Next Article in Journal
Evaluation of Pollination Potential in ‘Jinfeng’ Kiwifruit Seedling Male Plants Based on Floral Traits and Pollen Viability
Next Article in Special Issue
Integrated Physiological and Transcriptomic Analyses Reveal the Mechanism of Salt Acclimation-Induced Salinity Tolerance in Tomato Seedlings
Previous Article in Journal
Impact of Light Spectra and Substrate Composition on the Bioefficiency, Nutritional Content, and Morphology of Oyster Mushrooms
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Physiological Response and Transcriptome Analysis of Waxy Near-Isogenic Lines in Chinese Cabbage (Brassica rapa L. ssp. pekinensis) Under Drought Stress

Shandong Key Laboratory of Bulk Open-field Vegetable Breeding, Ministry of Agriculture and Rural Affairs Key Laboratory of Huang Huai Protected Horticulture Engineering, Institute of Vegetables, Shandong Academy of Agricultural Sciences, Jinan 250100, China
*
Author to whom correspondence should be addressed.
Horticulturae 2025, 11(12), 1431; https://doi.org/10.3390/horticulturae11121431
Submission received: 5 October 2025 / Revised: 17 November 2025 / Accepted: 18 November 2025 / Published: 26 November 2025

Abstract

To identify key genes involved in drought stress response among Chinese cabbage materials with different drought resistance, a pair of waxy near-isogenic lines (NILs) of Chinese cabbage were used as materials, and a 10% polyethylene glycol (PEG) 6000 solution was employed to simulate drought stress. A comparative analysis of phenotypes, physiology, and transcriptomes under drought stress was conducted in this study. Compared with the non-waxy material T065-2, the waxy material T065-1 exhibited 5068, 5512, 5210, and 5875 significantly differentially expressed genes (DEGs) at 0, 6, 12, and 24 h under drought stress, respectively. These DEGs were primarily enriched in “response to oxygen levels” and “secondary metabolite biosynthesis” biological processes and “biosynthesis of secondary metabolites” and “glucosinolate biosynthesis” pathways. Combined with gene function annotation, 26 genes related to the abscisic acid (ABA) signaling pathway (e.g., PYL2, PYL6, SnRK2.5, and SnRK2.10), 63 genes associated with wax synthesis and transport (e.g., MAH1, CER3a, ABCG25, and LTPG1), and 84 transcription factor genes (e.g., ERF, WRKY, and MYB) were identified, all of which showed significant differential expression in the waxy NILs of Chinese cabbage, potentially participating in drought stress response. The reliability of the transcriptomic analysis was validated using qRT-PCR. These findings provide a crucial theoretical foundation for exploring drought-resistant molecular markers and editing targets in Chinese cabbage, significantly accelerating the breeding of superior drought-resistant varieties.

1. Introduction

Drought is one of the primary abiotic stresses limiting plant growth and crop yield [1,2]. Analyzing the mechanism of drought’s impact on plant growth [3], clarifying the molecular regulatory network of plants in response to drought stress [4], and identifying key drought-resistant genes [5] can not only enrich and improve the theoretical framework of plant stress biology but also provide important theoretical support and gene reserves for the drought-resistant molecular design breeding of crops. During the evolutionary transition from aquatic to terrestrial environments, plants developed a series of complex physiological and morphological adaptations to cope with drought stress [6,7], including key drought-resistant traits such as cuticular wax synthesis [8,9], stomatal development and movement [10,11], root growth [12,13,14], and reproductive development [15,16]. Cuticular wax, a hydrophobic layer covering the above-ground parts of plants, is one of the critical barriers evolved through long-term adaptation to the external environment [17,18].
As the primary barrier against drought, cuticular wax is mainly composed of very-long-chain fatty acids and their derivatives [19,20]. It effectively restricts non-stomatal water loss by altering its physicochemical properties, increasing the wax content and modifying the wax composition. This in turn reduces surface water evaporation and enhances plant drought resistance [21,22]. Studies have shown that the ultra-structure and thickness of cuticular wax effectively reduce water evaporation, thereby enhancing plant drought tolerance [23]. In rice Wilted Dwarf and Lethal 1 (WDL1) mutants, the fragmentation and aggregation of wax crystals on leaf surfaces led to a 2~3-fold higher cuticular transpiration rate compared to the wild type, accompanied by decreased drought tolerance [24]. Over-expression of drought-stress-induced MYB96 [25,26] and MdMIEL1/MdPIAL2 protein complexes [27] in apple and Arabidopsis increased the cuticular wax content on leaves, thereby enhancing plant drought tolerance. Cuticular wax is critical to plant transpiration, influenced both by its physicochemical properties and content, as well as the varying effects of different wax components on water transpiration. Wax ester synthase/diacylglycerol acyltransferase genes WSD1, WSD6, and WSD7 were highly induced under drought treatment, leading to a significant increase in wax esters in Arabidopsis leaves, which contributed to improved drought tolerance [28]. Additionally, the biosynthesis of alkanes and aldehydes in the cuticular wax of wheat and Arabidopsis leaves can enhance their drought tolerance [25,29].
Chinese cabbage (Brassica rapa L. ssp. pekinensis) has an extremely high water requirement during cultivation. Drought is a major environmental factor restricting its growth and development; therefore, breeding drought-resistant varieties is one of the important means to improve water use efficiency and ensure yield. Currently, research on Chinese cabbage wax mainly focuses on the identification of wax-related genes [30] and map-based cloning [31,32,33,34,35,36]. However, there are few reports on the gene expression patterns affected by drought stress in Chinese cabbage and how wax-related genes respond to drought stress. Transcriptomic analysis is a powerful tool that enables researchers to identify genes and pathways activated or repressed during plant stress response [37,38]. With the long-read advantage of third-generation sequencing technology, the assembly quality of the Chinese cabbage genome has been significantly improved, and the gene annotation of Chiifu V3.5 is more accurate and comprehensive. In this study, a reference-based transcriptomic approach was employed for a pair of waxy NILs to investigate the phenotypic and physiological changes in Chinese cabbage under drought treatment. Additionally, transcriptome analysis was employed to identify key genes involved in drought stress response across different drought-resistant materials, providing potential targets for further enhancing the drought resistance of Chinese cabbage through gene editing.

2. Materials and Methods

2.1. Plant Materials and Drought Treatment

Near-isogenic lines, namely the waxy line T065-1 and the non-waxy line T065-2 [30], were used as research materials. Their seeds were sown separately in plug trays filled with nutrient soil and cultured in an artificial climate chamber (Hangzhou, China) with the following conditions: temperature of 25 °C, light intensity of 35,000 lux, relative humidity of 60%, and a photoperiod of 16 h light–8 h dark. When the seedlings reached the three-leaf-one-heart stage, all were transferred to 100× Hoagland nutrient solution for hydroponic cultivation. The control group continued hydroponic culture in Hoagland solution for 24 h, while the treatment group was subjected to drought stress by adding a 10% polyethylene glycol (PEG) 6000 solution [39] for 6, 12, and 24 h. After 24 h, all leaves from both control and treated seedlings were collected simultaneously. Each sample consisted of three individual plants per biological replicate, with a total of three biological replicates per group. All samples were immediately frozen in liquid nitrogen and then stored at –80 °C for subsequent analysis.

2.2. Relative Water Content

Relative water content (RWC) was assessed using the first true leaf, with 12 biological replicates, for different materials under various drought stress conditions. The RWC was determined using the formula RWC (%) = [(FW − DW)/(TW − DW)] × 100, where FW = fresh weight, DW = dry weight, and TW = turgid weight [40].

2.3. Determination of Physiological Index

Superoxide dismutase (SOD, U/g FW) activity was determined using the photochemical reduction method of nitroblue tetrazolium (NBT) according to Dhindsa et al. [41] with absorbance measured at 450 nm. Peroxidase (POD, U/g FW) activity was measured using the guaiacol method as described by Hammerschmidt et al. [42] at 470 nm. Malondialdehyde (MDA, mmol/g) content was assessed via the thiobarbituric acid (TBA) colorimetric method following Guidi et al. [43] with measurements taken at 532 nm and 600 nm. Proline (Pro, μg/g) content was determined using the sulfosalicylic acid-acidic ninhydrin colorimetric method based on Bates et al. [44] at 470 nm. All detections were performed with three biological replicates.

