Table Grape Ferritin1 Is Implicated in Iron Accumulation, Iron Homeostasis, and Plant Tolerance to Iron Toxicity and H₂O₂ Induced Oxidative Stress

Round 1

Reviewer 1 Report

Comments and Suggestions for Authors

1.      The theme of the manuscript sounds interesting as it addresses the dynamics of iron in different aspects and related plant stress research in table grape. Despite the relevance of the overall topic, I provide the following recommendations that, in my opinion, deserve the authors’ attention.

2.      Additionally, I recommend that the authors review the English language throughout the manuscript. For example, it would be interesting to include a comma before "and" in the title, and I am not sure if the authors meant H2O2-induced oxidative stress (line 19). I wonder if, as in the sentence "When Fe2+ is excessively stored in the cytoplasm, it will cause Fe2+ toxicity that hindered normal growth and development" (lines 37–38), it is grammatically correct in the scientific writing standard for authors to use "will"; "that being used" (line 42) does not seem accurate; Line 48: Perhaps the authors meant "participants" instead of "participating."

Abstract:

3.      I recommend that the abstract be improved to be more informative to readers by providing more quantitative details of the results obtained.

4.      Furthermore, it would be interesting to explain a little more about the biochemical properties of ferritin.

5.      I also suggest that the authors review whether they truly want to use the term "resistance" instead of "tolerance."

6.      In particular, I was curious to know whether the statement "biological functions of Ferritin proteins in fruit trees are still unknown" (as also mentioned in the introduction – lines 56–57) is indeed factual. For this reason, I recommend that the authors exercise caution in making this claim.

7.      The grammatical and structural construction of the sentence "VvFerritin1 was isolated from ‘Irsay Oliver’ table grape, which was mainly expressed..." sounds somewhat odd, considering that the gene (and not the table grape) was expressed.

8.      The sentence "VvFerritin1 can transport Fe2+ that directly restored the growth of 17 DEY1453 mutant" lacks a brief explanation of the approach the authors used to arrive at this finding.

9.      Overall, it would be better to clarify the abbreviations used in the abstract.

Introduction:

10.  The first paragraph of the introduction seems too short to be presented separately.

11.  Moreover, as seen in the first three citations, I recommend that the authors incorporate references to more recently published articles.

12.  The sentence "there exist two kinds of Fe transport and absorption strategies" (line 30) could be better elaborated to clearly show readers what these strategies are.

13.  A reference is missing in "development [xxx]" (line 37).

14.  Lines 37–38: It would be better to include a reference.

15.  I recommend that biochemical and molecular mechanisms related to this research topic and linked to table grape (Vitis vinifera) be better introduced so that readers can better understand the novelty presented in this study.

Methods:

16.  It is unclear to me why ‘Irsay Oliver’ seedlings (line 67) were selected and why other plant materials or genotypes were not considered to provide greater robustness to the scientific findings.

17.  I recommend that the authors provide justifications for the Fe toxicity treatments and stress treatments selected.

18.  The title and main text create an expectation for results related to oxidative stress; however, the methodology lacks other biochemical and molecular parameters that would provide a fuller picture of the oxidative stress that may actually be occurring.
18.1) In this context, it would be logical to observe scientific findings related to antioxidants that act to counteract the effects of oxidative stress.

19.  Lines 143–144: section 2.7?

20.  Section 2.5 could be better elaborated to provide more details about quality parameters and other information on the primers and respective genes selected.

Results:

21.  Regarding sections 3.1 and 3.2, I honestly expected to see at least one result based on the protein itself to provide  better protein characterization at the biochemical level.

22.  In my opinion, while the other result sections provide preliminary information (considering the absence of functional protein analyses as mentioned above), the section 3.4 is closer to an pratical application, relating to a relevant genetic engineering approach. However, I suggest that the authors consider further complementing the results (e.g., overexpression in non-mutant plants or further analyses with different mutants). In any case, this could be better elaborated upon in future perspectives for studies that the authors may want to pursue to complete the focus on transgenics or genetic engineering.

Author Response

Reviewer 1 

General comments:

The theme of the manuscript sounds interesting as it addresses the dynamics of iron in different aspects and related plant stress research in table grape. Despite the relevance of the overall topic, I provide the following recommendations that, in my opinion, deserve the authors’ attention. Additionally, I recommend that the authors review the English language throughout the manuscript. For example, it would be interesting to include a comma before "and" in the title, and I am not sure if the authors meant H2O2-induced oxidative stress (line 19). I wonder if, as in the sentence "When Fe2+ is excessively stored in the cytoplasm, it will cause Fe2+ toxicity that hindered normal growth and development" (lines 37–38), it is grammatically correct in the scientific writing standard for authors to use "will"; "that being used" (line 42) does not seem accurate; Line 48: Perhaps the authors meant "participants" instead of "participating."

Response: Dear Reviewer, we are honored to receive your feedback, and we sincerely appreciate the valuable comments provided. The manuscript has undergone revisions to address these concerns, involving both edits to the content and clarification of details throughout. In response to your insightful comments, we carefully revised the manuscript and submitted it to the journal. Thank you very much for your encouragement and all generous help during reviewing this manuscript. Looking forward to your further consideration.

For example:

In Line 19, indeed, it was H₂O₂-induced oxidative stress.

When Fe²⁺ is excessively stored in the cytoplasm, it will cause Fe²⁺toxicity that hinder normal growth and development (lines 37-38).

"that being used" (line 42) was changed into “which are being used”

Line 48: "participating" was changed into "participant" .

 

Abstract:
3. I recommend that the abstract be improved to be more informative to readers by providing more quantitative details of the results obtained.
Response: Thank you very much for valuable comments. We carefully revised the abstract and try to provide the readers with more quantitative details, followed as: ‘Heterologous expression of VvFerritin1 in fer1-2 mutant effectively rescued the retarded growth of fer1-2 mutant, under the control condition, Fe toxicity, or H₂O₂ induced oxidative stress, embodied in enhanced fresh weight (126%, 81%, or 48%), total root length (140%, 98%, or 64%), total root surface (70%, 84%, or 120%), and total leaf chlorophyll (56%, 51%, or 53%), respectively’.

Frankly, there are three different seedling lines (wild type, fer1-2 mutant, and fer1-2/35S::Ferritin1 lines, three growth conditions (control, Fe toxicity, and H₂O₂ induced oxidative stress), and at least seven physiological indexes (fresh weight, total root length, total root surface, total leaf chlorophyll, tissue Fe accumulation, and activity of ACO, NiR, and SDH), we find it hard to describe them in quantitative details. Moreover, the total words of the abstract was limited and we cannot fulfill the description in quantitative details. Notably, bar charts of quantitative details were shown in Figure 6. We beg your understanding and further consideration.

4. 
   Furthermore, it would be interesting to explain a little more about the biochemical properties of ferritin.

Response: Many thanks for all your sincere help, we revised the abstract and explained the biochemical properties of ferritin, followed as: ‘Ferritin is the earliest discovered regulator of iron (Fe) metabolism and plays a critical role in maintaining Fe storage and sequestration that contributes to cellular Fe homeostasis and resistance to abiotic stresses’.

5. 
    I also suggest that the authors review whether they truly want to use the term "resistance"instead of "tolerance."

Response: Thank you very much for valuable comments. ‘tolerance’ is more accurate in this study.

6. 
   In particular, I was curious to know whether the statement "biological functions of Ferritin proteins in fruit trees are still unknown"(as also mentioned in the introduction – lines 56–57) is indeed factual. For this reason, I recommend that the authors exercise caution in making this claim.
   Response: Thank you very much for valuable comments. We searched the functional research of plant ferritin protein, and only found that PbFerritin2 was cloned from pear (Zhong et al., 2013), and PpFerritin was isolated in peach (Yang et al., 2023). Biological functions of these Ferritins are still rare. To describe the abstract more accurate, we revised the sentence as follows: ‘biological functions of Ferritin proteins in fruit trees are largely rare’.
7. 
   The grammatical and structural construction of the sentence "VvFerritin1 was isolated from ‘Irsay Oliver’ table grape, which was mainly expressed..."sounds somewhat odd, considering that the gene (and not the table grape) was expressed.

Response: We apologize for our spelling mistakes. We have revised this in the newly submitted manuscript, followed as: ‘VvFerritin1 was isolated from ‘Irsay Oliver’ table grape, and it was mainly expressed’.

8. 
   The sentence "VvFerritin1 can transport Fe2+ that directly restored the growth of 17 DEY1453 mutant"lacks a brief explanation of the approach the authors used to arrive at this finding.

Response: Many thanks for all your sincere help. The original sentence was revised like:’ Complementation of VvFerritin2 in yeast mutant DEY1453 directly restored the mutant growth, and VvFerritin1 can transport Fe²⁺ in yeast’.

 

9. Overall, it would be better to clarify the abbreviations used in the abstract.

Response: Thank you for useful comments, we clarified the abbreviations in the abstract of the newly submitted manuscript, for example: abscisic acid (ABA), aconitase (ACO), nitrite reductase (NiR), and succinate dehydrogenase (SDH).

 

Introduction:

10. The first paragraph of the introduction seems too short to be presented separately.

Response: According to your useful comments, we revised the structure of the introduction section. The first two paragraphs of the original submission were combined into one paragraph.

 

11. Moreover, as seen in the first three citations, I recommend that the authors incorporate references to more recently published articles.

Response: Thank you for your useful comments. The first three citations were changed as following:

1. Kermeur, N.; Pédrot, M., Cabello-Hurtado, F. Iron availability and homeostasis in plants: a review of responses, adaptive mechanisms, and signaling. Methods Mol. 2023, 2642, 49-81. https://doi.org/ 10.1007/978-1-0716-3044-0_3.
2. Montejano-Ramírez, V., Valencia-Cantero,Cross-talk between iron deficiency response and defense establishment in plants. Int. J. Mol. Sci. 2023, 24(7), 6263. https://doi.org/10.3390/ijms24076236
3. Song, Z.Z.; Lin, S.Z.; Fu, J.Y.; Chen, Y.H.; Zhang, H.X.; Li, J.Z.; Liang, M.X. Heterologous expression of ISU1 gene from Fragaria vesca enhances plant tolerance to Fe depletion in Arabidopsis. Plant Physiol. Biochem. 2022, 184, 65-74. https://doi.org/10.1016/j.plaphy.2022.05.010

 

12. The sentence "there exist two kinds of Fe transport and absorption strategies"(line 30) could be better elaborated to clearly show readers what these strategies are.

Response: We revised the description in the newly submitted manuscript as follows: ‘In higher plants, there exist two kinds of Fe transport and absorption strategies, Strategy Ⅰ and Strategy Ⅱ, especially under Fe deficiency conditions [5-9]. In dicotyle-dons and non-gramineous monocotyledons (Strategy Ⅰ), Fe3+ is reduced to Fe2+ through ferric reduction oxide (FRO), and Fe2+ is absorbed by iron regulated transporters (IRT). In gramineous plants (Strategy Ⅱ), Fe3+ is absorbed through Fe3+ chelator phytosideo-phore (PS) pathway that depends on yellow stripe (YS) or yellow stripe-like (YSL) transporters [5,8,9]’.

 

13. A reference is missing in "development [xxx]"(line 37).

Response: We apologize for our spelling mistakes. It was revised into ‘and development [5-10]’.

 

14. Lines 37–38: It would be better to include a reference.

Response: According to your useful suggestion, we added references in the revised manuscript. ‘When Fe2+ is excessively stored in the cytoplasm, it will cause Fe2+toxicity that hinder normal growth and development [5-12]’.

 

15. I recommend that biochemical and molecular mechanisms related to this research topic and linked to table grape (Vitis vinifera) be better introduced so that readers can better understand the novelty presented in this study.

Response: Thank you for valuable comments. We revised the manuscript as follows: ‘Table grape (Vitis vinifera) is an important fruit crop, and its genome has been published [18]. Fe as the highest amount of trace elements in grape trees correlates with grape quality and yield [4-5]. Grapes are highly sensitive to Fe deficiency, and when the soil Fe content is low, the young leaves of new shoots are the first to show chlorosis and yellowing. Due to nutrient deficiency in grapevines, they suffer from malnutrition, slow growth of new shoots, weakened tree vigor, and reduced fruit size, which greatly affects the quality and yield of grapes [4-5]. However, molecular studies towards Fer-ritin proteins in grape are unclear’.

 

Methods:

16. It is unclear to me why ‘Irsay Oliver’ seedlings (line 67) were selected and why other plant materials or genotypes were not considered to provide greater robustness to the scientific findings.

Response: Frankly, ‘Irsay Oliver’ table grape is quite popular in many provinces of China, including Shandong, Beijing, and Jiangsu, and this is a typical diploid table-grape cultivar, and we successfully obtained many tissue-cultured seedlings of ‘Irsay Oliver’. The last but not the least important is that we successfully cloned 4 Ferritin family genes from ‘Irsay Oliver’ and submitted to GenBank of NCBI to apply for Accession No. Meanwhile, other plant materials or genotypes could be considered to provide greater robustness to the scientific findings in the future.

 

17. I recommend that the authors provide justifications for the Fe toxicity treatments and stress treatments selected.

Response: The normal range of iron content required by different plants is between 10-50 μmol∙L^-1 (Liang et al., 2014, Plant Cell and Environment; Qin et al., 2015, Plant Cell Report; Song et al., 2013, Plant Cell and Tissue Organ Culture). According to fruit tree seedlings, 500 μmol∙L^-1 is usually considered to be Fe toxicity stress threshold in wine grape seedlings (Song et al., 2024, Plant Growth Regulation); mango seedlings (Zhang et al., 2022, Plant Growth Regulation), and peach seedlings (Song et al., 2013, Plant Cell and Tissue Organ Culture)

 

18. The title and main text create an expectation for results related to oxidative stress; however, the methodology lacks other biochemical and molecular parameters that would provide a fuller picture of the oxidative stress that may actually be occurring.

Response: Many thanks for your valuable comments. In this study, we only carried out H₂O₂ treatment. We fully agree with you that lacks other biochemical and molecular parameters. According to your valuable suggestion, we revised the description of ‘H₂O₂ stress’, and heterologous expression of VvFerritin1 in fer1-2 mutant effectively rescued the retarded growth of fer1-2 mutant, under the control condition, Fe toxicity, or H2O2 stress, embodied in enhanced fresh weight (126%, 81%, or 48%), total root length (140%, 98%, or 64%), total root surface (70%, 84%, or 120%), and total leaf chlorophyll (56%, 51%, or 53%), respectively.

18.1) In this context, it would be logical to observe scientific findings related to antioxidants that act to counteract the effects of oxidative stress.

Response: Thank you for these useful comments. Combining the answer to the previous question, we fully agree with your valuable suggestion and revised the description of ‘H₂O₂ stress’. In this study, we just carried out H₂O₂ treatment and did not conduct any scientific findings related to antioxidants. To be honest, we want to emphasize that overexpression of VvFerritin1 gene enhances the resistance of transgenic lines to H2O2 stress, thus avoiding the notion of oxidative stress.

 

19. Lines 143–144: section 2.7?

Response: We apologize for our spelling mistakes. It was revised into ‘section 2.7’.

 

20. Section 2.5 could be better elaborated to provide more details about quality parameters and other information on the primers and respective genes selected.

Response: Thank you for valuable comments. We revised the Section 2.5 carefully in the newly submitted manuscript, as follows: ‘Specific primer pairs of VvFerritin1 (forward: GATCCCCAGTTGACAGATTT, reverse: CCACCCTCTTCGAGGAGCAT) was designed via the NCBI/Primer-BLAST on-line server. qRT-PCR analysis was executed on 7500 Real Time PCR System (Ap-plied Biosystems, New York, USA), labelled with SYBR Premix Ex Taq (TaKaRa, Kyoto, Japan). The Ubiquitin of wine grape was used as the internal control as described in previous studies [19,23]. To calculate the concentration of the starting template and RT-qPCR efficiency for each cDNA sample, the linear regression of the log (fluores-cence) per cycle number data was used by taking the logarithm on both sides of an equation as follows: log (Nc) = log (No) + log(Eff) × C, where Nc is fluorescence, No is the initial concentration of a template, Eff is efficiency, and C is the cycle number. The rel-ative expression level of VvFerritin1 was presented after normalization to the internal control from three independent biological repeats, each with four technical replicates’.

 

Results:

21. Regarding sections 3.1 and 3.2, I honestly expected to see at least one result based on the protein itself to provide better protein characterization at the biochemical level.

Response: Many thanks for your valuable comments. In the revised manuscript, the tertiary structure of VvFerri-tin1, AtFerritin1, PpFerritin1, and MeFerritin1 was predicted utilizing Phyre2 online server (http://www.sbg.bio.ic.ac.uk/phyre2/html/page.cgi? Predicting using id=index). In particular, four Ferritin homologous proteins (VvFerritin1, AtFerritin1, PpFerritin1, and MeFerritin1) exhibited similar tertiary structure, indicating that they may possess similar biological functions. Therefore, this study helps to reveal the biological function of Ferritin homologues from Euphorbiaceae and Vitis plants.

 

Figure 2. Tertiary structure prediction of Ferritin homologous proteins. The tertiary structure of VvFerritin1, AtFerritin1, PpFerritin1, and MeFerritin1 was predicted utilizing Phyre2 online server (http://www.sbg.bio.ic.ac.uk/phyre2/html/page.cgi? Predicting using id=index).

 

22. In my opinion, while the other result sections provide preliminary information (considering the absence of functional protein analyses as mentioned above), the section 3.4 is closer to an pratical application, relating to a relevant genetic engineering approach. However, I suggest that the authors consider further complementing the results (e.g., overexpression in non-mutant plants or further analyses with different mutants). In any case, this could be better elaborated upon in future perspectives for studies that the authors may want to pursue to complete the focus on transgenics or genetic engineering.

Response: Many thanks for your valuable suggestion. Considering the deadline of the revision work, we probably find it hard to further complement the results (e.g., overexpression in non-mutant plants or further analyses with different mutants) during one week. Actually, we fully appreciate your sincere help and valuable comments, we learnt a lot from you and the other Reviewer. Hopefully, these further complementing work will conduct in our group and share with you and readers of Horticulturae soon.

Author Response File: Author Response.pdf

Reviewer 2 Report

Comments and Suggestions for Authors

Dear Authors,

here are specific comments to improve your manuscript submitted to Horticulturae (ISSN 2311-7524:

Abstract

Line 21: Expand abbreviations ACO, NiR, and SDH as aconitase, nitrite reductase, and succinate dehydrogenase, respectively.

Lines 22-23: Revise the final sentence to: “This study provides insights into the molecular mechanisms of Fe storage and homeostasis in ‘Irsay Oliver’ table grape.”

Introduction

Expand the background to include specific limitations of prior studies on Ferritin proteins in perennial fruit crops.

Clearly define acronyms (e.g., Fe, ROS) at their first mention.

Ensure underlined characters in Lines 34 and 39-40 are corrected.

Line 37: Add the missing reference.

Delete Lines 63-64, as they are redundant.

Replace "grape trees" with "vines" throughout the manuscript.

Clarify the use of the term "elite" in Line 61, or remove it for consistency.

Materials and Methods

Statistical Analysis: Specify the software used (e.g., IBM SPSS or similar) and the exact statistical tests (e.g., Fisher’s LSD) for significance determination.

Primer Design: Include a brief explanation of the source of VvFerritin1 reference sequences and the rationale for primer selection.

qRT-PCR: Provide more detail on the number of biological and technical replicates.

Results

Expression Patterns: Clarify why VvFerritin1 expression is unresponsive to Fe depletion but induced under Fe toxicity and H2O2 stress. Speculative reasons could be briefly mentioned.

Figures: Ensure all figures have comprehensive captions explaining abbreviations and statistical annotations.

Discussion

Compare the findings with homologs in other species, such as AtFerritin1 in Arabidopsis, to provide a broader context.

Expand on the potential agricultural applications, such as enhancing Fe utilization efficiency and stress resilience in table grape cultivation.

Conclusion

Highlight the translational implications more explicitly, e.g., “The results provide a foundation for genetic improvement programs aimed at enhancing stress tolerance and nutrient use efficiency in table grape cultivars.”

Language and Style

The manuscript’s language is generally clear but requires minor grammatical corrections. For instance:

“Expression of VvFerritin1 was quite distinct among different tissues” can be rephrased for precision.

Avoid redundancy, such as repeating “tissue Fe concentration, ACO activity, NiR activity, and SDH activity” unnecessarily.

Kind regards.

• •  

 

Author Response

Reviewer 2 

Abstract

1. Line 21: Expand abbreviations ACO, NiR, and SDH as aconitase, nitrite reductase, and succinate dehydrogenase, respectively.

Response: Many thanks for valuable suggestion. We clarified the abbreviations in the abstract of the newly submitted manuscript, followed as: abscisic acid (ABA), aconitase (ACO), nitrite reductase (NiR), and succinate dehydrogenase (SDH).

 

2. Lines 22-23: Revise the final sentence to: “This study provides insights into the molecular mechanisms of Fe storage and homeostasis in ‘Irsay Oliver’ table grape.”

Response: Thank you so much for useful suggestion. We revised the final sentence in the newly submitted

manuscript, as follows: “This study provides insights into the molecular mechanisms of Fe storage and

homeostasis in ‘Irsay Oliver’ table grape.”

 

Introduction

3. Expand the background to include specific limitations of prior studies on Ferritin proteins in perennial fruit crops.

Response: Thank you very much for valuable comments. Accoeding to functional studies of Ferritin proteins, most of the reports are focused on the model Arabidopsis.        Recently, Ferritin family genes have been identified in cut rose (Liu et al., 2017), cassava (Ghislain et al., 2019), and peach (Yang et al., 2023). Honestly, biological functions of Ferritin proteins in perennial fruit crops are largely rare. We searched the functional research of plant ferritin protein, and only found that PbFerritin2 was cloned from pear (Zhong et al., 2013), and PpFerritin was isolated in peach (Yang et al., 2023), which were discussed in details in the Discussion.

 

4. Clearly define acronyms (e.g., Fe, ROS) at their first mention.

Response: Thank you for useful suggestion. We defined the acronyms for the first appearance in the revised manuscript.

 

5. Ensure underlined characters in Lines 34 and 39-40 are corrected.

Response: We apologize for our spelling mistakes. There underlines should be deleted.

 

6. Line 37: Add the missing reference.

Response: We apologize for our spelling mistakes. It was revised into ‘and development [5-10]’.

 

7. Delete Lines 63-64, as they are redundant.

Response: Thank you for useful suggestion, and we delete the redundant sentences.

 

8. Replace "grape trees" with "vines" throughout the manuscript.

Response: According to your useful suggestion, "grape trees" were replaced with "vines" throughout the manuscript.

 

9. Clarify the use of the term "elite" in Line 61, or remove it for consistency.

Response: According to your useful suggestion, "elite" was deleted in the newly submitted manuscript.

 

Materials and Methods

10. Statistical Analysis: Specify the software used (e.g., IBM SPSS or similar) and the exact statistical tests (e.g., Fisher’s LSD) for significance determination.

Response: Many thanks for valuable suggestion. We revised the description of Statistical Analysis in the newly submitted manuscript, as follows: ‘Significant differences were analyzed using IBM SPSS Statistics 23 (Armonk, New York, USA) followed by Fisher’s LSD test method at P < 0.01 level’.

 

11. Primer Design: Include a brief explanation of the source of VvFerritin1 reference sequences and the rationale for primer selection.

Response: Both Arabidopsis Ferritin1 [1,22] and peach Ferritin1 [17] were taken as reference sequences, and one putative Ferritin family gene (VvFerritin1) was screened throughout the Grape Genome Database.  For the rationale for primer selection, NCBI/Primer-BLAST will design specific primers based on the sequence you input, and they will be unique in the target database (selected in the specificity check area). The first two databases are annotated data by experts, which can provide more accurate results. Especially, when you use NCBI reference sequences as templates and reference sequence databases as standards to design primers, Primer BLAST can design specific primers that only amplify a specific splicing variant gene. 

 

12. qRT-PCR: Provide more detail on the number of biological and technical replicates.

Response: Many thanks for useful comments. We revised the description of qRT-PCR analysis, as follows: ‘qRT-PCR analysis was executed on 7500 Real Time PCR System (Applied Biosystems, New York, USA), labelled with SYBR Premix Ex Taq (TaKaRa, Kyoto, Japan). The Ubiquitin of wine grape was used as the internal control as described in previous studies [19,23]. To calculate the concentration of the starting template and RT-qPCR efficiency for each cDNA sample, the linear regression of the log (fluorescence) per cy-cle number data was used by taking the logarithm on both sides of an equation as fol-lows: log (Nc) = log (No) + log(Eff) × C, where Nc is fluorescence, No is the initial con-centration of a template, Eff is efficiency, and C is the cycle number. The relative expression level of VvFerritin1 was presented after normalization to the internal control from three independent biological repeats, each with four technical replicates’.

 

Results

13. Expression Patterns: Clarify why VvFerritin1 expression is unresponsive to Fe depletion but induced under Fe toxicity and H2O2 stress. Speculative reasons could be briefly mentioned.

Response: Frankly, Ferritin plays a crucial role in maintaining cellular Fe balance and protecting plants against oxidative damage [9-13]. In Arabidopsis., 4 ferritin family genes (At-Fer1-AtFer4) have been identified. Notably, AtFerritin1 is enhanced by Fe toxicity and H2O2 treatment, AtFerritin2 is increased by abscisic acid (ABA), and AtFerritin3 is in-duced by Fe toxicity [13-15]. AtFerritin proteins participate in the regulation of intra-cellular Fe2+ storage and sequestration, and maintaining plant tolerance to undesired abiotic stresses, including water loss [14], drought [16], and reactive oxygen species (ROS) [13,14,18].  

In this study, VvFerritin1 expression is unresponsive to Fe depletion but induced under Fe toxicity and H2O2 stress. While in pear, PbFerritin2 was reduced by Fe deficiency [27]. However, VvFerritin1 was not responsive to Fe depletion, similar to that of Ferritin genes in peach seedlings, indicating that VvFerritin1 may be active in table grape under excessive Fe status, but not Fe deficiency conditions. Moreover, AtFerritin1 and AtFerritin3 in Arabidopsis [22] and PpFerritin1 and PpFerritin3 in peach [17] were induced by excessive Fe and H2O2 stress, and RhFer1 in cut rose [14] and AtFerritin2 in Arabidopsis [22] were induced by ABA treatment. Consistently, VvFerritin1 was responsive to Fe toxicity, H2O2 stress, and ABA treatment, which was mainly induced, implying that VvFerritin1 may be implicated in the Fe uptake/transport in grape roots under adverse environ-mental stresses, thus maintaining Fe accumulation and homeostasis, so as to secure Fe-dependent basic metabolic activities. The abrupt increase of VvFerritin1 expression may be one of the crucial indicators that vines respond to such environmental stresses. Favorably, we mentioned these comments in the Discussion section. Thank you for your sincere help.

 

14. Figures: Ensure all figures have comprehensive captions explaining abbreviations and statistical annotations.

Response: Thank you for useful comments. We checked all captions and ensure that all figures have comprehensive captions explaining abbreviations and statistical annotations.

 

Discussion

15. Compare the findings with homologs in other species, such as AtFerritin1 in Arabidopsis, to provide a broader context.

Response: Combining the answer to the previous question, we revised the Discussion section in comparation with homologs in other species. Frankly, Ferritin plays a crucial role in maintaining cellular Fe balance and protecting plants against oxidative damage [9-13]. In Arabidopsis., 4 ferritin family genes (At-Fer1-AtFer4) have been identified. Notably, AtFerritin1 is enhanced by Fe toxicity and H2O2 treatment, AtFerritin2 is increased by abscisic acid (ABA), and AtFerritin3 is in-duced by Fe toxicity [13-15]. AtFerritin proteins participate in the regulation of intra-cellular Fe2+ storage and sequestration, and maintaining plant tolerance to undesired abiotic stresses, including water loss [14], drought [16], and reactive oxygen species (ROS) [13,14,18]. 

In this study, VvFerritin1 expression is unresponsive to Fe depletion but induced under Fe toxicity and H2O2 stress. While in pear, PbFerritin2 was reduced by Fe deficiency [27]. However, VvFerritin1 was not responsive to Fe depletion, similar to that of Ferritin genes in peach seedlings, indicating that VvFerritin1 may be active in table grape under excessive Fe status, but not Fe deficiency conditions. Moreover, AtFerritin1 and AtFerritin3 in Arabidopsis [22] and PpFerritin1 and PpFerritin3 in peach [17] were induced by excessive Fe and H2O2 stress, and RhFer1 in cut rose [14] and AtFerritin2 in Arabidopsis [22] were induced by ABA treatment. Consistently, VvFerritin1 was responsive to Fe toxicity, H2O2 stress, and ABA treatment, which was mainly induced, implying that VvFerritin1 may be implicated in the Fe uptake/transport in grape roots under adverse environ-mental stresses, thus maintaining Fe accumulation and homeostasis, so as to secure Fe-dependent basic metabolic activities. The abrupt increase of VvFerritin1 expression may be one of the crucial indicators that vines respond to such environmental stresses. Favorably, we mentioned these comments in the Discussion section. Thank you for your sincere help.

 

16. Expand on the potential agricultural applications, such as enhancing Fe utilization efficiency and stress resilience in table grape cultivation.

Response: Many thanks for valuable comments. In the revised manuscript, we mentioned the potential agricultural applications that followed as: ‘These findings favor the proposition that Ferritin transporters are implicated in regu-lating Fe homeostasis and H2O2 induced stress in plants, especially under undesired abiotic stresses [14-17]. Nonetheless, this study provides a foundation for genetic im-provement programs aimed at enhancing stress tolerance and nutrient use efficiency in table grape cultivar’.

 

Conclusion

17. Highlight the translational implications more explicitly, e.g., “The results provide a foundation for genetic improvement programs aimed at enhancing stress tolerance and nutrient use efficiency in table grape cultivars.”

Response: Thank you so much for valuable comments. We revised the conclusion section with the help of your suggestion.

 

Language and Style

18. The manuscript’s language is generally clear but requires minor grammatical corrections. For instance:

“Expression of VvFerritin1 was quite distinct among different tissues” can be rephrased for precision.

Avoid redundancy, such as repeating “tissue Fe concentration, ACO activity, NiR activity, and SDH activity” unnecessarily.

Response: We are honored to receive your feedback quickly and deeply appreciate the valuable comments from you and the other reviewers. The manuscript has undergone revisions to address these concerns, involving both edits to the content and clarification of details throughout. We paid our attention to the language, with the help of colleagues from the Department of Plant Science, University of Cambridge. Thank you so much for all your sincere help and consideration during the past days.

 

Author Response File: Author Response.pdf

Round 2

Reviewer 1 Report

Comments and Suggestions for Authors

The manuscript has been improved. I have no more comments.