CsWRKY46 Is Involved in the Regulation of Cucumber Salt Stress by Regulating Abscisic Acid and Modulating Cellular Reactive Oxygen Species
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Materials and Treatment
2.2. Construction of the Plant Transformation Plasmid and Arabidopsis Transformation
2.3. Measurements of Physiological Indices
2.4. RNA Extraction and qRT-PCR Analysis for Gene Expression
2.5. Statistical Analysis
3. Results
3.1. Effects of Exogenous ABA on the Growth of Cucumber Seedlings Under Salt Stress
3.2. Effects of Exogenous ABA on Electrolyte Leakage and Relative Water Content in Cucumber Leaves Under Salt Stress
3.3. Effect of ABA Pretreatment on Antioxidant Enzyme Activity Under Salt Stress
3.4. Effects of ABA Pretreatment on the Expression of Antioxidant Encoding Genes Under Salt Stress
3.5. CsWRKY46 Gene Response to Salt Stress and ABA in Cucumber Seedlings
3.6. CsWRKY46 Gene Responds to Salt Stress in Cucumber Fruit
3.7. Changes in Physiological Indexes of Transgenic Overexpressing CsWRKY46 Plants Under Salt Stress
3.8. Effects of Salt Stress on Functional Gene Expression in the Downstream of Transgenic Arabidopsis
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
Abbreviations
| ABA | abscisic acid |
| OE | overexpression |
| ROS | reactive oxygen species |
| SA | salicylic acid |
| JA | jasmonic acid |
Appendix A
| Gene | Primer Pairs |
|---|---|
| CsActin | F:TCCACGAGACTACCTACAACTC R:GCTCATACGGTCAGCGAT |
| SOD1 | F:TGGTGAAGATGGCAAGGC R:GACCAATAATGCCACAGGCTAC |
| SOD2 | F:GGTGATGATGGTACTGCTACTTTC R:CAATAACGCCACAGCCTATTCTC |
| SOD3 | F:TCCAGATGGGGTTGCTGA R:TAATGCCGCATCCGATTC |
| SOD4 | F:CAATGCTGATGGAGTAGCAGAG R:GACCGACAACACCACATGC |
| POD1 | F:GTCACCTTGGCATCAGGAC R:ATGTGTGTGCACCTGATAGAGC |
| POD2 | F:GTTAATTTGGCAGGAGGACCG R:TGTGTGTGCACCAGATAAGGC |
| POD3 | F:TGTTTCGTCCAAGGCTGC R:TCCTTGCACGTCGACAGAG |
| POD4 | F:CAATGGGTGTGATGGATCGA R:GTCCTCCCGACAAGAAAACAG |
| POD5 | F:CAATGCACGGGTGTGATG R:CTCCAGACAGCACAACAGACAC |
| CAT1 | F:GCGCGAGAGGTGTGTAATTC R:AGACCTATCAGCCTGAGACCAGA |
| CAT2 | F:GTTAATGCACCTAAGTGTGCTCAC R:ATCGTTCTTGCCTGTCTGATG |
| CAT3 | F:GGTGTGTGATTCCGAAAGAGAA R:ACCTGTCAGCCTGACTCCAATAC |
| AtPYL9 | F:CCTCTTCATCTCGTTTGGTCAC R:CTCTAAGACTGCCGATTTCAGG |
| AtCIPK6 | F: CGGAGTATCGCCGGTGAA R: CGTGTTTCCGGTGGCAAT |
| AtABF4 | F: AACAACTTAGGAGGTGGTGGTC R: CTTCAGGAGTTCATCCATGTTC |
| AtABI5 | F: CAATAAGAGAGGGATAGCGAACGAG R: CGTCCATTGCTGTCTCCTCCA |
| AtRAB18 | F:CAGCAGCAGTATGACGAGTA R:CAGTTCCAAAGCCTTCAGTC |
| AtRD19 | F:TCGGTTTCGTCTGATG R:GACGGATCCAACTTCTGGTG |
| AtDREB2A | F: CGACTGTTGATTCTCTAT R: TTATTCATTCCTGTTGTTAC |
| AtActin | F: GGTAACATTGTGCTCAGTGGTGG R: AACGACCTTAATCTTCATGCTGC |
References
- Castaares, J.L.; Bouzo, C.A.; Laboratory, P.P. Effect of exogenous melatonin on seed germination and seedling growth in melon (Cucumis melo L.) under salt stress. Hortic. Plant J. 2019, 5, 79–87. [Google Scholar] [CrossRef]
- Feng, Q.; Yin, X.; Zhu, M.; Zhang, J.; Liu, W.; Xi, H.; Yu, T.; Yang, L.; Liu, W.; Lu, Z. Overall promotion of integrated management and utilization of saline-alkali land in Northwest China: Conditions, challenges, and recommendations. Bull. Chin. Acad. Sci. 2024, 39, 2060–2073. [Google Scholar]
- Tanveer, A.; Arshad, M.; Ayub, M.; Javaid, M.M.; Yaseen, M. Effetct of temperature, light, salinity, drought stress and seeding depth on germination of Cucumis melo var. agrestis. Pak. J. Weed Sci. Res. 2012, 18, 445–459. [Google Scholar]
- Kusvuran, S.; Ellïaltıoğlu, S.; Yasar, F.; Abak, K. Effects of salt stress on ion accumulation and activity of some antioxidant enzymes in melon (Cucumis melo L.). Int. J. Food Agric. Environ. 2007, 5, 351–354. [Google Scholar]
- Sivritepe, N.; Sivritepe, H.O.; Eris, A. The effects of NaCl priming on salt tolerance in melon seedlings grown under saline conditions. Sci. Hortic. 2003, 97, 229–237. [Google Scholar] [CrossRef]
- Zhang, S.P.; Dong, S.Y.; Guan, J.T.; Miao, H.; Liu, X.P.; Gu, X.F. Research progress on molecular breeding of disease resistance in cucumber. Acta Hortic. Sin. 2025, 1, 1–19. [Google Scholar] [CrossRef]
- Zhang, Y.; Jiang, W.; Yu, H.; Yang, X. Exogenous abscisic acid alleviates low temperature-induced oxidative damage inseedlings of Cucumis sativus. L. Trans. Chin. Soc. Agric. Eng. (Trans. CSAE) 2012, 28, 221–228. [Google Scholar]
- Xiao-Yu, L.I.; Chun-Sheng, M.U. Effects of salt and alkali stresses, and exogenous plant hormones on growth and development of wheat and L. chinensis. Acta Agrestia Sin. 2017, 25, 257. [Google Scholar]
- Wu, N.; Nie, D.D.; Chen, L.; Wang, N.N. Progress of exogenous abscisic acid in salt-alkali stress in rice. Mol. Plant Breed. 2018, 16, 275–279. [Google Scholar]
- Liu, D.R.; Dong, S.Y.; Miao, H.; Bo, K.L.; Zhang, S.P.; Gu, X.F. Research progress on genetic breeding of Cucumber tolerance for salt stress. China Veg. 2021, 07, 14–23. [Google Scholar]
- Cutler, S.R.; Rodriguez, P.L.; Finkelstein, R.R.; Abrams, S.R. Abscisic acid: Emergence of a core signaling network. Annu. Rev. Plant Biol. 2010, 61, 651–679. [Google Scholar] [CrossRef]
- Ke, D.X.; Peng, K.P.; Xia, Y.J.; Zhu, Y.Y.; Zhang, D.D. Cloning of salt-stressed responsive gene GmWRKY6 and salt resistance analysis of transgenic Lotus japonicus. Acta Prataculturae Sin. 2018, 27, 95–106. [Google Scholar]
- Jue, D.W.; Sang, X.L.; Shu, B.; Liu, L.Q.; Wang, Y.C.; Shi, S.Y. Analysis of abiotic stress expression in maize WRKY transcription factor. Guangdong Agric. Sci. 2017, 44, 15–22+12. [Google Scholar]
- Sun, X.C.; Gao, Y.F.; Li, H.R.; Yang, S.Z.; Liu, Y.S. Over-expression of SlWRKY39 leads to enhanced resistance to multiple stress factors in tomato. J. Plant Biol. 2015, 58, 52–60. [Google Scholar] [CrossRef]
- Ling, J.; Jiang, W.; Zhang, Y.; Yu, H.; Xie, B. Genome-wide analysis of WRKY gene family in Cucumis sativus. BMC Genom. 2011, 12, 471. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Yu, H.; Yang, X.; Li, Q.; Ling, J.; Wang, H.; Gu, X.; Huang, S.; Jiang, W. CsWRKY46, a WRKY transcription factor from cucumber, confers cold resistance in transgenic-plant by regulating a set of cold-stress responsive genes in an ABA-dependent manner. Plant Physiol. Biochem. 2016, 108, 478–487. [Google Scholar] [CrossRef] [PubMed]
- Yu, Y.; Wang, L.; Chen, J.; Liu, Z.; Park, C.-M.; Xiang, F. WRKY71 acts antagonistically against salt-delayed flowering in Arabidopsis thaliana. Plant Cell Physiol. 2018, 59, 414–422. [Google Scholar] [CrossRef] [PubMed]
- Clough, S.J.; Bent, A.F. Floral dip: A simplified method for Agrobacterium mediated transformation of Arabidopsis thaliana. Plant J. 1998, 16, 735–743. [Google Scholar] [CrossRef]
- Lee, H.; Guo, Y.; Ohta, M.; Xiong, L.; Stevenson, B.; Zhu, J.K. LOS2, a genetic locus required for cold-responsive gene transcription encodes a bi-functional enolase. EMBO J. 2002, 21, 2692–2702. [Google Scholar] [CrossRef]
- Giannopolitis, C.N.; Ries, S.K. Superoxide Dismutases: I. Occurrence in Higher Plants. Plant Physiol. 1977, 59, 309–314. [Google Scholar] [CrossRef] [PubMed]
- Moerschbacher, B.M.; Noll, U.M.; Flott, B.E.; Reisener, H.J. Lignin biosynthetic enzymes in stem rust infected, resistant and susceptible near-isogenic wheat lines. Physiol. Mol. Plant Pathol. 1988, 33, 33–46. [Google Scholar] [CrossRef]
- Wang, H.; Jiang, Y.; Shi, K.; Zhou, Y.; Yu, J. Effects of light quality on leaf senescence and activities of antioxidant enzymes in cucumber plants. Sci. Agric. Sin. 2010, 43, 529–534. [Google Scholar]
- Diao, Q.; Song, Y.; Qi, H. Exogenous spermidine enhances chilling tolerance of tomato (Solanum lycopersicum L.) seedlings via involvement in polyamines metabolism and physiological parameter levels. Acta Physiol. Plant. 2015, 37, 230. [Google Scholar] [CrossRef]
- Su, H.L.; Zhang, Y.; Xue, H.; Sun, B. Horticultural plant cold resistance mechanism under WRKY transcription factor and fugar interaction. Mol. Plant Breed. 2022, 14, 1–15. [Google Scholar]
- Chen, L.Y.; Li, J.J.; Wang, B.; Du, W.Q.; Gao, M.X.; Liu, H.; Tan, S.Q.; Qiu, L.J.; Wang, X.B. Research progress on the function of WRKY transcription factor response to biotic and abiotic stresses in soybean. J. Plant Genet. Resour. 2022, 23, 323–332. [Google Scholar]
- Fan, H.F.; Guo, S.R.; Duan, J.J.; Du, C.X.; Sun, J. Effects of exogenous NO on cucumber (cucumis sativus L.) seedling growth and glutathione antioxidant enzyme system under NaCl stress. Acta Ecol. Sin. 2008, 6, 2511–2517. [Google Scholar]
- Hniličková, H.; Hniličk, F.; Orsák, M.; Hejnák, V. Effect of salt stress on growth, electrolyte leakage, Na+ and K+ content in selected plant species. Plant Soil Environ. 2019, 65, 90–96. [Google Scholar] [CrossRef]
- Xia, X.J.; Wang, Y.J.; Zhou, Y.H.; Tao, Y.; Mao, W.H.; Shi, K.; Yu, J.Q. Reactive oxygen species are involved in brassinosteroid-induced stress tolerance in cucumber. Plant Physiol. 2009, 150, 801–814. [Google Scholar] [CrossRef]
- Xia, X.J. Physiological and Molecular Mechanisms of Brassinolide Regulating Photosynthesis, Stress Resistance and Pesticide Metabolism in Cucumber. Ph.D. Thesis, Zhe Jiang University, Hangzhou, China, 2009. [Google Scholar]
- Zhu, H.; Jiang, Y.; Guo, Y.; Huang, J.; Zhou, M.; Tang, Y.; Sui, J.; Wang, J.; Qiao, L. A novel salt inducible WRKY transcription factor gene, AhWRKY75, confers salt tolerance in transgenic peanut. Plant Physiol Biochem. 2021, 160, 175–183. [Google Scholar] [CrossRef]
- Rai, G.K.; Mishra, S.; Chouhan, R.; Mushtaq, M.; Chowdhary, A.A.; Rai, P.K.; Kumar, R.R.; Kumar, P.; Perez-Alfocea, F.; Colla, G.; et al. Plant salinity stress, sensing, and its mitigation through WRKY. Front. Plant Sci. 2023, 14, 1238507. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X. Functional Analysis of Maize Transcription Factor ABP9 in ROS Metabolic Balance, ABA Signaling and Abiotic Stress Tolerance in Transgenic Arabidopsis Thaliana. Ph.D. Thesis, Chinese Academy of Agricultural Sciences, Beijing, China, 2008. [Google Scholar]
- Wei, Z.Y. Cloning and Functional Analysis of Wheat NAC Gene Related to ABA Stress. Master’s Thesis, Shandong University, Jinan, China, 2015. [Google Scholar]
- Cai, X.F.; Hu, T.X.; Ye, J.; Zhang, Y.Y.; Li, H.X.; Ye, Z.B. Advances in molecular mechanisms of plant salt stress resistance. J. Huazhong Agric. Univ. 2015, 34, 134–141. [Google Scholar]
- Zhu, D.; Hou, L.; Xiao, P.; Guo, Y.; Deyholos, M.K.; Liu, X. VvWRKY30, a grape WRKY transcription factor, plays a positive regulatory role under salinity stress. Plant Sci. 2019, 280, 132–142. [Google Scholar] [CrossRef] [PubMed]
- Cao, Y.J.; Wei, Q.; Liao, Y.; Song, H.L.; Li, X.; Xiang, C.B.; Kuai, B.K. Ectopic overexpression of AtHDG11 in tall fescue resulted in enhanced tolerance to drought and salt stress. Plant Cell Rep. 2009, 28, 579–588. [Google Scholar] [CrossRef] [PubMed]
- Yu, L.; Wu, S.; Peng, Y.; Liu, R.; Chen, X.; Zhao, P.; Xu, P.; Zhu, J.; Jiao, G.; Pei, Y.; et al. Arabidopsis EDT1HDG11 improves drought and salt tolerance in cotton and poplar and increases cotton yield in the field. Plant Biotechnol. J. 2016, 14, 72–84. [Google Scholar] [CrossRef] [PubMed]
- Ma, Z.; Hu, L. WRKY transcription factor responses and tolerance to abiotic stresses in plants. Int. J. Mol. Sci. 2024, 25, 6845. [Google Scholar] [CrossRef] [PubMed]









| Treatment | Increase in Plant Height (cm) | Increase in Stem Thickness (mm) | Increase in Leaf Number | Fresh Weight (g) | Dry Weight (g) |
|---|---|---|---|---|---|
| CK | 58.78 ± 2.95 a | 0.67 ± 0.09 b | 4 ± 0.25 a | 5.00 ± 0.19 a | 0.94 ± 0.01 a |
| CK+ABA | 62.67 ± 1.83 a | 0.94 ± 0.04 a | 3.67 ± 0.1 a | 5.07 ± 0.47 a | 0.95 ± 0.04 a |
| NaCl | 21.33 ± 2.76 b | 0.64 ± 0.06 b | 2.44 ± 0.11 b | 3.72 ± 0.34 b | 0.86 ± 0.02 a |
| NaCl+ABA | 24.44 ± 3.97 b | 0.58 ± 0.03 b | 2.56 ± 0.09 b | 3.79 ± 0.59 b | 0.93 ± 0.10 a |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bai, X.; Liu, P.; Zhu, F.; Zhang, C.; Pang, H.; Zhang, Y. CsWRKY46 Is Involved in the Regulation of Cucumber Salt Stress by Regulating Abscisic Acid and Modulating Cellular Reactive Oxygen Species. Horticulturae 2025, 11, 251. https://doi.org/10.3390/horticulturae11030251
Bai X, Liu P, Zhu F, Zhang C, Pang H, Zhang Y. CsWRKY46 Is Involved in the Regulation of Cucumber Salt Stress by Regulating Abscisic Acid and Modulating Cellular Reactive Oxygen Species. Horticulturae. 2025; 11(3):251. https://doi.org/10.3390/horticulturae11030251
Chicago/Turabian StyleBai, Xue, Pengyu Liu, Fangyi Zhu, Chong Zhang, Hongbo Pang, and Ying Zhang. 2025. "CsWRKY46 Is Involved in the Regulation of Cucumber Salt Stress by Regulating Abscisic Acid and Modulating Cellular Reactive Oxygen Species" Horticulturae 11, no. 3: 251. https://doi.org/10.3390/horticulturae11030251
APA StyleBai, X., Liu, P., Zhu, F., Zhang, C., Pang, H., & Zhang, Y. (2025). CsWRKY46 Is Involved in the Regulation of Cucumber Salt Stress by Regulating Abscisic Acid and Modulating Cellular Reactive Oxygen Species. Horticulturae, 11(3), 251. https://doi.org/10.3390/horticulturae11030251