2.4. RNA Extraction, DNB Sequencing, and Identification of DEGs

Total RNA was individually extracted from T065-1 (CK, 6, 12, and 24 h) and T065-2 (CK, 6 h, 12 h, and 24 h) Chinese cabbage leaves using Trizol reagents (Invitrogen, Waltham, MA, USA) following the manufacturer’s instructions. RNA quality was assessed using a Qubit 4.0 fluorometer (Invitrogen, Waltham, MA, USA) and a Qsep400 bioanalyzer (Bioptic Inc., Taipei City, China) with the RNA concentration ranging from 39 to 93 ng/μL. A total of 24 cDNA libraries were constructed following standard protocols from the eight samples with three biological replicates per sample. The libraries were initially quantified using a Qubit 2.0 fluorometer (Invitrogen, Carlsbad, CA, USA), and their insert sizes were determined using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA) and quantified via the Q-PCR method. The cDNA libraries were sequenced on the DNB sequencing platform by Metware Biotechnology Co., Ltd. (Wuhan, China). All raw RNA-Seq data were deposited in the NCBI database (https://www.ncbi.nlm.nih.gov) with BioProject accession number PRJNA1337933.
A differential expression analysis between sample groups was performed using DESeq2 software1.22.1 [45]. The Benjamin–Hochberg method was used to correct the multiple hypothesis test probability (p value) to obtain the false discovery rate (FDR). The screening criteria for DEGs were |log2Fold Change| ≥ 1 and FDR < 0.05. A Gene Ontology (GO) enrichment analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis were conducted for the identified DEGs.

2.5. Identification of Key Candidate Genes in Waxy/Non-Waxy Chinese Cabbage in Response to Drought Stress

Important metabolic pathways were screened in the comparative groups of waxy T065-1 and non-waxy T065-2 under drought stress by GO enrichment and KEGG pathway analyses. Key candidate genes involved in drought stress response in waxy NILs of Chinese cabbage were determined.

2.6. qPCR Validation of DEGs

Total RNA was extracted using the Trizol reagent (Invitrogen, Waltham, MA, USA) according to the manufacturer’s protocol. Each sample was assayed in three technical and three biological replicates. qRT-PCR was conducted on a MyiQ Real-Time PCR detection system platform (Bio-Rad, USA) using the SYBR® Green Master ROX (TaKaRa, Dalian, China). Each reaction was prepared in a total volume of 20 μL reaction mixture containing 2.0 μL of diluted cDNA, 0.2 μM primer pairs, and 10 μL of 2 × SYBR Green PCR Master Mix. The PCR reactions were carried out with the following program: 95 °C for 3 min, 40 cycles of 95 °C for 5 s, 58 °C for 30 s, and 72 °C for 10 s [46]. Specific primers were designed for 9 DEGs (Table 1). The relative expression level was quantified using the 2−ΔΔCT method with the G6PD gene as the reference gene [47]. Statistical significance was determined by Duncan’s multiple range test at the p < 0.05 level using SPSS 21.0 statistical software (SPSS Inc., Chicago, IL, USA).

3. Results

3.1. Phenotypic and Physiological Differences of Waxy/Non-Waxy Chinese Cabbage in Response to Drought Stress

Compared with normal hydroponic culture (CK), Chinese cabbage leaves exhibited symptoms of upward-curled leaf margins and yellowed, wilted outer leaves under drought stress. Waxy T065-1 exhibited yellowing of outer leaves at 12 h under drought stress, followed by smaller, shrunken, and yellowed leaves at 24 h (Figure 1a). Non-waxy T065-2 showed more obvious changes than waxy T065-1. Upward curling of the outer leaf margins appeared at 6 h, and significantly shrunk, yellowed, and wilted leaves were observed at 12 h and 24 h (Figure 1b). At 6 h of drought stress, the RWC of waxy T065-1 was lower than that of non-waxy T065-2. As the drought stress duration extended to 12 h and 24 h, the RWC of waxy T065-1 became higher than that of non-waxy T065-2 (Figure 1c).
Antioxidant enzymes SOD and POD in Chinese cabbage undergo changes to protect cells from damage in response to drought stress. SOD activity significantly increased in both T065-1 and T065-2 under drought stress. Waxy T065-1 reached the maximum SOD activity at 6 h, followed by a decrease and subsequent stabilization. In contrast, non-waxy T065-2 achieved its maximum SOD activity at 12 h, and the SOD activity of T065-1 was consistently higher than that of T065-2 (Figure 1c). POD activity in T065-1 was significantly higher than in T065-2. Waxy T065-1 peaked in POD activity at 12 h under drought stress then decreased and remained stable, while non-waxy T065-2 reached its peak at 6 h (Figure 1c). These results suggest that waxy T065-1 possesses stronger antioxidant capacity and adaptability to drought stress than non-waxy T065-2.
Drought stress also affected the content of osmotic adjustment substances in the leaves of Chinese cabbage. Under normal conditions, MDA levels in T065-1 and T065-2 showed no significant difference. After 6, 12, and 24 h under drought stress, MDA levels increased in both materials, with non-waxy T065-2 exhibiting a more significant rise than waxy T065-1 (Figure 1d). The Pro content in both materials increased continuously with drought stress duration, but the increase rate was markedly higher in non-waxy T065-2 than in waxy T065-1 (Figure 1d). These results suggest that drought stress caused more severe damage to cell membrane lipids in non-waxy T065-2, while waxy T065-1 maintained stronger leaf cell membrane stability.

3.2. Transcriptome Analysis of Waxy/Non-Waxy Chinese Cabbage in Response to Drought Stress

3.2.1. Statistics of Transcriptome Sequencing Data

Transcriptome sequencing analysis was performed on 24 samples from waxy NILs of Chinese cabbage in response to drought stress, yielding a total of 190.6 Gb of clean data. Each sample generated at least 6 Gb of clean data, with Q30 base percentages ≥93%. The obtained clean reads were aligned to the Chinese cabbage reference genome (Brassica Genome data/Brara Chiifu_V3.5), achieving an alignment rate ranging from 92.37% to 93.64% (Table 2).

3.2.2. Identification and Analysis of DEGs

The analysis of valid reads obtained from sequencing showed that compared with the control group, waxy T065-1 had 3056, 3199, and 5223 DEGs at 6, 12, and 24 h under drought stress, respectively (Table S1, Figure 2a). Non-waxy T065-2 had 3998, 4842, and 5438 DEGs at 6, 12, and 24 h under drought stress, respectively (Table S1, Figure 2b). Comparative analysis between the two materials identified 5068, 5512, 5210, and 5875 DEGs at 0, 6, 12, and 24 h under drought stress, respectively (Table S1, Figure 2c). Both waxy and non-waxy Chinese cabbage exhibited the largest number of DEGs at 24 h under drought stress, with the greatest difference between the two materials observed also at 24 h, followed by 6 h.

3.2.3. GO Enrichment and KEGG Pathway Analysis of DEGs

GO enrichment analysis was performed on DEGs between T065-1 and T065-2 (Figure 3). The results showed that biological processes such as “response to oxygen levels” and “secondary metabolite biosynthesis” were significantly enriched at all time points (6, 12, and 24 h) of drought treatment. At 6 h under drought stress, “photosynthesis” and “cellular amino acid biosynthetic process” were also enriched. At 12 h, enriched terms included “response to salicylic acid”, “response to toxic substance”, “glycosyl compound metabolic process”, and “plant organ senescence”. In addition to the same biological processes enriched at 6 h and 12 h under drought stress, 24 h under drought stress primarily enriched terms such as “phosphorelay signal transduction system”, “ethylene-activated signaling pathway”, and “response to reactive oxygen species”. In the cellular component category, the enriched terms were mainly concentrated in “secretory vesicle”. In the molecular function category, the main enriched term was involved in “monooxygenase activity”.
KEGG pathway analysis was conducted on the metabolic pathways associated with DEGs between T065-1 and T065-2 (Figure 4). The results showed that these genes were mainly enriched in the pathways of “biosynthesis of secondary metabolites” and “glucosinolate biosynthesis”. At 6 h under drought stress, 35 DEGs (35/1879, 1.86%) were identified to be involved in “cutin, suberine and wax biosynthesis”. At 12 h, 245 DEGs (245/1659, 14.77%) were enriched in the “plant-pathogen interaction” pathway, and 126 DEGs (126/1659, 7.59%) were enriched in the “MAPK signaling pathway-plant” pathway. At 24 h, 366 (366/2018, 18.14%), 268 (268/2018, 13.28%), 184 (184/2018, 9.12%), 75 (75/2018, 3.72%), and 40 (40/2018, 1.98%) DEGs were identified to be enriched in the five pathways of “plant-pathogen interaction”, “plant hormone signal transduction”, “MAPK signaling pathway-plant”, “biosynthesis of phenylpropanoids”, and “ABC transporters”, respectively.

3.3. Expression Analysis of Genes Related to Signal Transduction Pathways in Waxy/Non-Waxy Chinese Cabbage in Response to Drought Stress

In the comparative analysis between T065-1 and T065-2, 27, 44 and 12 genes were identified to be homologous to the key genes encoding Arabidopsis RCAR/PYR/PYLs, PP2Cs, and SnRK2, respectively (Figure 5). Among these, 7, 17, and 2 genes showed significant differential expression in response to drought stress.
Three genes, PYL2 (RCAR14, BraA09g054590), PYL5 (RCAR8, BraA03g002170), and PYL6 (RCAR9, BraA03g021440), were identified to be significantly downregulated in non-waxy T065-2 compared with waxy T065-1 at 6 h under drought stress. Two genes, PYL4 (RCAR10, BraA03g019980) and PYL6 (RCAR9, BraA03g021440), were significantly upregulated at 12 h. At 24 h, two genes, PYL9 (RCAR1, BraA10g000560) and PYL11/12 (RCAR5/6, BraA06g043610), were significantly upregulated, while two other genes, PYL5 (RCAR8, BraA03g002170) and PYL6 (RCAR9, BraA05g005710), were significantly downregulated.
At 6 h under drought stress, nine genes, ABI1 (BraA01g016860, BraA03g053880), ABI2 (BraA10g015330), AIP1 (BraA09g065170), PIR1 (BraA05g009830), HAI3 (BraA05g015100), PP2CA (BraA01g040820), AP2C1 (BraA05g014490), and HAI1 (BraA10g017110), were significantly upregulated in T065-2 compared with T065-1. Four genes, PP2C CLADE D 7 (BraA10g033010, BraA02g000620), PP2C6-6 (BraA08g035820), and EAR1 (BraA10g019300), were significantly downregulated. At 12 h, four genes, PIR1 (BraA05g009830), HAI3 (BraA05g015100), AP2C1 (BraA05g014490), and HAI1 (BraA10g017110), were significantly upregulated; five genes, PP2C CLADE D 7 (BraA10g033010, BraA03g001110, BraA02g000620), PP2C6-6 (BraA08g035820), and EAR1 (BraA10g019300), were significantly downregulated. At 24 h, seven genes, PP2C5 (BraA03g021320), HAI3 (BraA05g015100), PP2CA (BraA01g040820), AP2C1 (BraA05g014490), DOG18 (BraA09g028610), HAI1 (BraA10g017110), and PP2C5 (BraA05g005870) were significantly upregulated, and four genes, PP2C CLADE D 7 (BraA10g033010, BraA03g001110, BraA02g000620) and PP2C6-6 (BraA08g035820), were significantly downregulated.
SnRK2.5 (BraA06g028250) was significantly upregulated at 6, 12, and 24 h under drought stress, while SnRK2.10 (BraA01g029470) was significantly downregulated at 24 h.

3.4. Expression Analysis of Wax Biosynthesis and Transport-Related Genes in Chinese Cabbage in Response to Drought Stress

A total of 33 wax-biosynthesis-related and 30 transport-related DEGs were identified between T065-1 and T065-2 under drought stress (Figure 6). The key wax biosynthesis genes FATA1, CER1, and CER3b were upregulated in non-waxy T065-2, while ADS32, MAH1a, MAH1b, CER2, and CER3a were upregulated in waxy T065-1. Among the 16 rate-limiting enzymes (KCS) in very-long-chain fatty acid synthesis, KCS1a, KCS1b, KCS2, KCS3a, KCS6, KCS10, KCS12, KCS19a, and KCS20a were upregulated in T065-2, whereas KCS13, KCS16, and KCS19b were upregulated in T065-1. KCS3b, KCS9, KCS15, and KCS20b exhibited differential expression patterns at different drought stress time points. Wax ester synthase WSD1 was upregulated in non-waxy T065-2, while WSD2a and WSD3 were upregulated in T065-1 (Figure 6a).
A total of 20 ABC transporter (ABCG) genes and 10 lipid transfer protein (LTP) genes were identified as differentially expressed (Figure 6b). Under drought stress at 6, 12, and 24 h, ABCG6, ABCG11, ABCG12, ABCG22, ABCG23, and ABCG42 were upregulated in T065-2, whereas ABCG15, ABCG20, ABCG24, ABCG25, and ABCG29 were downregulated. ABCG16 and ABCG40 were significantly upregulated at 24 h and 6 h, respectively. ABCG31 was significantly downregulated under non-stress conditions but showed no significant differential expression after drought stress. LTPG5, nsLTP3, nsLTP4, nsLTP6, and nsLTP9A were upregulated in T065-2, while LTPG1, LTPG6, and nsLTP5 were downregulated. nsLTP3 and nsLTP4 were significantly upregulated at 6 h under drought stress.

3.5. Expression Analysis of Transcription Factors (TFs) in Waxy/Non-Waxy Chinese Cabbage in Response to Drought Stress

A total of 84 major TFs belonging to seven families were identified in T065-1 and T065-2 as involved in drought stress response (Figure 7). Among these families, ERF, WRKY, MYB, NAC, and LBD contained a relatively large number of TFs, with 24, 19, 17, 13, and 7 members, respectively, while both HDG and HHO families each had 2 members (Figure 7). Comparing T065-1 with T065-2, 40 (10 upregulated, 30 downregulated), 44 (19 upregulated, 25 downregulated), 54 (18 upregulated, 36 downregulated), and 61 (31 upregulated, 30 downregulated) differentially expressed TF genes were identified in response to 0, 6, 12, and 24 h of drought stress, respectively (Figure 8).

3.6. qRT-PCR Validation of DEGs

To verify the reliability of the RNA-seq results in waxy and non-waxy Chinese cabbage leaves under drought stress, nine DEGs related to signal transduction, wax biosynthesis/transport, and transcriptional regulation pathways were randomly selected for qRT-PCR validation (Figure 9). Comparative analysis showed that the expression trends of these DEGs detected by qRT-PCR were consistent with those from the transcriptome sequencing results, confirming the reliability of the RNA-seq data in this study.

4. Discussion

This study analyzed the physiological responses and transcriptomic regulation of a pair of Chinese cabbage waxy NILs under drought stress. Apart from the wax trait, the two lines share highly similar genetic backgrounds, allowing for a more precise elucidation of the association between the wax phenotype and drought resistance. By setting up multi-time-point treatments (6, 12, and 24 h under drought stress), this study was the first to reveal temporal dynamic differences in response to drought stress between waxy and non-waxy materials, particularly in the ABA signaling pathway, wax biosynthesis/transport, and transcription factor regulation.

4.1. Biological Mechanism of Cuticular Wax Response to Drought Stress

Non-waxy T065-2 showed higher sensitivity to drought stress compared to waxy T065-1. In terms of phenotype, the outer leaf margins of T065-2 exhibited obvious upward curling after 6 h under drought stress, while T065-1 showed almost no phenotypic changes compared to the control (Figure 1a,b). Physiological data revealed that the contents of osmotic adjustment substances MDA and Pro in non-waxy T065-2 were significantly higher than in waxy T065-1 at 6, 12, and 24 h under drought stress (Figure 1d). As shown in Figure 2a,b, the number of DEGs in the waxy NILs increased with the extension under drought stress time, reflecting a clear upward trend in gene expression changes. However, it has been reported in oats [48] that a drought-sensitive variety under study (Bayou 9) had a large number of DEGs at 12 h, while the number of DEGs in a drought-resistant variety (Yanke 2) increased significantly at 36 h. The number of DEGs in non-waxy T065-2 was consistently higher than that in waxy T065-1 (Figure 2a,b). This finding is consistent with studies in peanuts [49] and wheat [29,50], suggesting that drought stress may cause greater damage to non-waxy T065-2, prompting it to mobilize more DEGs to cope with the stress. Non-waxy T065-2 showed earlier drought damage such as curled leaves and higher MDA, triggering more DEGs for stress response. By contrast, waxy T065-1 delayed stress damage, resulting in a milder gene response. These findings are consistent with the previously reported gene expression trends in Brassica napus under drought stress [51].
The KEGG enrichment analysis identified 35 DEGs enriched in “cutin, suberine and wax biosynthesis” at 6 h, indicating that cuticular wax likely serves as the first barrier for plants against drought stress in early response stages. The DEGs were significantly enriched in five key pathways, including “plant-pathogen interaction pathways”, “MAPK signaling pathway-plant pathway”, “plant hormone signal transduction”, “phenylpropanoid biosynthesis”, and “ABC transporters” at 12 and 24 h under drought stress (Figure 4). These findings suggest that these metabolic pathways play critical roles in the growth, development, and cellular metabolism of waxy NILs under drought stress at both 12 and 24 h. The observed gene expression changes in these pathways likely represent coordinated stress responses. The GO enrichment analysis revealed that DEGs were significantly enriched in biological processes such as “response to oxygen levels” and “secondary metabolite synthesis”, implying that antioxidant-enzyme-related genes and cellular-component-related genes may play crucial roles in scavenging excess reactive oxygen species and maintaining cellular structure during drought stress.

4.2. Molecular Mechanism of ABA Signaling of Chinese Cabbage Wax NILs in Response to Drought Stress

Studies have shown that drought signals stimulate the synthesis of ABA in different plant organs. ABA regulates stomatal closure and the expression of drought-responsive genes by activating downstream signal transduction components, including RCAR/PYR/PYLs, PP2Cs, and SnRK2 [6,52]. This study found that a total of 26 DEGs were enriched in the ABA signaling pathway in Chinese cabbage NILs under drought stress. PYL2 (RCAR14, BraA09g054590) was significantly upregulated at 6 h under drought stress, while PYL5 (RCAR8, BraA03g002170) showed significant upregulation at both 6 and 24 h in the waxy T065-1. Over-expression of PYL2 in Arabidopsis [53] and rice [54] has been shown to enhance drought resistance. AtPYL5 has been reported to enhance plant drought resistance in addition to participating in the regulation of growth and development [55,56]. It is speculated that PYL2 and PYL5 genes may play important roles in maintaining drought resistance in waxy Chinese cabbage. Two homologous copies of the Arabidopsis PYL6 (RCAR9) orthologous gene exhibited distinct differential expression patterns. BraA03g021440 was significantly downregulated at 6 h and upregulated at 12 h in non-waxy T065-2, while the other copy, BraA05g005710, was significantly downregulated at 24 h. OsPYL6 is a key factor regulating rice development and drought tolerance, and precise regulation of its expression is essential for simultaneously improving rice yield and stress tolerance [57,58]. The different expression patterns of PYL6 at different times under drought stress may be related to maintaining a dynamic balance between yield and drought tolerance.
A total of 80 PP2Cs have been identified in Arabidopsis and classified into 13 major subfamilies [59]. In this study, the DEGs identified were mainly distributed in subfamilies A, B, D, and G. Interestingly, all members of subfamilies A (ABI1, ABI2, and PP2CA), B (AIP1, PP2C5, and AP2C1), and G (HAI1) were highly expressed in non-waxy T065-2, while all members of subfamily D (PP2C CLADE D 7, PP2C6-6) were highly expressed in waxy T065-1. This suggests potential functional divergence among different PP2C subfamilies in regulating plant growth, development, stress responses, and hormone signaling.
SnRK2.6 (OST1, open stomata 1) in Arabidopsis has been reported to regulate the expression of numerous drought-related genes, ion channel activity, and metabolic pathways, serving as a hub for plant drought responses [60,61]. In this study, SnRK2.6 showed differential but non-significant expression under drought stress (Figure 5). SnRK2.5 (BraA06g028250) and SnRK2.10 (BraA01g029470) exhibited distinct significant differential expression patterns at 6, 12, and 24 h under drought stress, though reports on their roles in drought stress responses were limited.

4.3. Functional Analysis of Wax Synthesis/Transport Genes and Transcription Factors in Response to Drought Stress in Waxy NILs of Chinese Cabbage

Drought-induced changes in plant cuticular wax were mainly mediated by altered expression of genes related to wax synthesis [62,63,64]. Variations in primary alcohols and alkanes among Arabidopsis thaliana cultivars indicate a negative correlation between primary alcohol content and drought factors, while alkanes exhibit the opposite trend [22]. Li et al. [22] proposed a working model where plants adjust their cuticular permeability to adapt to external environmental changes by fine-tuning the ratio of alkanes to primary alcohols via the SOH1-CER3-CER1 module. In citrus, the CsMYB44-csi-miR0008-CsCER1 module affects cuticular wax synthesis to enhance drought resistance [64]. Notably, CER3a (BraA03g012220) was upregulated in waxy T065-1 under drought stress; however, unlike the findings in Arabidopsis and citrus, CER1 (BraA09g068200) and CER3b (BraA10g016070) were downregulated in waxy T065-1. The nsLTPs identified in waxy NILs of Chinese cabbage exhibited distinct expression patterns under drought stress, partially inconsistent with findings on the cotton drought-resistant gene GhLTP4 [65] and Arabidopsis LTPG gene [66]. This suggests that nsLTPs were sensitive to drought stress and that their expression varies across different plant species and tissues. ABCG25 is an ABA transporter localized on the cell membrane in Arabidopsis. Over-expression of AtABCG25 enhanced ABA transport in guard cells of leaves and improved plant drought tolerance by increasing water use efficiency [67]. ABCG25 (BraA02g021380) was significantly upregulated in waxy T065-1 at 12 and 24 h under drought stress compared to non-waxy T065-2, indicating its potential role in drought resistance. Conversely, ABCG11 (BraA08g029660) in non-waxy T065-2 was significantly upregulated at 6 h, with no significant changes in waxy T065-1. This result conflicts with previous reports in Zygophyllum xanthoxylum and Arabidopsis [68].
In this study, the transcriptomic analysis of waxy NILs in response to drought stress identified 84 major TFs, primarily belonging to families including ERF, WRKY, MYB, NAC, and LBD (Figure 7). Previous studies on crops such as Arabidopsis, rice, and wheat have reported that these TFs are involved in regulating ABA signaling, wax synthesis/transport, and functional genes related to drought stress [25]. Numerous studies have demonstrated the roles of TFs such as AP2/ERF, DREB, NAC, bZIP, bHLH, WRKY, and ABF in drought signaling on crops [69]. The synthesis of cuticular wax is also subject to strict genetic regulation under drought stress. For example, the MYB96 gene induces expression under drought stress, and the MYB96 protein can directly bind to and activate the promoters of wax KCS1, KCS2, and CER6 to increase the cuticular wax content and further enhance drought resistance [29,70]. This study also revealed an increasing number of differentially expressed TFs over prolonged drought stress (Figure 8), suggesting that extended stress may activate more complex transcriptional regulatory networks. These long-term drought-responsive factors likely serve as core regulators of drought resistance differences between waxy and non-waxy materials, making them potential molecular markers or targets for genetic engineering.

5. Conclusions

In this study, a pair of Chinese cabbage waxy NILs was used for the first time to reveal the dynamic patterns of plant phenotype, physiology, and gene expression under drought stress. Phenotypic and physiological data demonstrated that waxy T065-1 exhibited significantly higher antioxidant capacity and stress adaptability compared to non-waxy T065-2 under drought stress. Combined with transcriptome analysis, the dynamic characteristics of DEGs between waxy and non-waxy material at different time points in response to drought stress were identified. In particular, key genes in the ABA signaling pathway (PYL2, PYL5, PYL6, SnRK2.5, and SnRK2.10), wax biosynthesis and transport (MAH1, CER3a, ABCG25, and LTPG1), and transcription factors exhibited significant differential expression. These genes may serve as important molecular targets for enhancing drought resistance in Chinese cabbage. This study provides critical technical support and application directions for addressing drought stress and ensuring the stable development of the Brassicaceae vegetable industry.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/horticulturae11121431/s1, Table S1: Comparative analysis between the waxy T065-1 and Non-waxy T065-2 identified DEGs at 0, 6, 12, and 24 h under drought stress, respectively.

Author Contributions

Experimental design and manuscript writing, R.W.; revision of the manuscript, S.W.; provision of experimental materials and resources, Z.Z. (Zhizhong Zhao); data collection, analysis, or interpretation, N.X.; data collection, analysis, or interpretation, Q.L.; field management, data collection, and analysis of experimental materials, Z.Z. (Zhigang Zhang); experimental design, research data collection, and financial support, S.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China [32202501]; the Shandong Academy of Agricultural Sciences Innovation Engineering Project [CXGC2025C08,CXGC2025E03]; and the Key R&D Program of Shandong Province, China [2022LZGCQY005].

Data Availability Statement

All raw RNA-Seq data were deposited in the NCBI database (https://www.ncbi.nlm.nih.gov) with BioProject accession number PRJNA1337933.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

ABAAbscisic Acid
CATCatalase
DEGDifferentially Expressed Gene
DWDry Weight
FDRFalse Discovery Rate
FWFresh Weight
GOGene Ontology
KEGGKyoto Encyclopedia of Genes and Genomes
RNARibonucleic Acid
ROSReactive Oxygen Species
RWCRelative Water Content
SODSuperoxide Dismutase
TFsTranscription Factors
MDAMalondialdehyde
NILsNear-Isogenic Lines
PEGPolyethylene Glycol
PODPeroxidase
ProProline
qRT-PCRQuantitative Real-time PCR
TWTurgid Weight
WDL1Wilted Dwarf and Lethal 1

References

  1. Ahluwalia, O.; Singh, P.C.; Bhatia, R. A review on drought stress in plants: Implications, mitigation and the role of plant growth promoting rhizob acteria. Resour. Environ. Sustain. 2021, 5, 6267–6282. [Google Scholar] [CrossRef]
  2. Illouz-Eliaz, N.; Yu, J.; Swift, J.; Lande, K.; Jow, B.; Partida-Garcia, L.; Tuang, Z.K.; Lee, T.A.; Yaaran, A.; Gomez-Castanon, R.; et al. Drought recovery in plants triggers a cell-state-specific immune activation. Nat. Commun. 2025, 16, 8095. [Google Scholar] [CrossRef]
  3. Verma, K.K.; Song, X.P.; Kumari, A.; Jagadesh, M.; Singh, S.K.; Bhatt, R.; Singh, M.; Seth, C.S.; Li, Y.R. Climate change adaptation: Challenges for agricultural sustainability. Plant Cell Environ. 2025, 48, 2522–2533. [Google Scholar] [CrossRef]
  4. Shah, W.U.H.; Lu, Y.; Liu, J.; Rehman, A.; Yasmeen, R. The impact of climate change and production technology heterogeneity on China’s agricultural total factor productivity and production efficiency. Sci. Total Environ. 2024, 907, 168027. [Google Scholar] [CrossRef] [PubMed]
  5. Chen, K.; Gao, J.; Sun, S.; Zhang, Z.; Yu, B.; Li, J.; Xie, C.; Li, G.; Wang, P.; Song, C.P.; et al. BONZAI proteins control global osmotic stress responses in plants. Curr. Biol. 2020, 30, 4815–4825. [Google Scholar] [CrossRef]
  6. Gupta, A.; Rico-Medina, A.; Cao-Delgado, A.I. The physiology of plant responses to drought. Science. 2020, 368, 266–269. [Google Scholar] [CrossRef]
  7. Kong, L.; Liu, Y.; Zhi, P.; Wang, X.; Xu, B.; Gong, Z.; Chang, C. Origins and evolution of cuticle biosynthetic machinery in land plants. Plant Physiol. 2020, 184, 1998–2010. [Google Scholar] [CrossRef]
  8. Lian, X.Y.; Gao, H.N.; Jiang, H.; Liu, C.; Li, Y.Y. MdKCS2 increased plant drought resistance by regulating wax biosynthesis. Plant Cell Rep. 2021, 40, 2357–2368. [Google Scholar] [CrossRef] [PubMed]
  9. Urano, K.; Oshima, Y.; Ishikawa, T.; Kajino, T.; Sakamoto, S.; Sato, M.; Toyooka, K.; Fujita, M.; Kawai-Yamada, M.; Taji, T.; et al. Arabidopsis DREB26/ERF12 and its close relatives regulate cuticular wax biosynthesis under drought stress condition. Plant J. 2024, 120, 2057–2075. [Google Scholar] [CrossRef] [PubMed]
  10. Liu, C.; Sack, L.; Li, Y.; Zhang, J.; Yu, K.; Zhang, Q.; He, N.; Yu, G. Relationships of stomatal morphology to the environment across plant communities. Nat. Commun. 2023, 14, 6629. [Google Scholar] [CrossRef]
  11. Liu, L.; Ashraf, M.A.; Morrow, T.; Facette, M. Stomatal closure in maize is mediated by subsidiary cells and the PAN2 receptor. New Phytol. 2024, 241, 1130–1143. [Google Scholar] [CrossRef]
  12. Sun, X.; Xiong, H.; Jiang, C.; Zhang, D.; Yang, Z.; Huang, Y.; Zhu, W.; Ma, S.; Duan, J.; Wang, X.; et al. Natural variation of DROT1 confers drought adaptation in upland rice. Nat. Commun. 2022, 13, 4265. [Google Scholar] [CrossRef]
  13. Han, S.; Wang, Y.; Li, Y.; Zhu, R.; Gu, Y.; Li, J.; Guo, H.; Ye, W.; Nabi, H.G.; Yang, T.; et al. The OsNAC41-RoLe1-OsAGAP module promotes root development and drought resistance in upland rice. Mol. Plant. 2024, 17, 1573–1593. [Google Scholar] [CrossRef]
  14. Zhang, X.; Mi, Y.; Mao, H.; Liu, S.; Chen, L.; Qin, F. Genetic variation in ZmTIP1 contributes to root hair elongation and drought tolerance in maize. Plant Biotechnol. J. 2020, 18, 1271–1283. [Google Scholar] [CrossRef]
  15. Ying, S.; Scheible, W.R.; Lundquist, P.K. A stress-inducible protein regulates drought tolerance and flowering time in Brachypodium and Arabidopsis. Plant Physiol. 2023, 191, 643–659. [Google Scholar] [CrossRef]
  16. Shavrukov, Y. Pathway to the molecular origins of drought escape and early flowering illuminated via the phosphorylation of SnRK2-Substrate 1 in Arabidopsis. Plant Cell Physiol. 2024, 65, 179–180. [Google Scholar] [CrossRef] [PubMed]
  17. Islam, M.A.; Du, H.; Ning, J.; Ye, H.; Xiong, L. Characterization of Glossy1-homologous genes in rice involved in leaf wax accumulation and drought resistance. Plant Mol. Biol. 2009, 70, 443–456. [Google Scholar] [CrossRef] [PubMed]
  18. Lewandowska, M.; Keyl, A.; Feussner, I. Wax biosynthesis in response to danger: Its regulation upon abiotic and biotic stress. New Phytol. 2020, 227, 698–713. [Google Scholar] [CrossRef] [PubMed]
  19. Bernard, A.; Domergue, F.; Pascal, S.; Jetter, R.; Renne, C.; Faure, J.D.; Haslam, R.P.; Napier, J.A.; Lessire, R.; Joubès, J. Reconstitution of plant alkane biosynthesis in yeast demonstrates that Arabidopsis ECERIFERUM1 and ECERIFERUM3 are core components of a very-long-chain alkane synthesis complex. Plant Cell. 2012, 24, 3106–3118. [Google Scholar] [CrossRef]
  20. Rowland, O.; Zheng, H.; Hepworth, S.R.; Lam, P.; Jetter, R.; Kunst, L. CER4 encodes an alcohol-forming fatty acyl-coenzyme A reductase involved in cuticular wax production in Arabidopsis. Plant Physiol. 2006, 142, 866–877. [Google Scholar] [CrossRef]
  21. Lei, P.; Pan, M.; Kang, S.; Zeng, P.; Ma, Y.; Peng, Y.; Ma, X.; Chen, W.; He, L.; Yang, H.; et al. A premature termination codon mutation in the onion AcCER2 gene is associated with both glossy leaves and thrip resistance. Hortic. Res. 2025, 12, uhaf006. [Google Scholar] [CrossRef] [PubMed]
  22. Li, S.; Zhang, X.; Huang, H.; Yin, M.; Jenks, M.A.; Kosma, D.K.; Yang, P.; Yang, X.; Zhang, H.; Lu, S. Deciphering the core shunt mechanism in Arabidopsis cuticular wax biosynthesis and its role in plant environmental adaptation. Nat. Plants. 2025, 11, 165–175. [Google Scholar] [CrossRef] [PubMed]
  23. Kerstiens, G. Water transport in plant cuticles: An update. J. Exp. Bot. 2006, 57, 2493–2499. [Google Scholar] [CrossRef]
  24. Park, J.J.; Jin, P.; Yoon, J.; Yang, J.; Jeong, H.J.; Ranathunge, K.; Schreiber, L.; Franke, R.; Lee, I.; An, G. Mutation in Wilted Dwarf and Lethal 1 (WDL1) causes abnormal cuticle formation and rapid water loss in rice. Plant Mol. Biol. 2010, 74, 91–103. [Google Scholar] [CrossRef] [PubMed]
  25. Seo, P.J.; Lee, S.B.; Suh, M.C.; Park, M.J.; Go, Y.S.; Park, C.M. The MYB96 transcription factor regulates cuticular wax biosynthesis under drought conditions in Arabidopsis. Plant Cell 2011, 23, 1138–1152. [Google Scholar] [CrossRef]
  26. Jiang, L.; Zhang, D.; Liu, C.; Shen, W.; He, J.; Yue, Q.; Niu, C.; Yang, F.; Li, X.; Shen, X.; et al. MdGH3.6 is targeted by MdMYB94 and plays a negative role in apple water-deficit stress tolerance. Plant J. 2022, 109, 1271–1289. [Google Scholar] [CrossRef]
  27. Cao, F.; Qian, Q.; Li, Z.; Wang, J.; Liu, Z.; Zhang, Z.; Niu, C.; Xie, Y.; Ma, F.; Guan, Q. Natural variation in an HD-ZIP factor identifies its role in controlling apple leaf cuticular wax deposition. Dev. Cell. 2025, 60, 949–964. [Google Scholar] [CrossRef]
  28. Patwari, P.; Salewski, V.; Gutbrod, K.; Kreszies, T.; Dresen-Scholz, B.; Peisker, H.; Steiner, U.; Meyer, A.J.; Schreiber, L.; Dörmann, P. Surface wax esters contribute to drought tolerance in Arabidopsis. Plant J. 2019, 98, 727–744. [Google Scholar] [CrossRef]
  29. He, J.; Li, C.; Hu, N.; Zhu, Y.; He, Z.; Sun, Y.; Wang, Z.; Wang, Y. ECERIFERUM1-6A is required for the synthesis of cuticular wax alkanes and promotes drought tolerance in wheat. Plant Physiol. 2022, 190, 1640–1657. [Google Scholar] [CrossRef]
  30. Wang, R.H.; Wang, S.B.; Liu, S.T.; Li, Q.Y.; Zhang, Z.G.; Wang, L.H.; Zhao, Z.Z. Transcriptome analysis of waxy near-isogenic lines in Chinese cabbage floral axis. Acta Hortic. Sinica. 2022, 49, 62–72. [Google Scholar]
  31. Zhang, X.; Liu, Z.; Wang, P.; Wang, Q.; Yang, S.; Feng, H. Fine mapping of BrWax1, a gene controlling cuticular wax biosynthesis in Chinese cabbage (Brassica rapa L. ssp. pekinensis). Mol. Breeding. 2013, 32, 867–874. [Google Scholar] [CrossRef]
  32. Yang, S.; Liu, H.; Wei, X.; Zhao, Y.; Wang, Z.; Su, H.; Zhao, X.; Tian, B.; Zhang, X.; Yuan, Y. BrWAX2 plays an essential role in cuticular wax biosynthesis in Chinese cabbage (Brassica rapa L. ssp. pekinensis). Theor. Appl. Genet. 2022, 135, 693–707. [Google Scholar] [CrossRef] [PubMed]
  33. Yang, S.; Tang, H.; Wei, X.; Zhao, Y.; Wang, Z.; Su, H.; Niu, L.; Yuan, Y.; Zhang, X. BrWAX3, encoding a beta-ketoacyl-CoA synthase, plays an essential role in cuticular wax biosynthesis in Chinese cabbage. Int. J. Mol. Sci. 2022, 23, 10938. [Google Scholar] [CrossRef]
  34. Li, B.; Yue, Z.; Ding, X.; Zhao, Y.; Lei, J.; Zang, Y.; Hu, Q.; Tao, P. A BrLINE1-RUP insertion in BrCER2 alters cuticular wax biosynthesis in Chinese cabbage (Brassica rapa L. ssp. pekinensis). Front. Plant Sci. 2023, 14, 1212528. [Google Scholar] [CrossRef]
  35. Liu, C.; Yu, L.; Yang, L.; Tan, C.; Shi, F.; Ye, X.; Liu, Z. Identification of a new allele of BraA09g066480.3C controlling the wax-less phenotype of Chinese cabbage. BMC Plant Biol. 2023, 23, 408. [Google Scholar] [CrossRef] [PubMed]
  36. Song, G.; Dong, S.; Liu, C.; Zou, J.; Ren, J.; Feng, H. BrKCS6 mutation conferred a bright glossy phenotype to Chinese cabbage. Theor. Appl. Genet. 2023, 136, 216. [Google Scholar] [CrossRef] [PubMed]
  37. Privitera, G.F.; Treccarichi, S.; Nicotra, R.; Branca, F.; Pulvirenti, A.; Piero, A.R.L.; Sicilia, A. Comparative transcriptome analysis of B. oleracea L. var. italica and B. macrocarpa Guss. genotypes under drought stress: De novo vs reference genome assembly. Plant Stress. 2024, 14, 100657. [Google Scholar] [CrossRef]
  38. Singh, K.P.; Kumari, P.; Yadava, D.K. Development of de-novo transcriptome assembly and SSRs in all hexaploid Brassica with functional annotations and identification of heat-shock proteins for thermotolerance. Front. Genet. 2022, 13, 958217. [Google Scholar] [CrossRef]
  39. Ahmad, J.; Ali, A.A.; Al-Huqail, A.A.; Qureshi, M.I. Triacontanol attenuates drought-induced oxidative stress in Brassica juncea L. by regulating lignification genes, calcium metabolism and the antioxidant system. Plant Physiol. Biochem. 2021, 166, 985–998. [Google Scholar] [CrossRef]
  40. Schonfeld, M.A.; Johnson, R.C.; Carver, B.F.; Mornhinweg, D.W. Water relations in winter wheat as drought resistance indicators. Crop Sci. 1998, 28, 526–531. [Google Scholar] [CrossRef]
  41. Dhindsa, R.S.; Matowe, W. Drought tolerance in two mosses: Correlated with enzymatic defence against lipid peroxidation. J. Exp. Bot. 1981, 32, 79–91. [Google Scholar] [CrossRef]
  42. Hammerschmidt, R.; Nuckles, E.M.; Kuć, J. Association of enhanced peroxidase activity with induced systemic resistance of cucumber to Colletotrichum lagenarium. Physiol. Plant Pathol. 1982, 20, 73–82. [Google Scholar] [CrossRef]
  43. Guidi, L.; Bongi, G.; Ciompi, S.; Soldatini, G.F. In Vicia faba leaves photoinhibition from ozone fumigation in light precedes a decrease in quantum yield of functional PSII centres. J. Plant Physiol. 1999, 154, 167–172. [Google Scholar] [CrossRef]
  44. Bates, L.S.; Waldren, R.P.; Teare, I.D. Rapid determination of free proline for water-stress studies. Plant Soil. 1973, 39, 205–207. [Google Scholar] [CrossRef]
  45. Dewey, C.N.; Bo, L. RSEM: Accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinformatics. 2011, 12, 323. [Google Scholar]
  46. Wang, R.; Mei, Y.; Xu, L.; Zhu, X.; Wang, Y.; Guo, J.; Liu, L. Differential proteomic analysis reveals sequential heat stress-responsive regulatory network in radish (Raphanus sativus L.) taproot. Planta. 2018, 247, 1109–1122. [Google Scholar] [CrossRef]
  47. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  48. Fei, N. Identification of Drought Resistant Oat Germplasm Resources and Its Antioxidant Defense Mechanisms in Response to Drought Stress. Ph.D. Thesis, Inner Mongolia Agricultural University, Hohhot, China, 2024. [Google Scholar]
  49. Jiang, C.; Li, X.; Zou, J.; Ren, J.; Jin, C.; Zhang, H.; Yu, H.; Jin, H. Comparative transcriptome analysis of genes involved in the drought stress response of two peanut (Arachis hypogaea L.) varieties. BMC Plant Biol. 2021, 21, 64. [Google Scholar] [CrossRef]
  50. Guo, J.; Xu, W.; Yu, X.; Shen, H.; Li, H.; Cheng, D.; Liu, A.; Liu, J.; Liu, C.; Zhao, S.; et al. Cuticular wax accumulation is associated with drought tolerance in wheat near-isogenic lines. Front. Plant Sci. 2016, 7, 1809. [Google Scholar] [CrossRef]
  51. Lu, G.; Tian, Z.; Chen, P.; Liang, Z.; Zeng, X.; Zhao, Y.; Li, C.; Yan, T.; Hang, Q.; Jiang, L. Comprehensive morphological and molecular insights into drought tolerance variation at germination stage in Brassica napus accessions. Plants. 2024, 13, 3296. [Google Scholar] [CrossRef]
  52. Shi, Y.; Liu, X.; Zhao, S.; Guo, Y. The PYR-PP2C-CKL2 module regulates ABA-mediated actin reorganization during stomatal closure. New Phytol. 2022, 233, 2168–2184. [Google Scholar] [CrossRef] [PubMed]
  53. Cao, M.J.; Zhang, Y.L.; Liu, X.; Huang, H.; Zhou, X.E.; Wang, W.L.; Zeng, A.; Zhao, C.Z.; Si, T.; Du, J.; et al. Combining chemical and genetic approaches to increase drought resistance in plants. Nat. Commun. 2017, 30, 1183. [Google Scholar] [CrossRef] [PubMed]
  54. Qiao, Z.; Zhao, Y.; Wang, X.; Fu, Y.; Chen, C.; Du, X.; Sheng, F. PYL2 regulates drought and blast (Magnaporthe oryzae) resistance in rice. Plant Sci. 2025, 360, 112690. [Google Scholar] [CrossRef]
  55. Santiago, J.; Rodrigues, A.; Saez, A.; Rubio, S.; Antoni, R.; Dupeux, F.; Park, S.Y.; Márquez, J.A.; Cutler, S.R.; Rodriguez, P.L. Modulation of drought resistance by the abscisic acid receptor PYL5 through inhibition of clade a PP2Cs. Plant J. 2009, 60, 575–588. [Google Scholar] [CrossRef]
  56. Kim, H.; Lee, K.; Hwang, H.; Bhatnagar, N.; Kim, D.Y.; Yoon, I.S.; Byun, M.O.; Kim, S.T.; Jung, K.H.; Kim, B.G. Overexpression of PYL5 in rice enhances drought tolerance, inhibits growth, and modulates gene expression. J. Exp. Bot. 2014, 65, 453–464. [Google Scholar] [CrossRef]
  57. Kumar, V.V.S.; Yadav, S.K.; Verma, R.K.; Shrivastava, S.; Ghimire, O.; Pushkar, S.; Rao, M.V.; Kumar, T.S.; Chinnusamy, V. The abscisic acid receptor OsPYL6 confers drought tolerance to indica rice through dehydration avoidance and tolerance mechanisms. J. Exp. Bot. 2021, 72, 1411–1431. [Google Scholar] [CrossRef]
  58. Zhao, L.; Ma, X.; Ma, W.; Wang, Z.; Luo, D.; Zhou, Q.; Liu, W.; Fang, L.; Jin, J.; Searle, I.R.; et al. MsPYL6 and MsPYL9 improves drought tolerance by regulating stomata in alfalfa (Medicago sativa). Plant J. 2025, 122, e70265. [Google Scholar] [CrossRef]
  59. Xue, T.; Wang, D.; Zhang, S.; Ehlting, J.; Ni, F.; Jakab, S.; Zheng, C.; Zhong, Y. Genome-wide and expression analysis of protein phosphatase 2C in rice and Arabidopsis. BMC Genomics. 2008, 9, 550. [Google Scholar] [CrossRef]
  60. Hasan, M.M.; Liu, X.D.; Waseem, M.; Guang-Qian, Y.; Alabdallah, N.M.; Jahan, M.S.; Fang, X.W. ABA activated SnRK2 kinases: An emerging role in plant growth and physiology. Plant Signal Behav. 2022, 17, 2071024. [Google Scholar] [CrossRef]
  61. Liu, H.; Song, S.; Zhang, H.; Li, Y.; Niu, L.; Zhang, J.; Wang, W. Signaling transduction of ABA, ROS, and Ca2+ in plant stomatal closure in response to drought. Int. J. Mol. Sci. 2022, 23, 14824. [Google Scholar] [CrossRef] [PubMed]
  62. Zhu, X.; Xiong, L. Putative megaenzyme DWA1 plays essential roles in drought resistance by regulating stress-induced wax deposition in rice. Proc. Natl. Acad. Sci. USA 2013, 110, 17790–17795. [Google Scholar] [CrossRef]
  63. Zhang, Y.; Tian, Y.; Man, Y.; Zhang, C.; Wang, Y.; You, C.; Li, Y. Apple sUMo E3 ligase MdSIZ1 regulates cuticular wax biosynthesis by SUMOylating transcription factor MdMYB30. Plant Physiol. 2023, 191, 1771–1788. [Google Scholar] [CrossRef] [PubMed]
  64. Xie, J.; Yang, L.; Hu, W.; Song, J.; Kuang, L.; Huang, Y.; Liu, D.; Liu, Y. The CsMYB44-csi-miR0008-CsCER1 module regulates cuticular wax biosynthesis and drought tolerance in citrus. New Phytol. 2025, 246, 1757–1779. [Google Scholar] [CrossRef] [PubMed]
  65. Zhang, D.; Li, J.; Li, M.; Cheng, Z.; Song, X.; Shang, X.; Guo, W. Overexpression of a cotton nonspecific lipid transfer protein gene, GhITP4, enhances drought tolerance by remodeling lipid profiles, regulating abscisic acid homeostasis and improving tricarboxylic acid cycle in cotton. Environ. Exp. Bot. 2022, 201, 104991. [Google Scholar] [CrossRef]
  66. Debono, A.; Yeats, T.H.; Rose, J.K.; Bird, D.; Jetter, R.; Kunst, L.; Samuels, L. Arabidopsis LTPG is a glycosylphosphatidylinositol-anchored lipid transfer protein required for export of lipids to the plant surface. Plant Cell. 2009, 21, 1230–1238. [Google Scholar] [CrossRef]
  67. Kuromori, T.; Fujita, M.; Urano, K.; Tanabata, T.; Sugimoto, E.; Shinozaki, K. Overexpression of AtABCG25 enhances the abscisic acid signal in guard cells and improves plant water use efficiency. Plant Sci. 2016, 251, 75–81. [Google Scholar] [CrossRef]
  68. Liu, L.B.; Bai, W.P.; Li, H.J.; Tian, Y.; Yuan, H.J.; Garant, T.M.; Liu, H.S.; Zhang, J.; Bao, A.K.; Rowland, O.; et al. ZxABCG11 from the xerophyte Zygophyllum xanthoxylum enhances drought tolerance in Arabidopsis thaliana through modulating cuticular wax accumulation. Environ. Exp. Bot. 2021, 190, 104570. [Google Scholar] [CrossRef]
  69. Nakashima, K.; Ito, Y.; Yamaguchi-Shinozaki, K. Transcriptional regulatory networks in response to abiotic stresses in Arabidopsis and grasses. Plant Physiol. 2009, 149, 88–95. [Google Scholar] [CrossRef]
  70. Zhang, M.; Wang, J.; Liu, R.; Liu, H.; Yang, H.; Zhu, Z.; Xu, R.; Wang, P.; Deng, X.; Xue, S.; et al. CsMYB96 confers resistance to water loss in citrus fruit by simultaneous regulation of water transport and wax biosynthesis. J. Exp. Bot. 2022, 73, 953–966. [Google Scholar] [CrossRef]
Figure 1. Phenotypic and physiological changes of Chinese cabbage seedlings under drought stress. Waxy T065-1 (a); non-waxy T065-2 (b); RWC (%) = [(FW − DW)/(TW − DW)] × 100, where FW = fresh weight, DW = dry weight, and TW = turgid weight (c); SOD activity (U/g FW) (d); POD activity (U/g FW) (e); MDA content (mmol/g) (f); and Pro content (μg/g) (g). Note: Different lowercase letters in the same physiological indicator in the figure indicate significant differences in different treatments (p < 0.05, n = 3).
Figure 1. Phenotypic and physiological changes of Chinese cabbage seedlings under drought stress. Waxy T065-1 (a); non-waxy T065-2 (b); RWC (%) = [(FW − DW)/(TW − DW)] × 100, where FW = fresh weight, DW = dry weight, and TW = turgid weight (c); SOD activity (U/g FW) (d); POD activity (U/g FW) (e); MDA content (mmol/g) (f); and Pro content (μg/g) (g). Note: Different lowercase letters in the same physiological indicator in the figure indicate significant differences in different treatments (p < 0.05, n = 3).
Horticulturae 11 01431 g001
Figure 2. Venn diagram of DEGs in waxy/non-waxy Chinese cabbage under drought stress. DEGs among waxy T065-1 6 h vs. CK, 12 h vs. CK, and 24 h vs. CK (a); DEGs among non-waxy T065-2 6 h vs. CK, 12 h vs. CK, and 24 h vs. CK (b); DEGs among T065-2_CK vs. T065-1_CK, T065-2_6 h vs. T065-1_6 h, T065-2_12 h vs. T065-1_12 h, and T065-2_24 h vs. T065-1_24 h (c).
Figure 2. Venn diagram of DEGs in waxy/non-waxy Chinese cabbage under drought stress. DEGs among waxy T065-1 6 h vs. CK, 12 h vs. CK, and 24 h vs. CK (a); DEGs among non-waxy T065-2 6 h vs. CK, 12 h vs. CK, and 24 h vs. CK (b); DEGs among T065-2_CK vs. T065-1_CK, T065-2_6 h vs. T065-1_6 h, T065-2_12 h vs. T065-1_12 h, and T065-2_24 h vs. T065-1_24 h (c).
Horticulturae 11 01431 g002
Figure 3. GO enrichment analysis of DEGs in waxy/non-waxy Chinese cabbage under drought stress.
Figure 3. GO enrichment analysis of DEGs in waxy/non-waxy Chinese cabbage under drought stress.
Horticulturae 11 01431 g003
Figure 4. KEGG functional enrichment analysis of DEGs in waxy/non-waxy Chinese cabbage under drought stress.
Figure 4. KEGG functional enrichment analysis of DEGs in waxy/non-waxy Chinese cabbage under drought stress.
Horticulturae 11 01431 g004
Figure 5. Heat map of gene expression related to ABA signaling pathway in waxy/non-waxy Chinese cabbage under drought stress.
Figure 5. Heat map of gene expression related to ABA signaling pathway in waxy/non-waxy Chinese cabbage under drought stress.
Horticulturae 11 01431 g005
Figure 6. Comparative expression heat map analysis of wax synthesis (a) and transport genes (b) in waxy/non-waxy Chinese cabbage under drought stress.
Figure 6. Comparative expression heat map analysis of wax synthesis (a) and transport genes (b) in waxy/non-waxy Chinese cabbage under drought stress.
Horticulturae 11 01431 g006
Figure 7. Distribution of differentially expressed transcription factor family genes in waxy/non-waxy Chinese cabbage under drought stress.
Figure 7. Distribution of differentially expressed transcription factor family genes in waxy/non-waxy Chinese cabbage under drought stress.
Horticulturae 11 01431 g007
Figure 8. Distribution of differentially expressed transcription factor family genes in waxy/non-waxy Chinese cabbage under drought stress at different time points.
Figure 8. Distribution of differentially expressed transcription factor family genes in waxy/non-waxy Chinese cabbage under drought stress at different time points.
Horticulturae 11 01431 g008
Figure 9. qRT-PCR and RNA-seq validation of 9 genes in waxy/non-waxy Chinese cabbage under drought stress. Left vertical axis represents FPKM value (RNA-seq); right vertical axis represents relative expression (qRT-PCR).
Figure 9. qRT-PCR and RNA-seq validation of 9 genes in waxy/non-waxy Chinese cabbage under drought stress. Left vertical axis represents FPKM value (RNA-seq); right vertical axis represents relative expression (qRT-PCR).
Horticulturae 11 01431 g009
Table 1. Primers for qRT-PCR.
Table 1. Primers for qRT-PCR.
GeneIDForward SequenceReverse SequenceFragment Length (bp)
PYL9 (RCAR1)BraA10g000560TCGTCTCGTTTGGTCAGTGGACTTGTAGTTGCAGGGAGGC145
PP2C49BraA09g053530TTCCAACAATCCGGTCAGGGACGTACGTTGCTGCTTCTGA178
SNRK2.3BraA07g017590AATGCTGGACGGTTTAGCGAGGTGCAGGACTTCCATCCAA140
KCS2BraA10g002650AGCAGACGACAACGCCTTTACTTCTCCGGCGATAGCCATT107
KCS16BraA03g059790CGGTCGATACTCTTCTCCGCCTATAGCGATGACGCCAGCA189
ABCG14BraA05g024710CATCAAGCGGAGAACAGGGTAACTCGGTCCACATGCTCAG145
WRK33BraA03g020120ACCATCGGTTGTCCAGTGAGAGGGTCTTGTACCGGTCTGT147
MYB48BraA06g021070GGAGATCGGCGATGGGATTTAGCTCAGTGACAAGACGCTC146
NAC22BraA05g035170AATCGGCGAGAGTAGGAGGTTGCCCACAAGGCTACCATTT156
G6PD GGGTATGCCAGGACTAAGCTCGAATCATAAGGGCCACTCACAT134
Table 2. Transcriptome sequencing data statistics and quality evaluation.
Table 2. Transcriptome sequencing data statistics and quality evaluation.
SampleRaw Reads
(bp)
Clean Reads
(bp)
Clean Base
(Gb)
Q20(%)Q30(%)Total Reads (bp)Reads Mapped (bp)
T065-1_CK-155,971,96055,343,5628.397.6193.8455,343,56251,122,706 (92.37%)
T065-1_CK-248,334,94647,690,1887.1598.1895.0247,690,18844,393,154 (93.09%)
T065-1_CK-361,091,58860,131,4329.0298.5996.160,131,43256,229,016 (93.51%)
T065-1_6h-149,610,57848,946,8747.3498.0594.7448,946,87445,535,098 (93.03%)
T065-1_6h-255,353,16054,669,7088.298.5395.954,669,70851,194,721 (93.64%)
T065-1_6h-356,204,54255,500,4388.3398.1694.9955,500,43851,750,521 (93.24%)
T065-1_12h-164,703,42663,736,3049.5698.5195.9463,736,30459,347,842 (93.11%)
T065-1_12h-255,833,16455,184,8288.2898.1995.0455,184,82851,379,555 (93.10%)
T065-1_12h-362,590,54261,669,3429.2598.4995.7961,669,34257,413,137 (93.10%)
T065-1_24h-150,352,04849,548,9607.4398.1695.0249,548,96045,997,192 (92.83%)
T065-1_24h-248,717,00248,130,4027.2298.1794.9548,130,40244,844,386 (93.17%)
T065-1_24h-360,572,81259,697,1228.9598.4195.6659,697,12255,657,624 (93.23%)
T065-2_CK-153,967,76453,224,1947.9898.0694.7653,224,19449,619,884 (93.23%)
T065-2_CK-249,883,58649,286,9867.3998.2495.1549,286,98646,031,445 (93.39%)
T065-2_CK-343,768,68043,218,5386.4898.0894.8243,218,53840,273,898 (93.19%)
T065-2_6h-142,287,23041,700,9606.2698.1194.8541,700,96038,910,365 (93.31%)
T065-2_6h-251,673,15851,040,5467.6698.0294.6951,040,54647,470,769 (93.01%)
T065-2_6h-355,846,98855,095,2948.2698.3495.4155,095,29451,362,435 (93.22%)
T065-2_12h-167,306,84266,262,0709.9498.3795.5966,262,07061,944,090 (93.48%)
T065-2_12h-252,821,23252,081,8687.8197.9894.5952,081,86848,484,670 (93.09%)
T065-2_12h-351,577,82850,802,6567.6298.2895.2750,802,65647,376,753 (93.26%)
T065-2_24h-148,824,91048,147,6227.2298.295.148,147,62244,913,833 (93.28%)
T065-2_24h-245,400,79844,813,9426.7297.994.3444,813,94241,755,712 (93.18%)
T065-2_24h-355,644,80254,856,3168.2398.3795.5254,856,31651,296,769 (93.51%)
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, R.; Wang, S.; Zhao, Z.; Xu, N.; Li, Q.; Zhang, Z.; Liu, S. Physiological Response and Transcriptome Analysis of Waxy Near-Isogenic Lines in Chinese Cabbage (Brassica rapa L. ssp. pekinensis) Under Drought Stress. Horticulturae 2025, 11, 1431. https://doi.org/10.3390/horticulturae11121431

AMA Style

Wang R, Wang S, Zhao Z, Xu N, Li Q, Zhang Z, Liu S. Physiological Response and Transcriptome Analysis of Waxy Near-Isogenic Lines in Chinese Cabbage (Brassica rapa L. ssp. pekinensis) Under Drought Stress. Horticulturae. 2025; 11(12):1431. https://doi.org/10.3390/horticulturae11121431

Chicago/Turabian Style

Wang, Ronghua, Shubin Wang, Zhizhong Zhao, Nianfang Xu, Qiaoyun Li, Zhigang Zhang, and Shuantao Liu. 2025. "Physiological Response and Transcriptome Analysis of Waxy Near-Isogenic Lines in Chinese Cabbage (Brassica rapa L. ssp. pekinensis) Under Drought Stress" Horticulturae 11, no. 12: 1431. https://doi.org/10.3390/horticulturae11121431

APA Style

Wang, R., Wang, S., Zhao, Z., Xu, N., Li, Q., Zhang, Z., & Liu, S. (2025). Physiological Response and Transcriptome Analysis of Waxy Near-Isogenic Lines in Chinese Cabbage (Brassica rapa L. ssp. pekinensis) Under Drought Stress. Horticulturae, 11(12), 1431. https://doi.org/10.3390/horticulturae11121431

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop