Next Article in Journal
Genome-Wide Identification of miRNAs in Oily Persimmon (Diospyros oleifera Cheng) and Their Functional Targets Associated with Proanthocyanidin Metabolism
Next Article in Special Issue
Seed Priming with PEG 6000 and Silicic Acid Enhances Drought Tolerance in Cowpea by Modulating Physiological Responses
Previous Article in Journal
Bacillus thuringiensis and Trichoderma asperellum as Biostimulants in Hydroponic Tendril Pea (Pisum sativum) Microgreens
Previous Article in Special Issue
The Role of Brassinosteroids and Nano-Encapsulated Brassinosteroids in Capsicum Pepper Growth and Physiological Adaptations to High-Temperature Stress
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Identification of the CIPK Gene Family in Jasmine and Expression Analysis Under Salt Stress

1
School of Landscape and Ecological Engineering, Hebei University of Engineering, Handan 056038, China
2
College of Horticulture, China Agricultural University, Beijing 100091, China
3
College of Agronomy and Life Sciences, Shanxi Datong University, Datong 037009, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Horticulturae 2025, 11(1), 40; https://doi.org/10.3390/horticulturae11010040
Submission received: 25 November 2024 / Revised: 28 December 2024 / Accepted: 31 December 2024 / Published: 4 January 2025
(This article belongs to the Special Issue Tolerance of Horticultural Plants to Abiotic Stresses)

Abstract

Various CBL-interacting protein kinases (CIPKs) are involved in abiotic stress responses in plants. Despite the economic importance of jasmine (Jasminum sambac L. Aiton) and the availability of genome data, there are few reports analyzing the CIPK gene family. In this study, genome-wide identification of the CIPK gene family in jasmine was conducted, which would provide valuable information for the function analysis of JsCIPKs regarding participation in growth and development and response to salt stress. In the present study, a total of 17 CIPKs were identified, which were unevenly distributed on eight chromosomes. The JsCIPK protein sequences contained 311–781 amino acids, with a molecular weight of 35.05–87.58 kDa. Phylogenetic analysis revealed that the 17 JsCIPKs could be divided into five classical branches. JsCIPK genes with higher homology showed greater similarity between conserved protein motifs. Collinearity analysis demonstrated that 13 gene pairs in Arabidopsis were collinear with the jasmine sequences. Various hormone-related response- and stress-induced elements were observed in the promoter region of JsCIPK genes, such as TC-rich repeats, CARE, etc. Furthermore, the expression of JsCIPK genes varied in different organs. Finally, the expression analyses of eight JsCIPKs under salt stress were performed. A systematic analysis of the CIPK gene family and the effect of salt stress on the expression of eight JsCIPK genes in leaves of jasmine was carried out. The expression of JsCIPK6 and JsCIPK8 was significantly down-regulated and up-regulated by salt treatment, respectively. These findings would lay a foundation for future functional studies of these two genes in jasmine related to salt stress and provide useful resistance genes for the molecular breeding of new varieties of salt-tolerant jasmine.

1. Introduction

Plants are frequently exposed to various abiotic stresses, such as salt, drought, cold, high temperature, and oxidative stress. In response, they have developed complex mechanisms to perceive external signals and adapt to various environmental stimuli through appropriate physiological and morphological changes [1]. For example, in unfavorable environments, plants can maintain a normal metabolic response by upregulating the expression of related genes and changing the structure of certain proteins to maintain the integrity of plant structure and function [2].
When plants respond to exogenous stimuli and biotic and abiotic stresses, intracellular calcium ion (Ca2+) levels are regulated [3]. In turn, Ca2+ plays a crucial role as a secondary messenger in plant stress signal transduction [4]. Ca2+ sensors in plants can be classified into four types: calcium-dependent protein kinases (CDPKs), calmodulins (CaMs), calmodulin-like proteins (CAMLs), and calcineurin B-like proteins (CBLs) [5]. Among them, CBLs are specifically targeted by and interact with the CIPK family of serine/threonine protein kinases, which are unique to plants [6], regulating downstream genes and leading to a range of physiological and biochemical changes [7]. More specifically, CBLs sense changes in Ca2+ in plants and combine with CIPK to form a CBL-CIPK complex. This complex binds to the corresponding target proteins, phosphorylates them, and transmits downstream signals, improving the response of plants to stress [8].
CBL-CIPK protein complexes participate in various stress signal transmission networks in plants, such as drought, low temperature, high salt, and low potassium, in response to changes in the expression patterns of CIPK genes in plants [9]. CIPK proteins usually contain a conserved catalytic kinase domain at the N-terminus and a regulatory domain at the C-terminus. The former contains a serine/threonine protein kinase catalytic domain with an activation loop for phosphorylation. The C-terminal regulatory domain consists of the protein phosphatase interaction (PPI) motif and the autoregulatory NAF motif (also known as the FISL motif) [10]. The C-terminal regulatory domain is highly conserved and mediates the interactions between CIPK and CBL proteins [11].
With continuous improvements in genome sequencing technology, CIPK and CBL genes have been widely identified in many species, including Arabidopsis (Arabidopsis thalian L. Heynh) [12], rice (Oryza sativa L.) [13], maize (Zea mays L.) [6], apple (Malus domestica) [3], grape (Vitis vinifera L.) [14], pepper (Capsicum annuum L.) [15], canola (Brassica napus L.) [16], and tomato (Solanum lycopersicum L.) [17]. Significant differences in the number of CIPK family members exist among the different plants. Maize, rice, Arabidopsis, and tomato have 43, 31, 26, and 22 CIPK gene family members, respectively. In previous studies, various CBL-CIPK complexes were shown to play an important role in plant responses to abiotic stress and nutrient signaling cascades [14]. The sequences and structures of CBLs and CIPKs are highly conserved, suggesting that the functions of CBLs and CIPKs may be similar within and between species [18]. For example, in Arabidopsis, the salt overly sensitive (SOS) pathway is a well-elucidated salt tolerance pathway [17] and similar SOS signaling networks exist in other species, such as apple [19], poplar (Populus przewalskii Maxim.) [20], and tomato [17]. Similarly, low temperature, drought, salinity, and other abiotic stresses have been shown to influence the transcription levels of 20 OsCIPKs in rice, among which, the overexpression of OsCIPK3, OsCIPK12, and OsCIPK15 significantly improved the salt tolerance of transgenic plants, while the overexpression of corn ZmCIPK8 significantly improved drought resistance in tobacco (Nicotiana tabacum L.). The overexpression of wheat (Triticum aestivum L.) TaCIPK14 enables tobacco to acquire stronger cold adaptation ability [21]. The overexpression of AtCIPK21 in rice can reduce the accumulation of reactive oxygen species in transgenic plants under low-temperature stress. In terms of cold stress, CIPK can induce the expression of Ca2+-dependent protein kinases (CPK) and MAPK and significantly increase the content of polyamines and the activity of antioxidant enzymes in plants [22]. This may be the main way by which CIPK regulates cold resistance in plants.
A moderate amount of salt is required during the plant growth process, which plays an important role in maintaining normal physiological functions, but excessive salt will have a serious inhibitory effect on its growth and development [23]. Studying the effects of salt coercion on the growth and development of plants, screening salted alkali plants, and improving the development and utilization of saline-alkalized soil is of great significance. Studies have shown that salt coercion often leads to plant photosynthetic ability and anti-inverse ability decline, inhibiting the germination of plant seeds and the growth and development of plants [24]. Jasmine (Jasminum sambac L. Aiton) is a perennial evergreen shrub belonging to the Luteaceae family that can be primarily divided into three types: single-leaved, double-leaved, and multipetaled plants. Jasmine is native to tropical and subtropical India and the Persian Gulf. It has high ornamental, economic, edible, and medicinal value. Most varieties are resistant to cold, drought, frost, wet, and alkaline conditions, and deciduous vines are very cold- and drought-tolerant [25].
The morphology, cultivation management technology, pest control, chemical composition, and extraction of essential oils have been studied in jasmine; however, there are few reports on the bioinformatics analysis of gene families in jasmine. Extensive jasmine genomic data provide an opportunity for the genome-wide identification of jasmine, as well as comparative genomic studies. The aim of this study was to perform a bioinformatics analysis of the CIPK genes in jasmine using bioinformatics tools. Phylogenetic relationships, cis-element prediction, and functional components were analyzed through comparisons of jasmine genome-wide-identified CIPK homologous sequences. These findings provide a basis for further studies on the biological functions of the CIPK genes in jasmine.

2. Materials and Methods

2.1. Identification and Characterization of CIPK Family Members in Jasmine

The 26 CIPK protein sequences of Arabidopsis were obtained from the TAIR website (https://www.arabidopsis.org/, accessed on 28 December 2023) and downloaded locally. Three steps were performed to identify the members of the CIPK family in jasmine. First, the Hidden Markov Models (HMMs) of Pkinase (PF00069) and NAF (PF03822) were downloaded from the Pfam database, and the protein database (E-value < 0.01) was searched using HMMER 3.0 software [26]. The Arabidopsis CIPK protein sequences were used as seed sequences, and the jasmine protein sequences annotated using BLAST in the jasmine genomic database (https://github.com/maypoleflyn/Jasminum-sambac-genome, accessed on 14 January 2024) were downloaded to the local site for further analysis. If each CIPK member contained multiple genes with high homology, only the sequences with the highest homology were selected. To obtain all CIPKs encoded in the genome, the protein sequences of Jasmine sambac CIPKs (JsCIPKs) were reverse-translated into nucleotide sequences and further compared with the nucleotide sequences of the J. sambac genome to avoid missing any unannotated CIPK genes. Further comparative analysis was carried out using a conservative domain database (CCD) [27]. Eventually, 17 jasmine CIPK genes were identified. The above results were analyzed using TBtools software (version 1.6) [28]. The number of amino acids, isoelectric point (pI), protein stability, and molecular weight of the JsCIPKs were analyzed using the ExPASy website [29]; and secondary structure prediction and subcellular localization was carried out using Subcellular Localization Predictor [30].

2.2. Phylogenetic Analysis and Chromosomal Mapping of JsCIPKs

The protein coding sequences of 26 AtCIPK and 17 JsCIPK genes were analyzed by multiple sequence alignment using Clustal X version 2.0 software [31]. After sequence alignment, the matrix was used for phylogenetic tree analysis, and a phylogenetic tree was constructed using the Maximum Likelihood (ML) method in MEGA7.0 software (Arizona State University, Tempe, AZ, USA), with a bootstrap test value set at 1000. We extracted the chromosomal location data of the JsCIPK gene family members from genome annotation files and determined whole chromosome densities. TBtools was used for visual analysis, showing only those chromosomes containing JsCIPK members [28].

2.3. Analysis of Conserved Motifs and Domains of the Jasmine CIPK Family

Gene sequences were analyzed for gene structure, conserved motifs, conserved structural domains, and multiple sequence alignment. Clustal X was used for multiple sequence alignment analysis of the protein sequences encoded by the 26 AtCIPK and 17 JsCIPK genes [31]. The conserved protein motifs of JsCIPKs were analyzed using online prediction in MEME [32]. Promoter element prediction was performed using the PLANTCARE database [33]. Gene structure, conserved motifs, and cis-elements of all members of the CIPK gene family were visualized using the gene structure viewer in TB tools [28].

2.4. Analysis of CIPK Gene Distribution and Collinearity in Jasmine

Based on the gene position number, the corresponding chromosomal location information of jasmine was extracted from the genome annotation files [34], visualized, and identified using MapChart software (version 2.32) [35]. Analysis of the colinear relationship between gene family members was performed by MCScanX [36].

2.5. Prediction of Cis-Elements in the Jasmine CIPK Gene

The conserved CIPK motif was analyzed using the MEME suite [32]. The Amazing Optional Gene Viewer in TBtools was used to determine the structure of JsCIPK. The cis-elements of all promoter sequences (approximately 2000 bp) were identified using PlantCARE [33].

2.6. Analysis of the Expression Patterns of CIPK Genes in Jasmine

RNA-seq data of jasmine root, stem, leaf, and flower organs were obtained from the NCBI SRA database under accession number SRR14317414-SRR14317417. Then, the expression levels of 17 JsCIPK genes were collected and analyzed, and a heat map was generated using TBTools [28].

2.7. Expression Analysis of JsCIPK Genes Under Salt Stress

Seeds of Arabian jasmine were sown on the experimental field of Hebei University of Engineering (Handan, China). Branches of 3-month-old Arabian jasmine were immersed in 200 mM NaCl solution [37,38], and leaves were collected at 0, 1, 6, and 12 h. Then, samples were frozen using liquid nitrogen and stored at −80 °C for RNA extraction. RNA was extracted by the RC411–01 kit (Vazyme Biotech Co., Ltd., Nanjing, China). Subsequently, total RNA was reverse-transcribed, and the cDNA was used for the expression analysis of JsCIPK genes by qRT-PCR analysis with specific primers (Table 1) using Taq Pro Universal SYBR qPCR Master Mix (Q712–02; Vazyme Biotech Co., Ltd.). Three biological replicates and three technical replicates were performed for each treatment.

2.8. Statistical Analyses

The 2−∆∆CT method was taken as the method used for the analyzation of qRT-PCR data. Statistical and graphical analyses were performed using Statistica 7.0 StatSoft software and GraphPad Prism version 9.0 (GraphPad Software, La Jolla, CA, USA) software.

3. Results

3.1. Identification of Members of the Jasmine CIPK Family

The NAF domain (PF03822) and Pkinase domain (PF00069) were used as reference sequences. The HMM search method was used to identify potential members of the JsCIPK gene family, and BLASTP was used to search the jasmine protein database using 26 AtCIPKs as query sequences. The results of the two search methods were compiled, redundant sequences were removed from the dataset, and 17 JsCIPK protein sequences were identified. These putative JsCIPK genes were named JsCIPK1JsCIPK17 according to their locations on different chromosomes. These genes were unevenly distributed on the chromosomes, with only one JsCIPK gene each on chromosomes 8 and 13; two on chromosomes 1, 2, 6, and 11; three on chromosome 9; and four on chromosome 3 (Figure 1).
Analysis of the physical and chemical properties revealed that the JsCIPK protein sequence ranged from 311 (JsCIPK5) to 781 (JsCIPK1) amino acids (Table S1), with an average amino acid number of 465. The molecular weight (Da) of the proteins ranged from 35,049.82 (JsCIPK5) to 87,584.34 (JsCIPK1). The theoretical pIs of the CIPKs ranged from 5.52 (JsCIPK10) to 9.24 (JsCIPK6). Analysis of the pI values showed that most of the CIPK proteins were basic; only JsCIPK1 was acidic. The instability indices of JsCIPK2, JsCIPK8, JsCIPK9, JsCIPK10, and JsCIPK17 were >40, indicating that the proteins may have been unstable, whereas the other JsCIPKs were stable. The grand average hydropathicity (GRAVY) was negative, indicating a hydrophilic protein. Subcellular localization showed that all of the proteins were localized to the plasma membrane.

3.2. Phylogenetic Analysis of the CIPK Gene Family in Jasmine

To study the evolutionary relationship of CIPK proteins between jasmine, Arabidopsis, rice, and osmanthus, an ML phylogenetic tree was constructed using the CIPK amino acid sequences. The results showed that the 113 CIPKs could be divided into five subfamilies (named Groups I–V) as follows: Group I, JsCIPK2, JsCIPK3, JsCIPK5, JsCIPK6, JsCIPK13, and JsCIPK15; Group II, JsCIPK9; Goup III, JsCIPK11, and JsCIPK8; Group IV, JsCIPK12; and Group V, JsCIPK1, JsCIPK4, JsCIPK7, JsCIPK10, JsCIPK14, JsCIPK16, and JsCIPK17 (Figure 2). These results also indicated that intron-rich JsCIPKs clustered into Group V, whereas intron-poor and intron-free JsCIPKs clustered into the other four groups, which was consistent with the results for Arabidopsis.

3.3. Gene Structure and Conserved Motifs of JsCIPKs

Structural analysis of JsCIPKs showed that the sequence length of the genes ranged from 1365 bp (JsCIPK9) to 6350 bp (JsCIPK4) and contained coding sequences (CDSs) and untranslated regions (UTRs) with different numbers and lengths, respectively (Figure 3). UTR statistics showed that JsCIPK2, 3, 5, 6, 9, 11, 12, 13, 15, and 17 had both exon start and end structures. Except for JsCIPK1, all the other members of the gene family contained a complete UTR. CDS analysis showed that JsCIPK1 and JsCIPK16 contained 16 exons; JsCIPK4, JsCIPK14, and JsCIPK17 contained 14 exons; and JsCIPK7 and JsCIPK10 contained 13 exons, respectively. There were four exons each in JsCIPK5 and JsCIPK13, two in JsCIPK8 and JsCIPK12, and only one in the other JsCIPKs. The CIPK gene family members were divided into intron-harboring and intron-less types, consistent with the results of other plant CIPK gene family members. These results indicated that homologs clustered in the same subfamily have similar genetic structures and conserved functions.
The conserved motifs of the jasmine CIPK protein family were analyzed using the MEME tool, and 10 motifs were predicted. The results showed that the motifs of most JsCIPK proteins were the same in type and sequence, and the higher the homology, the higher the similarity of the motifs. Among them, JsCIPK5 lacked motif 4–7, and JsCIPK10 lacked motif 5 (Figure 3). A Batch CD-search was used to analyze the CIPK domains of jasmine. The predicted results showed the presence of the CIPK_C domain in the C-terminus of JsCIPK protein sequences, whereas the PKc_like superfamily was present in the N-terminus of JsCIPK protein sequence STKc_SnRK3, which had two different domains. The structure of the N-terminal kinase, the base of non-ferferent-1 (SNF-1) kinase, is similar to that of sucrose and matches the structural characteristics of the CIPK protein (Figure 3). In this study, JsCIPK protein sequences were homologous, and all JsCIPKs clustered into five groups, I–V, according to the type and sequence of the motifs. We speculated that homologous proteins were more similar in the same group, and that there might have been functional redundancy.

3.4. Collinearity Analysis of Jasmine CIPK Gene Family

To further understand the phylogenetic relationship of CIPKs, a collinearity analysis diagram of Arabidopsis and J. japonicum genes and a collinearity diagram of CIPK gene family members of each species were constructed. The results showed that 13 gene pairs in Arabidopsis were collinear with jasmine genes (Figure 4A). A collinear relationship was observed, including among JsCIPK15, AtCIPK12, AtCIPK13, ATCIPK18, ATCIPK19, JsCIPK2, AtCIPK12, AtCIPK13, and AtCIPK19; JsCIPK6 with AtCIPK1 and AtCIPK17; JsCIPK9 with AtCIPK4 and AtCIPK7; and JsCIPK12 with AtCIPK14 and AtCIPK22. The collinearity pairs of Arabidopsis and jasmine included JsCIPK3 and AtCIPK22; JsCIPK4 and AtCIPK3; JsCIPK13 and AtCIPK15; JsCIPK16 and AtCIPK23; and JsCIPK17 and AtCIPK21. In addition, the CIPKs of J. japonicum included four gene replication pairs: JsCIPK1:JsCIPK16, JsCIPK2:JsCIPK15, and JsCIPK3:JsCIPK14 (Figure 4B).

3.5. Analysis of Cis-Elements of CIPK Gene Family Members in Jasmine

To explore the potential functions of CIPK genes, cis-element prediction was performed on the promoter region sequence 2000 bp upstream of the JsCIPK start site (Figure 5 and Figure S1). The results demonstrated that there were several cis-elements in the promoter region, and the types and quantities of cis-elements differed in different gene members. Eight components were identified in the promoter region of CIPK, including ABRE, TGA-element, TC-rich, GARE-motif, LRE, LTR, MeJA, and SA. Except for JsCIPK4, all of the other genes contained more than four types of functional elements. All of the JsCIPKs contained light-response elements, most of which contained methyl jasmine- and abscisic acid-response elements. Among these, 14 genes had abscisic acid cis-elements; 13 had methyl jasmine cis-elements; and most had low-temperature-, salicylic acid-, and gibberellin-response elements. Three gene family members had auxin-response elements and three had defense stress elements, suggesting that the three family members with defense stress elements might be involved in the abiotic stress response in jasmine.

3.6. Expression Analysis of JsCIPK Genes

Heat map analysis revealed that JsCIPK5 was not expressed in any organ. The expression levels of JsCIPK1, JsCIPK2, JsCIPK6, JsCIPK12, and JsCIPK13 were strongly up-regulated in different tissues. Among them, JsCIPK1, JsCIPK2, and JsCIPK13 were highly expressed in flowers. JsCIPK2 and JsCIPK12 were significantly expressed in roots, whereas JsCIPK1, JsCIPK6, and JsCIPK13 were expressed in stems. The expression of JsCIPK2 in roots was higher than that in the leaves and flowers, and the expression of JsCIPK2 was relatively high in all tissues. However, other JsCIPK genes were expressed at low levels in all tissues (Figure 6).
To determine the role of JsCIPKs in the response to salt stress, the expression levels of eight JsCIPKs were analyzed (Figure 7). The results demonstrated that the expression levels of all Js CIPKs had varying degrees of response under salt stress. It is worth mentioning that the expression of JsCIPK6 was down-regulated by salt stress at different times, and the expression of JsCIPK8 was up-regulated significantly.

4. Discussion

Calcium plays an important role in regulating signal transduction pathways [39]. These pathways can be activated in response to various environmental stimuli. CBLs, acting as calcium sensors, can interact with target kinase CIPKs to regulate plant growth, development, and the response to abiotic stress [40]. The CIPK gene participates in plant development in Arabidopsis and rice [41]; however, there are no corresponding reports in jasmine. In this study, 17 CIPK gene family members were screened through bioinformatics analysis, and all of these genes were comprehensively identified, including analysis of their evolutionary relationship, chromosome structure, and chromosome distribution.
The first plant CIPK was discovered in the model plant Arabidopsis, in which 26 CIPKs have now been identified [5]. In addition, among Solanaceae plants, 15 CIPKs have been identified in eggplant [18] and 21 in pepper. Among the Gramineae, 34 CIPKs have been identified in rice [41], 51 in turnip [42], and 43 in maize [43]. Among woody plants, 16 CIPKs have been identified in plum and 20 in grapes [14]. CIPKs have also been detected in algae, mosses, ferns, Cucurbitaceae, and other plants. Analysis of the location of CIPKs on chromosomes showed that the number of CIPKs distributed on chromosomes 3, 6, and 9 was higher than that on other chromosomes, which is consistent with millet and maize in the Gramineae. Previous research has shown that the 20 grapevine VvCIPK genes were located on 11 chromosomes. Among them, three VvCIPKs were located on grapevine chromosomes 6, 10, and 11, respectively. Two VvCIPK genes were located on chromosomes 5, 8, and 9, respectively. Chromosomes 4, 13, 15, 16, and 18 had only one VvCIPK gene. However, no VvCIPK genes were located on chromosomes 1, 3, 7, 12, 14, 17, and 19. Therefore, the distribution of CIPKs on chromosomes was uneven among different species, and the uneven distribution of CIPKs might be related to species evolution and genetic variation.
NAF- and PPI-conserved motifs mediate specific binding of CBL-CIPK and PP2C-CIPK signal transduction pathways, respectively. In this study, a motif5 deletion was observed in the gene structure of JsCIPK5 and JsCIPK10. However, whether the deletion of this motif affects the signaling pathway of CIPK remains to be verified. A Batch CD-search revealed that all JsCIPKs were composed of a highly conserved kinase domain and a relatively conserved regulatory domain, reflecting the highly conserved evolutionary characteristics of JsCIPKs in jasmine. In previous studies, CIPK proteins have been reported to include a C-terminal regulatory domain and a conserved N-terminal catalytic kinase domain [44]. Among them, an activation loop and an ATP binding site was included in the N-terminal catalytic kinase domain, and an NAF/FISL motif was included in the C-terminal regulatory domain contains. The NAF/FISL motif can mediate the interaction between CIPKs and type 2C protein phosphates (PP2Cs) as well as the interaction between CIPKs and CBLs by the PPI motif. In our study, all JsCIPKs possessed an NAF domain in the C-terminal sequence and an activation domain in the N-terminal sequence.
The evolutionary relationship of CIPK proteins showed that all JsCIPKs could be divided into five groups, along with CIPKs in Arabidopsis, rice, and osmanthus. The number of JsCIPKs was highest in Group V, followed by Group I. Meanwhile, Group 4 and Group 2 had the lowest number of JsCIPKs, with only one member. The number of CIPKs of the other specials was also highest in Group I and Group V. These results also indicated that intron-rich JsCIPKs clustered into Group V, whereas intron-poor and intron-free JsCIPKs clustered into the other four groups, which was consistent with the results for Arabidopsis.
Analysis of gene expression profiling data showed that the majority of Group I JsCIPKs had significantly higher expression levels in different organs than those of other JsCIPK gene group members. However, a few members of Groups II and III also showed high expression.
Salinity is one of the major abiotic factors that limits the growth and development of plants and the productivity of crops worldwide. Studying the effects of salt coercion on the growth and development of plants, screening salted alkali plants, and improving the development and utilization of saline-alkalized soil is of great significance. Studies have shown that salt coercion often leads to plant photosynthetic ability and anti-inverse ability decline, inhibiting the germination of plant seeds and the growth and development of plants [24]. CIPKs, acting as one of the transcription factor families, have been reported to play a vital role in response to salt stress in plants. In previous studies, the expression of CIPK genes in plants revealed their important roles in response to salt stress [45,46,47]. However, the expression patterns of CIPKs in jasmine under salt stress are unclear. To further clarify whether the JsCIPK gene responds to salt stress, eight JsCIPKs with high expression levels in different organs were selected as for the determination of expression under salt stress. The results showed that most JsCIPKs were up-regulated under salt stress, and the expression level reached its highest value after 1 h of salt stress treatment. It is worth mentioning that the expression of JsCIPK6 was down-regulated by salt stress at different times, and the expression of JsCIPK8 was up-regulated significantly.
In conclusion, 17 JsCIPK genes were identified in this study, and a comprehensive bioinformatics analysis was carried out to determine gene structure, physicochemical properties, chromosomal location, expression patterns in different tissues, and collinearity. Previous studies have shown that CIPKs are involved in various abiotic stress responses, including to drought, low temperature, high pH, and high salinity. The expression levels of JsCIPK2 and JsCIPK13 were relatively high in jasmine roots, stems, leaves, and flowers, indicating that these two genes are important in the four major plant growth organs. In contrast, the expression of JsCIPK6 was relatively high in leaves and stems, but low in flowers and roots, thus indicating that this gene is mainly involved in leaf and stem development. In addition, the expression of JsCIPK6 and JsCIPK8 was significantly down-regulated and up-regulated by salt treatment, respectively. In further studies, JsCIPK6 and JsCIPK8 would be chosen as the candidate salt-tolerant genes for the functional analysis of the regulation of the response to salt stress and the genetic improvement in salt-tolerant jasmine germplasms.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/horticulturae11010040/s1, Figure S1: Analysis of specific phytohormone- and abiotic stress-related cis-elements of the 2000 bp upstream sequences. Table S1: Physiological characterization of JsCIPKs. Table S2: Protein sequences of CIPK in different specials.

Author Contributions

Conceptualization, S.Z.; methodology, J.X.; software, X.H.; validation, J.L. and L.Y.; formal analysis, R.W.; investigation, S.Z.; resources, J.L.; data curation, R.W.; writing—original draft preparation, S.Z.; writing—review and editing, L.Y.; visualization, S.Z.; supervision, R.W.; project administration, R.W.; funding acquisition, R.W. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Earmarked Fund of the Handan Science and Technology Research and Development Plan Project (21422012321) and the General Project of the Natural Science Foundation of Hebei Province (C2022402006).

Data Availability Statement

The following information was supplied regarding data availability: RNA sequencing (RNA-seq) data for expression pattern analysis of JsCIPK genes of different tissues were submitted to the National Center for Biotechnology Information SRA database under accession number SRR14317414-SRR14317417.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Xiong, L.Z.; Yang, Y.N. Disease resistance and abiotic stress tolerance in rice are inversely modulated by an abscisic acid-inducible mitogen-activated protein kinase. Plant Cell 2003, 15, 745–759. [Google Scholar] [CrossRef]
  2. Su, W.H.; Ren, Y.J.; Wang, D.J.; Huang, L.; Fu, X.Q.; Ling, H.; Su, Y.C.; Huang, N.; Tang, H.C.; Xu, L.P.; et al. New insights into the evolution and functional divergence of the CIPK gene family in Saccharum. BMC Genom. 2020, 21, 868. [Google Scholar] [CrossRef] [PubMed]
  3. Niu, L.L.; Dong, B.Y.; Song, Z.H.; Meng, D.; Fu, Y.J. Genome-wide identification and characterization of CIPK family and analysis responses to various stresses in apple (Malus domestica). Int. J. Mol. Sci. 2018, 19, 2131. [Google Scholar] [CrossRef]
  4. Sanders, D.; Pelloux, J.; Brownlee, C.; Harper, J.F. Calcium at the crossroads of signaling. Plant Cell 2002, 14 (Suppl. 1), S401–S417. [Google Scholar] [CrossRef]
  5. Yu, Y.H.; Xia, X.L.; Yin, W.L.; Zhang, H.C. Comparative genomic analysis of CIPK gene family in Arabidopsis and Populus. Plant Growth Regul. 2007, 52, 101–110. [Google Scholar] [CrossRef]
  6. Chen, X.; Gu, Z.; Xin, D.; Hao, L.; Liu, C.; Huang, J.; Ma, B.; Zhang, H. Identification and characterization of putative CIPK genes in maize. J. Genet. Genom. 2011, 38, 77–87. [Google Scholar] [CrossRef]
  7. Luan, S.; Lan, W.Z.; Lee, S.C. Potassium nutrition, sodium toxicity, and calcium signaling: Connections through the CBL-CIPK network. Curr. Opin. Plant Biol. 2009, 12, 339–346. [Google Scholar] [CrossRef] [PubMed]
  8. Dong, Q.; Wallrad, L.; Almutairi, B.O.; Kudla, J. Ca2+ signaling in plant responses to abiotic stresses. J. Integr. Plant Biol. 2022, 64, 287–300. [Google Scholar] [CrossRef]
  9. Albrecht, V.; Weinl, S.; Blazevic, D.; D’Angelo, C.; Batistic, O.; Kolukisaoglu, U.; Bock, R.; Schulz, B.; Harter, K.; Kudla, J. The calcium sensor CBL1 integrates plant responses to abiotic stresses. Plant J. 2003, 36, 457–470. [Google Scholar] [CrossRef]
  10. Hu, W.; Xia, Z.Q.; Yan, Y.; Ding, Z.H.; Tie, W.W.; Wang, L.Z.; Zou, M.L.; Wei, Y.X.; Lu, C.; Hou, X.W.; et al. Genome-wide gene phylogeny of CIPK family in cassava and expression analysis of partial drought-induced genes. Front. Plant Sci. 2015, 6, 914. [Google Scholar] [CrossRef]
  11. Albrecht, V.; Ritz, O.; Linder, S.; Harter, K.; Kudla, J. The NAF domain defines a novel protein-protein interaction module conserved in Ca2+-regulated kinases. EMBO J. 2001, 20, 1051–1063. [Google Scholar] [CrossRef]
  12. Kolukisaoglu, U.; Weinl, S.; Blazevic, D.; Batistic, O.; Kudla, J. Calcium sensors and their interacting protein kinases: Genomics of the Arabidopsis and rice CBL-CIPK signaling networks. Plant Physiol. 2004, 134, 43–58. [Google Scholar] [CrossRef]
  13. Xiang, Y.; Huang, Y.; Xiong, L. Characterization of stress-responsive CIPK genes in rice for stress tolerance improvement. Plant Physiol. 2007, 144, 1416–1428. [Google Scholar] [CrossRef] [PubMed]
  14. Xi, Y.; Liu, J.; Dong, C.; Cheng, Z.M. The CBL and CIPK Gene Family in Grapevine (Vitis vinifera): Genome-wide analysis and expression profiles in response to various abiotic stresses. Front. Plant Sci. 2017, 8, 978. [Google Scholar] [CrossRef] [PubMed]
  15. Ma, X.; Gai, W.X.; Qiao, Y.M.; Ali, M.; Wei, A.M.; Luo, D.X.; Li, Q.H.; Gong, Z.H. Identification of CBL and CIPK gene families and functional characterization of CaCIPK1 under Phytophthora capsici in pepper (Capsicum annuum L.). BMC Genom. 2019, 20, 775. [Google Scholar] [CrossRef] [PubMed]
  16. Zhang, H.F.; Liu, W.Z.; Li, H.W.; Wang, L.Y.; Deng, M.; Liang, W.W.; Deyholos, M.K.; Jiang, Y.Q. Identification and characterization of CBL and CIPK gene families in canola (Brassica napus L.). BMC Plant Biol. 2014, 14, 8. [Google Scholar] [CrossRef]
  17. Zhang, Y.; Zhou, X.N.; Liu, S.Y.; Yu, A.Z.; Yang, C.M.; Chen, X.L.; Liu, J.Y.; Wang, A.X. Identification and functional analysis of tomato CIPK gene family. Int. J. Mol. Sci. 2019, 21, 110. [Google Scholar] [CrossRef]
  18. Li, J.; Jiang, M.M.; Ren, L.; Liu, Y.; Chen, H.Y. Identification and characterization of CBL and CIPK gene families in eggplant (Solanum melongena L.). Mol. Genet. Genom. 2016, 291, 1769–1781. [Google Scholar] [CrossRef] [PubMed]
  19. Hu, D.G.; Ma, Q.J.; Sun, C.H.; Sun, M.H.; You, C.X.; Hao, Y.J. Overexpression of MdSOS2L1, a CIPK protein kinase, increases the antioxidant metabolites to enhance salt tolerance in apple and tomato. Physiol. Plant. 2016, 156, 201–214. [Google Scholar] [CrossRef]
  20. Tang, R.J.; Liu, H.; Bao, Y.; Lv, Q.D.; Yang, L.; Zhang, H.X. The woody plant poplar has a functionally conserved salt overly sensitive pathway in response to salinity stress. Plant Mol. Biol. 2010, 74, 367–380. [Google Scholar] [CrossRef]
  21. Deng, X.M.; Zhou, S.Y.; Hu, W.; Feng, J.L.; Zhang, F.; Chen, L.H.; Huang, C.; Luo, Q.C.; He, Y.Z.; Yang, G.X.; et al. Ectopic expression of wheat TaCIPK14, encoding a calcineurin B-like protein-interacting protein kinase, confers salinity and cold tolerance in tobacco. Physiol. Plant. 2013, 149, 367–377. [Google Scholar] [CrossRef]
  22. Tang, W.; Thompson, W.A. Role of the Arabidopsis calcineurin B-like protein-interacting protein kinase CIPK21 in plant cold stress tolerance. Plant Biotechnol. Rep. 2020, 14, 275–291. [Google Scholar] [CrossRef]
  23. Yan, S.H.; Ji, J.; Wang, G. Effects of salt stress on plants and the mechanism of salt tolerance. World Sci.-Technol. Rearch Dev. 2006, 28, 70–76. [Google Scholar]
  24. Papastylianou, P.; Bakogianni, N.N.; Travlos, I. Sensitivity of seed germination to salt stress in black cumin (Nigella sativa L.). Not. Bot. Horti Agrobot. Cluj-Napoca 2018, 46, 202–205. [Google Scholar] [CrossRef]
  25. Tang, Y.J.; Gao, F.L.; Yang, Z.; Wu, Z.J.; Yang, L. Complete genome analysis of jasmine virus T from Jasminum sambac in China. Arch. Virol. 2016, 161, 2033–2036. [Google Scholar] [CrossRef]
  26. Mistry, J.; Finn, R.D.; Eddy, S.R.; Bateman, A.; Punta, M. Challenges in homology search: HMMER3 and convergent evolution of coiled-coil regions. Nucleic Acids Res. 2013, 41, e121. [Google Scholar] [CrossRef]
  27. Tusnády, G.E.; Kalmár, L.; Hegyi, H.; Tompa, P.; Simon, I. TOPDOM: Database of domains and motifs with conservative location in transmembrane proteins. Bioinformatics 2008, 24, 1469–1470. [Google Scholar] [CrossRef]
  28. Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An integrative toolkit developed for interactive analyses of big biological data. Mol. Plant 2020, 8, 1194–1202. [Google Scholar] [CrossRef]
  29. Gasteiger, E.; Hoogland, C.; Gattiker, A.; Duvaud, S.; Wilkins, M.R.; Appel, R.D.; Bairoch, A. Protein Identification and Analysis Tools on the ExPASy Server. In The Proteomics Protocols Handbook; Humana Press: Totowa, NJ, USA, 2005; Volume 52, pp. 571–607. [Google Scholar]
  30. Yu, C.S.; Chen, Y.C.; Lu, C.H.; Hwang, J.K. Prediction of protein subcellular localization. Proteins 2006, 64, 643–651. [Google Scholar] [CrossRef]
  31. Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; McGettigan, P.A.; McWilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R.; et al. Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23, 2947–2948. [Google Scholar] [CrossRef]
  32. Bailey, T.L.; Nadya, W.; Chris, M.; Li, W.W. MeMe: Discovering and analyzing DNA and protein sequence motifs. Nucleic Acids Res. 2006, 34, W369–W373. [Google Scholar] [CrossRef] [PubMed]
  33. Lescot, M.; Déhais, P.; Thijs, G.; Marchal, K.; Moreau, Y.; Van de Peer, Y.; Rombauts, S. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res. 2002, 30, 325–327. [Google Scholar] [CrossRef]
  34. Shen, F. Jasminum-Sambac-Genome. Available online: https://github.com/maypoleflyn/Jasminum-sambac-genome (accessed on 20 November 2022).
  35. Voorrips, R. MapChart: Software for the graphical presentation of linkage maps and QTLs. J. Hered. 2002, 93, 77–78. [Google Scholar] [CrossRef]
  36. Wang, Y.P.; Tang, H.B.; Debarry, J.D.; Tan, X.; Li, J.P.; Wang, X.Y.; Lee, T.H.; Jin, H.Z.; Marler, B.; Guo, H.; et al. Mcscanx: A toolkit for detection and evolutionary analysis of gene synteny and collinearity. Nucleic Acids Res. 2012, 40, e49. [Google Scholar] [CrossRef]
  37. Wang, S.; Li, Q. Genome-Wide Identification of the Salvia miltiorrhiza SmCIPK gene family and revealing the salt resistance characteristic of SmCIPK13. Int. J. Mol. Sci. 2022, 23, 6861. [Google Scholar] [CrossRef]
  38. Meng, D.; Dong, B.Y.; Niu, L.L.; Song, Z.H.; Wang, L.T.; Amin, R.; Cao, H.Y.; Li, H.H.; Yang, Q.; Fu, Y.J. The pigeon pea CcCIPK14-CcCBL1 pair positively modulates drought tolerance by enhancing flavonoid biosynthesis. Plant J. 2021, 106, 1278–1297. [Google Scholar] [CrossRef]
  39. Kudla, J.; Batistic, O.; Hashimoto, K. Calcium signals: The lead currency of plant information processing. Plant Cell 2010, 22, 541–563. [Google Scholar] [CrossRef]
  40. Kim, K.N.; Cheong, Y.H.; Gupta, R.; Luan, S. Interaction specificity of Arabidopsis calcineurin B-like calcium sensors and their target kinases. Plant Physiol. 2000, 124, 1844–1853. [Google Scholar] [CrossRef]
  41. Kanwar, P.; Sanyal, S.K.; Tokas, I.; Yadav, A.K.; Pandey, A.; Kapoor, S.; Pandey, G.K. Comprehensive structural, interaction and expression analysis of CBL and CIPK complement during abiotic stresses and development in rice. Cell Calcium 2014, 56, 81–95. [Google Scholar] [CrossRef]
  42. Yin, X.; Wang, Q.L.; Chen, Q.; Xiang, N.; Yang, Y.Q.; Yang, Y.P. Genome-wide identification and functional analysis of the calcineurin B-like protein and calcineurin B-like protein-interacting protein Kinase gene families in Turnip (Brassica rapa var. rapa). Front. Plant Sci. 2017, 8, 1191. [Google Scholar] [CrossRef] [PubMed]
  43. Tai, F.J.; Yuan, Z.H.; Li, S.P.; Wang, Q.; Liu, F.Y.; Wang, W. ZmCIPK8, a CBL-interacting protein kinase, regulates maize response to drought stress. Plant Cell Tissue Organ Cult. 2015, 124, 459–469. [Google Scholar] [CrossRef]
  44. Gong, J.Y.; Shi, T.L.; Li, Y.K.; Wang, H.C.; Li, F. Genome-wide identification and characterization of calcium metabolism related gene families in Arabidopsis thaliana and their regulation by Bacillus amyloliquefaciens under high calcium stress. Front. Plant Sci. 2021, 12, 707496. [Google Scholar] [CrossRef] [PubMed]
  45. Bai, X.; Ji, J.; Wang, W.; Gu, C.; Yu, Q.; Jiang, J.; Yang, C.; Liu, G. Characterization of CBL-Interacting Protein Kinases’ Gene Family and Expression Pattern Reveal Their Important Roles in Response to Salt Stress in Poplar. Forests 2022, 13, 1353. [Google Scholar] [CrossRef]
  46. Wu, G.Q.; Xie, L.L.; Wang, J.L.; Wang, B.C.; Li, Z.Q. Genome-wide identification of CIPK genes in sugar beet (Beta vulgaris) and their expression under NaCl stress. J. Plant Growth Regul. 2022, 42, 260–274. [Google Scholar] [CrossRef]
  47. Ohta, M.; Guo, Y.; Halfter, U.; Zhu, J.K. A novel domain in the protein kinase SOS2 mediates interaction with the protein phosphatase 2C AB12. Proc. Natl. Acad. Sci. USA 2003, 100, 11771–11776. [Google Scholar] [CrossRef]
Figure 1. Chromosomal locations of J. sambac CIPK genes. The red colour represents the name of the gene that is distributed on the chromosome.
Figure 1. Chromosomal locations of J. sambac CIPK genes. The red colour represents the name of the gene that is distributed on the chromosome.
Horticulturae 11 00040 g001
Figure 2. The phylogenetic analysis of CIPK protein families across Jasmine sambac (JS) and Arabidopsis thaliana (At). The lines of different colours represent different subgroups. CIPK family members of Arabidopsis were identified in blue, and those of jasmine were identified in red.
Figure 2. The phylogenetic analysis of CIPK protein families across Jasmine sambac (JS) and Arabidopsis thaliana (At). The lines of different colours represent different subgroups. CIPK family members of Arabidopsis were identified in blue, and those of jasmine were identified in red.
Horticulturae 11 00040 g002
Figure 3. Analyses on phylogenetic relationships, motifs, and gene structures of CIPK genes from J. sambac. (A) Motif distribution of JsCIPK proteins. Protein motif architectures were indicated using MEME online tool. (B) Exon and intron structures of JsCIPK genes.
Figure 3. Analyses on phylogenetic relationships, motifs, and gene structures of CIPK genes from J. sambac. (A) Motif distribution of JsCIPK proteins. Protein motif architectures were indicated using MEME online tool. (B) Exon and intron structures of JsCIPK genes.
Horticulturae 11 00040 g003
Figure 4. Collinearity analysis of jasmine CIPK gene family. (A) Collinearity analysis of CIPKs in J. sambac, A. thaliana, and O. sativa. Different colors represent chromosomes from different species, and chromosome numbers are indicated by numbers. Gray lines in the background indicate co-lined blocks in the genomes of J. sambac and other plants, while blue lines represent CIPK gene pairs. (B) Schematic representation of the chromosomal distribution and inter chromosomal relationships of the JSCIPK gene. Gray lines indicate all homologous blocks in the J. sambac genome, and red lines indicate duplicate CIPK gene pairs. Chromosome numbers are shown in the middle of each chromosome. The red triangle represents the collinearity of CIPK family among the different species.
Figure 4. Collinearity analysis of jasmine CIPK gene family. (A) Collinearity analysis of CIPKs in J. sambac, A. thaliana, and O. sativa. Different colors represent chromosomes from different species, and chromosome numbers are indicated by numbers. Gray lines in the background indicate co-lined blocks in the genomes of J. sambac and other plants, while blue lines represent CIPK gene pairs. (B) Schematic representation of the chromosomal distribution and inter chromosomal relationships of the JSCIPK gene. Gray lines indicate all homologous blocks in the J. sambac genome, and red lines indicate duplicate CIPK gene pairs. Chromosome numbers are shown in the middle of each chromosome. The red triangle represents the collinearity of CIPK family among the different species.
Horticulturae 11 00040 g004
Figure 5. Analysis of specific phytohormone- and abiotic stress-related cis-elements of the 2000 bp upstream of 17 JsCIPK sequences.
Figure 5. Analysis of specific phytohormone- and abiotic stress-related cis-elements of the 2000 bp upstream of 17 JsCIPK sequences.
Horticulturae 11 00040 g005
Figure 6. Heatmap of CIPK gene expression in RNA-seq data in the different jasmine tissue.
Figure 6. Heatmap of CIPK gene expression in RNA-seq data in the different jasmine tissue.
Horticulturae 11 00040 g006
Figure 7. Effect of salt stress (200 mM NaCl) on the expression of eight JsCIPK genes in leaves of 3-month-old Arabian jasmine. ns represents p > 0.05, * represents p ≤ 0.05, ** represents p ≤ 0.01, *** represents p ≤ 0.001, and **** represents p ≤ 0.0001.
Figure 7. Effect of salt stress (200 mM NaCl) on the expression of eight JsCIPK genes in leaves of 3-month-old Arabian jasmine. ns represents p > 0.05, * represents p ≤ 0.05, ** represents p ≤ 0.01, *** represents p ≤ 0.001, and **** represents p ≤ 0.0001.
Horticulturae 11 00040 g007
Table 1. Gene-specific primers were designed for the expression analysis of eight JsCIPK genes by qRT-PCR.
Table 1. Gene-specific primers were designed for the expression analysis of eight JsCIPK genes by qRT-PCR.
Sequences (5′–3′)
PrimersForwardReverse
JsCIPK1GGCCTCAACCTTGCTTCTCTGTGACCCTTGCGTCCAATCT
JsCIPK2AGGTTTTGGCTCGAAAGGGTTCCGGTGTGAACCATCTTGG
JsCIPK6AGGCATGACGGAGCAAATCATCGACCCCTAGCGATTTTGG
JsCIPK7GCACCGGAGGTATTAAGCCATACGCAGCAATGACACGGAA
JsCIPK8GGGAGGCTTTTAGGGAAGGGAACCAATCGCATGACGGAGA
JsCIPK12ACGGCGCAAAAGTTGACATCGTATCCGGGTTCGGGTCAAG
JsCIPK13TCCAATCCATTTGGTGGCGAGCACATCTTTCGGCATTCCC
JsCIPK14TTGGCTATGATGGGGCAACCGCTGAACGAAAGCCAAGGTG
JsACTIN2TCTCTATGGTAACATTGTCCTGATCCAGACACTGTACTTCCTCT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, S.; Huang, X.; Yin, L.; Li, J.; Xu, J.; Wu, R. Genome-Wide Identification of the CIPK Gene Family in Jasmine and Expression Analysis Under Salt Stress. Horticulturae 2025, 11, 40. https://doi.org/10.3390/horticulturae11010040

AMA Style

Zhang S, Huang X, Yin L, Li J, Xu J, Wu R. Genome-Wide Identification of the CIPK Gene Family in Jasmine and Expression Analysis Under Salt Stress. Horticulturae. 2025; 11(1):40. https://doi.org/10.3390/horticulturae11010040

Chicago/Turabian Style

Zhang, Shuang, Xin Huang, Lili Yin, Jiawei Li, Jiacan Xu, and Ruigang Wu. 2025. "Genome-Wide Identification of the CIPK Gene Family in Jasmine and Expression Analysis Under Salt Stress" Horticulturae 11, no. 1: 40. https://doi.org/10.3390/horticulturae11010040

APA Style

Zhang, S., Huang, X., Yin, L., Li, J., Xu, J., & Wu, R. (2025). Genome-Wide Identification of the CIPK Gene Family in Jasmine and Expression Analysis Under Salt Stress. Horticulturae, 11(1), 40. https://doi.org/10.3390/horticulturae11010040

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop