025).
  3. Sardaro, R.; Faccilongo, N.; Contò, F.; La Sala, P. Adaption Actions to Cope with Climate Change: Evidence from Farmers’ Preferences on an Agrobiodiversity Conservation Programme in the Mediterranean Area. Sustainability 2021, 13, 5977. [Google Scholar] [CrossRef]
  4. Bethke, P.C.; Halterman, D.A.; Jansky, S.H. Potato Germplasm Enhancement Enters the Genomics Era. Agronomy 2019, 9, 575. [Google Scholar] [CrossRef]
  5. Ceccarelli, S.; Grando, S. Return to Agrobiodiversity: Participatory Plant Breeding. Diversity 2022, 14, 126. [Google Scholar] [CrossRef]
  6. Jago, S.; Elliott, K.F.V.A.; Tovar, C.; Soto Gomez, M.; Starnes, T.; Abebe, W.; Alexander, C.; Antonelli, A.; Baldaszti, L.; Cerullo, G.; et al. Adapting Wild Biodiversity Conservation Approaches to Conserve Agrobiodiversity. Nat. Sustain. 2024, 7, 1385–1394. [Google Scholar] [CrossRef]
  7. Kim, Y.-U.; Lee, B.-W. Differential Mechanisms of Potato Yield Loss Induced by High Day and Night Temperatures During Tuber Initiation and Bulking: Photosynthesis and Tuber Growth. Front. Plant Sci. 2019, 10, 300. [Google Scholar] [CrossRef] [PubMed]
  8. Dwelle, R.B.; Kleinkopf, G.E.; Pavek, J.J. Stomatal Conductance and Gross Photosynthesis of Potato (Solanum tuberosum L.) as Influenced by Irradiance, Temperature, and Growth Stage. Potato Res. 1981, 24, 49–59. [Google Scholar] [CrossRef]
  9. Havaux, M. Rapid Photosynthetic Adaptation to Heat Stress Triggered in Potato Leaves by Moderately Elevated Temperatures. Plant Cell Environ. 1993, 16, 461–467. [Google Scholar] [CrossRef]
  10. Muthoni, J.; Kabira, J.N. Potato Production in the Hot Tropical Areas of Africa: Progress Made in Breeding for Heat Tolerance. JAS 2015, 7, 220. [Google Scholar] [CrossRef]
  11. Levy, D.; Veilleux, R.E. Adaptation of Potato to High Temperatures and Salinity—A Review. Amer J. Potato Res. 2007, 84, 487–506. [Google Scholar] [CrossRef]
  12. Tang, R.; Niu, S.; Zhang, G.; Chen, G.; Haroon, M.; Yang, Q.; Rajora, O.P.; Li, X.-Q. Physiological and Growth Responses of Potato Cultivars to Heat Stress. Botany 2018, 96, 897–912. [Google Scholar] [CrossRef]
  13. Singh, B.; Kukreja, S.; Goutam, U. Impact of Heat Stress on Potato (Solanum tuberosum L.): Present. Scenar. Future Opportunities. J. Hortic. Sci. Biotechnol. 2020, 95, 407–424. [Google Scholar] [CrossRef]
  14. Guerriero, V.; Scorzini, A.R.; Di Lena, B.; Iulianella, S.; Di Bacco, M.; Tallini, M. Impact of Climate Change on Crop Yields: Insights from the Abruzzo Region, Central Italy. Sustainability 2023, 15, 14235. [Google Scholar] [CrossRef]
  15. Bocchiola, D.; Nana, E.; Soncini, A. Impact of Climate Change Scenarios on Crop Yield and Water Footprint of Maize in the Po Valley of Italy. Agric. Water Manag. 2013, 116, 50–61. [Google Scholar] [CrossRef]
  16. Bocchiola, D. Impact of Potential Climate Change on Crop Yield and Water Footprint of Rice in the Po Valley of Italy. Agric. Syst. 2015, 139, 223–237. [Google Scholar] [CrossRef]
  17. Giupponi, L.; Leoni, V.; Pedrali, D.; Ceciliani, G.; Bassoli, A.; Borgonovo, G. Morphometric and Phytochemical Characterization and Elevation Effect on Yield of Three Potato Landraces of the Liguri-an Apennines (Northern Italy). J. Appl. Bot. Food Qual. 2020, 93, 234–243. [Google Scholar] [CrossRef]
  18. Di Donato, F.; Di Cecco, V.; Torricelli, R.; D’Archivio, A.A.; Di Santo, M.; Albertini, E.; Veronesi, F.; Garramone, R.; Aversano, R.; Marcantonio, G.; et al. Discrimination of Potato (Solanum tuberosum L.) Accessions Collected in Majella National Park (Abruzzo, Italy) Using Mid-Infrared Spectroscopy and Chemometrics Combined with Morphological and Molecular Analysis. Appl. Sci. 2020, 10, 1630. [Google Scholar] [CrossRef]
  19. Pacifico, D. Upland Italian Potato Quality—A Perspective. Sustainability 2018, 10, 3939. [Google Scholar] [CrossRef]
  20. Selvi, F.; Fiorini, G. Karyology of Hieracium L. Subg. Hieracium (Asteraceae) from Mount Amiata (Central Italy). Int. J. Cytol. Cytosyst. Cytogenet. 1996, 49, 287–299. [Google Scholar] [CrossRef]
  21. Cebulak, T.; Krochmal-Marczak, B.; Stryjecka, M.; Krzysztofik, B.; Sawicka, B.; Danilčenko, H.; Jarienè, E. Phenolic Acid Content and Antioxidant Properties of Edible Potato (Solanum tuberosum L.) with Various Tuber Flesh Colours. Foods 2023, 12, 100. [Google Scholar] [CrossRef]
  22. Loppi, S.; Fedeli, R.; Canali, G.; Guarnieri, M.; Biagiotti, S.; Vannini, A. Comparison of the Mineral and Nutraceutical Profiles of Elephant Garlic (Allium ampeloprasum L.) Grown in Organic and Conventional Fields of Valdichiana, a Traditional Cultivation Area of Tuscany, Italy. Biology 2021, 10, 1058. [Google Scholar] [CrossRef]
  23. Favoretto, P.; Veasey, E.A.; Melo, P.C.T. de Molecular Characterization of Potato Cultivars Using SSR Markers. Hortic. Bras. 2011, 29, 542–547. [Google Scholar] [CrossRef]
  24. Ghislain, M.; Spooner, D.M.; Rodríguez, F.; Villamón, F.; Núñez, J.; Vásquez, C.; Waugh, R.; Bonierbale, M. Selection of Highly Informative and User-Friendly Microsatellites (SSRs) for Genotyping of Cultivated Potato. Theor. Appl. Genet. 2004, 108, 881–890. [Google Scholar] [CrossRef]
  25. d’Aquino, L.; Cozzolino, R.; Nardone, G.; Borelli, G.; Gambale, E.; Sighicelli, M.; Menegoni, P.; Modarelli, G.C.; Rimauro, J.; Chianese, E.; et al. Effects of White and Blue-Red Light on Growth and Metabolism of Basil Grown under Microcosm Conditions. Plants 2023, 12, 1450. [Google Scholar] [CrossRef] [PubMed]
  26. Rahman, M.H.; Azad, M.O.K.; Islam, M.J.; Rana, M.S.; Li, K.; Lim, Y.S. Production of Potato (Solanum tuberosum L.) Seed Tuber under Artificial LED Light Irradiation in Plant Factory. Plants 2021, 10, 297. [Google Scholar] [CrossRef] [PubMed]
  27. Bhardwaj, V.; Kumar, A.; Sharma, S.; Singh, B.; Poonam; Sood, S.; Dipta, B.; Singh, R.; Siddappa, S.; Thakur, A.K.; et al. Analysis of Genetic Diversity, Population Structure and Association Mapping for Late Blight Resistance in Potato (Solanum tuberosum L.) Accessions Using SSR Markers. Agronomy 2023, 13, 294. [Google Scholar] [CrossRef]
  28. Tillault, A.-S.; Yevtushenko, D.P. Simple Sequence Repeat Analysis of New Potato Varieties Developed in Alberta, Canada. Plant Direct 2019, 3, e00140. [Google Scholar] [CrossRef] [PubMed]
  29. Mienie, A.; De, R.J.A. A Comparison of Drought Stress and Heat Stress in the Leaves and Tubers of 12 Potato Cultivars: Research Letter. S. Afr. J. Sci. 2008, 104, 156–159. [Google Scholar]
  30. Bashir, I.; Nardino, M.; Castro, C.M.; Heiden, G. Genotypic Response and Selection of Potato Germplasm Under Heat Stress. Potato Res. 2023, 66, 85–104. [Google Scholar] [CrossRef]
  31. Öztürk Gökçe, Z.N.; Aksoy, E.; Bakhsh, A.; Demirel, U.; Çalışkan, S.; Çalışkan, M.E. Combined Drought and Heat Stresses Trigger Different Sets of miRNAs in Contrasting Potato Cultivars. Funct. Integr. Genom. 2021, 21, 489–502. [Google Scholar] [CrossRef]
  32. Viola, R.; Pelloux, J.; Van Der Ploeg, A.; Gillespie, T.; Marquis, N.; Roberts, A.G.; Hancock, R.D. Symplastic Connection Is Required for Bud Outgrowth Following Dormancy in Potato (Solanum tuberosum L.) Tubers. Plant Cell Environ. 2007, 30, 973–983. [Google Scholar] [CrossRef]
  33. Friedman, M. Chemistry, Biochemistry, and Dietary Role of Potato Polyphenols. A Review. J. Agric. Food Chem. 1997, 45, 1523–1540. [Google Scholar] [CrossRef]
  34. Handayani, T.; Watanabe, K. The Combination of Drought and Heat Stress Has a Greater Effect on Potato Plants than Single Stresses. Plant Soil. Environ. 2020, 66, 175–182. [Google Scholar] [CrossRef]
  35. Mali, S.; Zinta, G. Genome-Wide Identification and Expression Analysis Reveal the Role of Histone Methyltransferase and Demethylase Genes in Heat Stress Response in Potato (Solanum tuberosum L.). Biochim. Biophys. Acta (BBA)—Gen. Subj. 2024, 1868, 130507. [Google Scholar] [CrossRef]
  36. Asim, A.; Gökçe, Z.; Bakhsh, A.; Çayli, İ.; Aksoy, E.; Çalişkan, S.; Çalişkan, M.; Demirel, U. Individual and Combined Effect of Drought and Heat Stresses in Contrasting Potatocultivars Overexpressing miR172b-3p. Turk. J. Agric. For. 2021, 45, 651–668. [Google Scholar] [CrossRef]
  37. Vratsanos, D.; Rossouw, F.T. Heat Shock Protein Synthesis in Solanum tuberosum: An Inter-Cultivar Comparison. S. Afr. J. Sci. 1991, 87, 442–446. [Google Scholar]
  38. Gelmesa, D.; Dechassa, N.; Mohammed, W.; Etissa, E.; Gebre, E.; Monneveux, P. Index-Based Selection of Potato (Solanum tuberosum L.) Genotypes for Tolerance to Soil Moisture and Ambient Heat Stress. Crop Sci. 2024, 64, 1266–1283. [Google Scholar] [CrossRef]
  39. Lawlor, D.W.; Tezara, W. Causes of Decreased Photosynthetic Rate and Metabolic Capacity in Water-Deficient Leaf Cells: A Critical Evaluation of Mechanisms and Integration of Processes. Ann. Bot. 2009, 103, 561–579. [Google Scholar] [CrossRef]
  40. Flexas, J.; Niinemets, Ü.; Gallé, A.; Barbour, M.M.; Centritto, M.; Diaz-Espejo, A.; Douthe, C.; Galmés, J.; Ribas-Carbo, M.; Rodriguez, P.L.; et al. Diffusional Conductances to CO2 as a Target for Increasing Photosynthesis and Photosynthetic Water-Use Efficiency. Photosynth. Res. 2013, 117, 45–59. [Google Scholar] [CrossRef]
  41. Koornneef, M.; Alonso-Blanco, C.; Vreugdenhil, D. Naturally occurring genetic variation in Arabidopsis thaliana. Annu. Rev. Plant Biol. 2004, 55, 141–172. [Google Scholar] [CrossRef]
Horticulturae 11 00415 g001
Figure 1. Temperature and precipitation levels are recorded by a weather station located near the potato cultivation area. (A) Maximum (red) and minimum (blue) temperature in 2023, average of maximum (light red) and minimum (light blue) temperature from 2012 to 2022; (B) millimeters of precipitation in 2023 (red) and average of millimeters of precipitation from 2012 to 2022 (light red).
Figure 1. Temperature and precipitation levels are recorded by a weather station located near the potato cultivation area. (A) Maximum (red) and minimum (blue) temperature in 2023, average of maximum (light red) and minimum (light blue) temperature from 2012 to 2022; (B) millimeters of precipitation in 2023 (red) and average of millimeters of precipitation from 2012 to 2022 (light red).
Horticulturae 11 00415 g001
Horticulturae 11 00415 g002
Figure 2. Scheme of the Microcosmo simulator and a picture of cultivated plants. (A) Schematic of the Microcosmo. The epigeal zone is equipped with temperature, humidity, and LED lighting controllers and a ventilation system; the hypogeal zone is equipped with plastic cylinders containing soil and a temperature controller. (B) Pictures of potato plants grown in one of the Microcosmo simulators. From left: ‘Biancona del Faggeto’, ‘Rossa delle Macchie’, ‘Quarantina delle Macchie’. Drawing in Panel A made with Biorender (https://app.biorender.com/ (accessed on 11 April 2025)).
Figure 2. Scheme of the Microcosmo simulator and a picture of cultivated plants. (A) Schematic of the Microcosmo. The epigeal zone is equipped with temperature, humidity, and LED lighting controllers and a ventilation system; the hypogeal zone is equipped with plastic cylinders containing soil and a temperature controller. (B) Pictures of potato plants grown in one of the Microcosmo simulators. From left: ‘Biancona del Faggeto’, ‘Rossa delle Macchie’, ‘Quarantina delle Macchie’. Drawing in Panel A made with Biorender (https://app.biorender.com/ (accessed on 11 April 2025)).
Horticulturae 11 00415 g002
Horticulturae 11 00415 g003
Figure 3. Temperature settings in the Microcosmo simulator. (A) Temperature in the epigeal chamber; (B) temperature in the hypogeal chamber for both control (CTRL, blue line) and heat stress (HS, orange line) conditions.
Figure 3. Temperature settings in the Microcosmo simulator. (A) Temperature in the epigeal chamber; (B) temperature in the hypogeal chamber for both control (CTRL, blue line) and heat stress (HS, orange line) conditions.
Horticulturae 11 00415 g003
Horticulturae 11 00415 g004
Figure 4. Pictures of potato tubers. From the left: tuber of ‘Biancona del Faggeto’, ‘Rossa delle Macchie’, and ‘Quarantina delle Macchie’.
Figure 4. Pictures of potato tubers. From the left: tuber of ‘Biancona del Faggeto’, ‘Rossa delle Macchie’, and ‘Quarantina delle Macchie’.
Horticulturae 11 00415 g004
Horticulturae 11 00415 g005
Figure 5. A dissimilarity phylogenetic tree was obtained using the Neighbor-Joining method with MEGA7 software. The optimal tree with the sum of branch lengths = 2.50000000 is shown. The tree is drawn to scale (bar at the bottom left), with branch lengths in the same units as those of the evolutionary distances (in our case, the lengths of the alleles) used to infer the phylogenetic tree. The tree shows the genetic differences in the three potato varieties analyzed.
Figure 5. A dissimilarity phylogenetic tree was obtained using the Neighbor-Joining method with MEGA7 software. The optimal tree with the sum of branch lengths = 2.50000000 is shown. The tree is drawn to scale (bar at the bottom left), with branch lengths in the same units as those of the evolutionary distances (in our case, the lengths of the alleles) used to infer the phylogenetic tree. The tree shows the genetic differences in the three potato varieties analyzed.
Horticulturae 11 00415 g005
Horticulturae 11 00415 g006
Figure 6. Starch content (mg g−1) in the pulp and peel tissues of three potato landraces: Biancona del Faggeto, Rossa delle Macchie, and Quarantina delle Macchie. Data are shown as mean ± standard error. Statistically significant differences are indicated by asterisks (** p < 0.01 and *** p < 0.001).
Figure 6. Starch content (mg g−1) in the pulp and peel tissues of three potato landraces: Biancona del Faggeto, Rossa delle Macchie, and Quarantina delle Macchie. Data are shown as mean ± standard error. Statistically significant differences are indicated by asterisks (** p < 0.01 and *** p < 0.001).
Horticulturae 11 00415 g006
Horticulturae 11 00415 g007
Figure 7. Polyphenol and antioxidant levels in potato tubers. (A) Total polyphenols content expressed in mg of equivalent gallic acid per 100 g of pulp and peel tissues of three potato landraces: Biancona del Faggeto, Rossa delle Macchie, and Quarantina delle Macchie. (B) Antioxidant capacity expressed as mmol Fe2+ per 100 g of pulp and peel tissues of three potato landraces. Data are shown as mean ± standard error. Statistically significant differences are indicated by asterisks (**** p < 0.0001).
Figure 7. Polyphenol and antioxidant levels in potato tubers. (A) Total polyphenols content expressed in mg of equivalent gallic acid per 100 g of pulp and peel tissues of three potato landraces: Biancona del Faggeto, Rossa delle Macchie, and Quarantina delle Macchie. (B) Antioxidant capacity expressed as mmol Fe2+ per 100 g of pulp and peel tissues of three potato landraces. Data are shown as mean ± standard error. Statistically significant differences are indicated by asterisks (**** p < 0.0001).
Horticulturae 11 00415 g007
Horticulturae 11 00415 g008
Figure 8. Stomatal conductance and carbon assimilation rate. Stomatal conductance (mmol H2O m−2 s−1) (A) and net carbon assimilation (μmol CO2 m−2 s−1) (B) of three potato landraces (Biancona del Faggeto, Rossa delle Macchie and Quarantina delle Macchie) under control conditions (CTRL, 25 °C) and at the fourth day of heat stress (HS) at 10 am (30 °C) and 3 pm (35 °C). Data are presented as mean ± standard error. Statistically significant differences are indicated by asterisks (* p < 0.05).
Figure 8. Stomatal conductance and carbon assimilation rate. Stomatal conductance (mmol H2O m−2 s−1) (A) and net carbon assimilation (μmol CO2 m−2 s−1) (B) of three potato landraces (Biancona del Faggeto, Rossa delle Macchie and Quarantina delle Macchie) under control conditions (CTRL, 25 °C) and at the fourth day of heat stress (HS) at 10 am (30 °C) and 3 pm (35 °C). Data are presented as mean ± standard error. Statistically significant differences are indicated by asterisks (* p < 0.05).
Horticulturae 11 00415 g008
Table 1. List of primers (forward and reverse) used in SSR genotyping.
Table 1. List of primers (forward and reverse) used in SSR genotyping.
LocusPrimer Sequences 5′ → 3′ (Forward-Fw and Reverse-Rv)MotifAllele Range (Expected Product)Reference
STM1049Fw FAM-CTACCAGTTTGTTGATTGTGGTG
Rv AGGGACTTTAATTTGTTGGACG		(ATA)6184–254[23,24]
STM0019aFw FAM-AATAGGTGTACTGACTCTCAATG
Rv TTGAAGTAAAAGTCCTAGTATGTG		(AT)7(GT)10(AT)4 (GT)5 (GC)4 (GT)4155–241[23,24]
STM1052Fw FAM-CAATTTCGTTTTTTCATGTGACAC
Rv ATGGCGTAATTTGATTTAATACGT		(AT)14 GT (AT)4 (GT)6212–268[24]
STM1104Fw FAM-FTGATTCTCTTGCCTACTGTAATCG
Rv CAAAGTGGTGTGAAGCTGTGA		(TCT)5164–185[23,24]
STM1106Fw FAM-TCCAGCTGATTGGTTAGGTTG
Rv ATGCGAATCTACTCGTCATGG		(ATT)13152–192[23,24]
STM2013Fw FAM-TTCGGAATTACCCTCTGCC
Rv AAAAAAAGAACGCGCACG 		(TCTA)6146–172[23,24]
Table 2. PCR parameters for SSR amplification.
Table 2. PCR parameters for SSR amplification.
DenaturationAmplification (35 Cycles)Extension
Temperature (°C)9595577272
Time5 min30 s30 s45 s7 min
Table 3. Allelic sizes observed at 6 loci (STM1049, STM0019a, STM1052, STM2013, STM1104, STM1106) on 3 potato cultivars (Quarantina delle Macchie, Rossa delle Macchie, and Biancona del Faggeto).
Table 3. Allelic sizes observed at 6 loci (STM1049, STM0019a, STM1052, STM2013, STM1104, STM1106) on 3 potato cultivars (Quarantina delle Macchie, Rossa delle Macchie, and Biancona del Faggeto).
STM1049STM0019aSTM1052STM2013STM1104STM1106
Quarantina delle Macchie176/186193/203206/224139/151166/170154/154
Rossa delle Macchie176/186203/231206/224139/151166/170154/154
Biancona del Faggeto176/176187/203206/224139/151166/170154/154
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Parri, S.; Piccini, C.; Cai, G.; Cantini, C.; Romi, M.; Conti, V. Exploring Heat Stress Response in Genetically and Nutraceutically Diverse Tuscan Potato Landraces Using the Innovative Microcosmo Platform. Horticulturae 2025, 11, 415. https://doi.org/10.3390/horticulturae11040415

AMA Style

Parri S, Piccini C, Cai G, Cantini C, Romi M, Conti V. Exploring Heat Stress Response in Genetically and Nutraceutically Diverse Tuscan Potato Landraces Using the Innovative Microcosmo Platform. Horticulturae. 2025; 11(4):415. https://doi.org/10.3390/horticulturae11040415

Chicago/Turabian Style

Parri, Sara, Chiara Piccini, Giampiero Cai, Claudio Cantini, Marco Romi, and Veronica Conti. 2025. "Exploring Heat Stress Response in Genetically and Nutraceutically Diverse Tuscan Potato Landraces Using the Innovative Microcosmo Platform" Horticulturae 11, no. 4: 415. https://doi.org/10.3390/horticulturae11040415

APA Style

Parri, S., Piccini, C., Cai, G., Cantini, C., Romi, M., & Conti, V. (2025). Exploring Heat Stress Response in Genetically and Nutraceutically Diverse Tuscan Potato Landraces Using the Innovative Microcosmo Platform. Horticulturae, 11(4), 415. https://doi.org/10.3390/horticulturae11040415

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop