The Expression and Sequence Analysis of MdMATE52 in Apple Roots During Activation of Defense Against Pythium ultimum Infection
Abstract
1. Introduction
2. Materials and Methods
2.1. Apple Plant Micropropagation by Tissue Culture-Based Procedure
2.2. Inoculum Preparation, Inoculation by Root-Dipping, and Root Tissue Collection
2.3. RNA Isolation, cDNA Synthesis, Sequence Retrieval, Primer Design, and RT-qPCR
2.4. RNA-Seq-Based Transcriptome Analysis of Defense Response in Apple Roots per Genotype and Timepoint
2.5. Cloning of Genomic Copy of MdMATE52 from Selected Apple Rootstock Genotypes and Sequence Retrieval from GDR for Selected Malus Species
| Gene # Functional Annotation | Primer F/R [5′-3′] |
|---|---|
| MD14G1012300 MATE52 promoter region Set 1 | F-5′ AAGTTCGTATCCGCAATGGC 3′ |
| R-5′ TGTTCCGAATGACGCAACTC 3′ | |
| MATE52 promoter region Set 2 | F-5′ GTCCGAATTGCGTCAACTTCC 3′ |
| R-5′ ACTAAGGTTTGCGTTCCCACA 3′ | |
| Coding region | F-5′ TTGGCATGGCAAGTGCGC 3′ |
| R-5′ TGGAAACAGTACCGGAGAGCA 3′ | |
| qPCR | F-5′ CATCGTGGGGTGGGAAATGA 3′ |
| R-5′ CGCCTTTGAGCTACCTCCTC 3′ | |
| MD02G1221400 Reference gene | F-5′ ACATCGAGAGCTTTGGCTAAC 3′ |
| R-5′ CTCCATCAGAACCACTGACATC 3′ |
2.6. Bioinformatic Analysis for the Selected Sequences of MATE Genes per Genotype and Malus Species
3. Results
3.1. Distinct Resistance Responses Between O3R5 Apple Rootstock Genotypes to P. ultimum Infection
3.2. Expression Profile of the MATE Gene Family in Response to P. ultimum Infection Between Resistant and Susceptible Genotypes
3.3. Basic Bioinformatics About the MdMATE52 Gene
3.4. Variations in Predicted Cis Elements in the Promoter Region of MdMATE52 Among O3R5 Genotypes and Malus Species
3.5. Detected Sequence Variation Within Coding Sequences
3.6. Expression Patterns of MdMATE52 During Defense Activation Among O3R5 Genotypes
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Janick, J.; Cummins, J.; Brown, S.; Hemmat, M. Apples. Fruit Breed. 1996, 1, 508. [Google Scholar] [CrossRef]
- Jaffee, B.; Abawi, G.; Mai, W. Fungi associated with roots of apple seedlings grown in soil from an apple replant site. Plant Dis. 1982, 66, 942–944. [Google Scholar] [CrossRef]
- Mazzola, M. Elucidation of the microbial complex having a causal role in the development of apple replant disease in Washington. Phytopathology 1998, 88, 930–938. [Google Scholar] [CrossRef]
- Zhu, Y.; Fazio, G.; Mazzola, M. Elucidating the molecular responses of apple rootstock resistant to ARD pathogens: Challenges and opportunities for development of genomics-assisted breeding tools. Hort. Res. 2014, 1, 14043. [Google Scholar] [CrossRef]
- Zhu, Y.; Saltzgiver, M. A systematic analysis of apple root resistance traits to Pythium ultimum infection and the underpinned molecular regulations of defense activation. Hort. Res. 2020, 7, 62. [Google Scholar] [CrossRef]
- Dixon, R.A. Natural products and plant disease resistance. Nature 2001, 411, 843. [Google Scholar] [CrossRef]
- Grayer, R.J.; Kokubun, T. Plant–fungal interactions: The search for phytoalexins and other antifungal compounds from higher plants. Phytochemistry 2001, 56, 253–263. [Google Scholar] [CrossRef]
- Geilfus, C.-M. Plant Secondary Compounds. In Controlled Environment Horticulture: Improving Quality of Vegetables and Medicinal Plants; Springer International Publishing: Cham, Switzerland, 2019; pp. 19–33. [Google Scholar]
- Meyer, J.; Murray, S.L.; Berger, D.K. Signals that stop the rot: Regulation of secondary metabolite defences in cereals. Physiol. Mol. Plant Pathol. 2016, 94, 156–166. [Google Scholar] [CrossRef]
- Zhao, N.; Wang, G.; Norris, A.; Chen, X.; Chen, F. Studying plant secondary metabolism in the age of genomics. Crit. Rev. Plant Sci. 2013, 32, 369–382. [Google Scholar] [CrossRef]
- Hammerschmidt, R. Phytoalexins: What have we learned after 60 years? Annu. Rev. Phytopathol. 1999, 37, 285–306. [Google Scholar] [CrossRef]
- Grayer, R.J.; Harborne, J.B. A survey of antifungal compounds from higher plants, 1982–1993. Phytochemistry 1994, 37, 19–42. [Google Scholar] [CrossRef]
- Nicholson, R.L.; Hammerschmidt, R. Phenolic compounds and their role in disease resistance. Annu. Rev. Phytopathol. 1992, 30, 369–389. [Google Scholar] [CrossRef]
- Shin, S.; Zheng, P.; Fazio, G.; Mazzola, M.; Main, D.; Zhu, Y. Transcriptome changes specifically associated with apple (Malus domestica) root defense response during Pythium ultimum infection. Physiol. Mol. Plant Pathol. 2016, 94, 16–26. [Google Scholar] [CrossRef]
- Zhu, Y.; Saltzgiver, M.; Zhao, J. A phenotyping protocol for detailed evaluation of apple root resistance responses utilizing tissue culture micropropagated apple plants. Am. J. Plant Sci. 2018, 9, 2183. [Google Scholar] [CrossRef]
- Zhu, Y.; Zhao, J.; Zhou, Z. Identifying an elite panel of apple rootstock germplasm with contrasting root resistance to Pythium ultimum. J. Plant Pathol. Microbiol. 2018, 9, 1000461. [Google Scholar] [CrossRef]
- Zhu, Y.; Shao, J.; Zhou, Z.; Davis, R.E. Genotype-specific suppression of multiple defense pathways in apple root during infection by Pythium ultimum. Hort. Res. 2019, 6, 10. [Google Scholar] [CrossRef]
- Zhu, Y.; Li, G.; Singh, J.; Khan, A.; Fazio, G.; Saltzgiver, M.; Xia, R. Laccase Directed Lignification Is One of the Major Processes Associated With the Defense Response Against Pythium ultimum Infection in Apple Roots. Front. Plant Sci. 2021, 12, 629776. [Google Scholar] [CrossRef]
- Zhu, Y.; Zhou, Z. Challenges and Progress in Evaluating Apple Root Resistance Responses to Pythium ultimum Infection. Am. J. Plant Sci. 2023, 14, 1410–1429. [Google Scholar] [CrossRef]
- Zhu, Y.; Shao, J.; Zhou, Z.; Davis, R.E. Comparative transcriptome analysis reveals a preformed defense system in apple root of a resistant genotype of G.935 in the absence of pathogen. Int. J. Plant Genom. 2017, 2017, 8950746. [Google Scholar] [CrossRef]
- Zhu, Y.; Zhou, Z. The genotype-specific laccase gene expression and lignin deposition patterns in apple root during Pythium ultimum infection. Fruit Res. 2021, 1, 12. [Google Scholar] [CrossRef]
- Upadhyay, N.; Kar, D.; Deepak Mahajan, B.; Nanda, S.; Rahiman, R.; Panchakshari, N.; Bhagavatula, L.; Datta, S. The multitasking abilities of MATE transporters in plants. J. Exp. Bot. 2019, 70, 4643–4656. [Google Scholar] [CrossRef] [PubMed]
- Zhao, J. Flavonoid transport mechanisms: How to go, and with whom. Trends Plant Sci. 2015, 20, 576–585. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.; Liao, L.; Xu, J.; Han, Y.; Li, L. Genome-wide identification, characterization and expression analysis of MATE family genes in apple (Malus × domestica Borkh). BMC Genom. 2021, 22, 632. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Y.; Shin, S.; Mazzola, M. Genotype responses of two apple rootstocks to infection by Pythium ultimum causing apple replant disease. Can. J. Plant Pathol. 2016, 38, 483–491. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Langmead, B.; Salzberg, S.L. Fast gapped-read alignment with Bowtie 2. Nat. Methods 2012, 9, 357. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- Kolde, R. pheatmap: Pretty Heatmaps. 2019. Available online: https://CRAN.R-project.org/package=pheatmap (accessed on 8 August 2024).
- Lescot, M.; Déhais, P.; Thijs, G.; Marchal, K.; Moreau, Y.; Van de Peer, Y.; Rouzé, P.; Rombauts, S. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res. 2002, 30, 325–327. [Google Scholar] [CrossRef]
- Chow, C.-N.; Yang, C.-W.; Wu, N.-Y.; Wang, H.-T.; Tseng, K.-C.; Chiu, Y.-H.; Lee, T.-Y.; Chang, W.-C. PlantPAN 4.0: Updated database for identifying conserved non-coding sequences and exploring dynamic transcriptional regulation in plant promoters. Nucleic Acids Res. 2024, 52, D1569–D1578. [Google Scholar] [CrossRef]
- Chen, C.; Wu, Y.; Li, J.; Wang, X.; Zeng, Z.; Xu, J.; Liu, Y.; Feng, J.; Chen, H.; He, Y. TBtools-II: A “one for all, all for one” bioinformatics platform for biological big-data mining. Mol. Plant 2023, 16, 1733–1742. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Z.; Tian, Y.; Cong, P.; Zhu, Y. Functional characterization of an apple (Malus x domestica) LysM domain receptor encoding gene for its role in defense response. Plant Sci. 2018, 269, 56–65. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Z.; Zhu, Y.; Tian, Y.; Yao, J.-L.; Bian, S.; Zhang, H.; Zhang, R.; Gao, Q.; Yan, Z. MdPR4, a pathogenesis-related protein in apple, is involved in chitin recognition and resistance response to apple replant disease pathogens. J. Plant Physiol. 2021, 260, 153390. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Y. The Feasibility of Using Autofluorescence to Detect Lignin Deposition Pattern during Defense Response in Apple Roots to Pythium ultimum Infection. Horticulturae 2022, 8, 1085. [Google Scholar] [CrossRef]
- Zhu, Y.; Jordan, R.; Zhou, Z. Microscopic features of lignin deposition patterns in young apple roots using brightfield and fluorescence imaging. Fruit Res. 2023, 4, e007. [Google Scholar] [CrossRef]
- Eckardt, N.A. Move It on Out with MATEs. Plant Cell 2001, 13, 1477–1480. [Google Scholar] [CrossRef]
- Takanashi, K.; Shitan, N.; Yazaki, K. The multidrug and toxic compound extrusion (MATE) family in plants. Plant Biotechnol. 2014, 31, 417–430. [Google Scholar] [CrossRef]
- Birkenbihl, R.P.; Liu, S.; Somssich, I.E. Transcriptional events defining plant immune responses. Curr. Opin. Plant Biol. 2017, 38, 1–9. [Google Scholar] [CrossRef]
- Chezem, W.R.; Clay, N.K. Regulation of plant secondary metabolism and associated specialized cell development by MYBs and bHLHs. Phytochemistry 2016, 131, 26–43. [Google Scholar] [CrossRef]
- Moore, J.W.; Loake, G.J.; Spoel, S.H. Transcription Dynamics in Plant Immunity. Plant Cell 2011, 23, 2809–2820. [Google Scholar] [CrossRef]
- Pireyre, M.; Burow, M. Regulation of MYB and bHLH Transcription Factors: A Glance at the Protein Level. Mol. Plant 2015, 8, 378–388. [Google Scholar] [CrossRef] [PubMed]
- Xu, W.; Dubos, C.; Lepiniec, L. Transcriptional control of flavonoid biosynthesis by MYB–bHLH–WDR complexes. Trends Plant Sci. 2015, 20, 176–185. [Google Scholar] [CrossRef] [PubMed]
- Bakshi, M.; Oelmüller, R. WRKY transcription factors: Jack of many trades in plants. Plant Signal. Behav. 2014, 9, e27700. [Google Scholar] [CrossRef] [PubMed]
- Birkenbihl, R.P.; Diezel, C.; Somssich, I.E. Arabidopsis WRKY33 is a key transcriptional regulator of hormonal and metabolic responses toward Botrytis cinerea infection. Plant Physiol. 2012, 159, 266–285. [Google Scholar] [CrossRef] [PubMed]
- Pandey, S.P.; Somssich, I.E. The role of WRKY transcription factors in plant immunity. Plant Physiol. 2009, 150, 1648–1655. [Google Scholar] [CrossRef]
- Chen, X.; Li, S.; Zhang, D.; Han, M.; Jin, X.; Zhao, C.; Wang, S.; Xing, L.; Ma, J.; Ji, J. Sequencing of a wild apple (Malus baccata) genome unravels the differences between cultivated and wild apple species regarding disease resistance and cold tolerance. G3 Genes Genomes Genet. 2019, 9, 2051–2060. [Google Scholar] [CrossRef]
- Daccord, N.; Celton, J.-M.; Linsmith, G.; Becker, C.; Choisne, N.; Schijlen, E.; Van de Geest, H.; Bianco, L.; Micheletti, D.; Velasco, R. High-quality de novo assembly of the apple genome and methylome dynamics of early fruit development. Nat. Genet. 2017, 49, 1099–1106. [Google Scholar] [CrossRef]
- Li, Z.; Wang, L.; He, J.; Li, X.; Hou, N.; Guo, J.; Niu, C.; Li, C.; Liu, S.; Xu, J. Chromosome-scale reference genome provides insights into the genetic origin and grafting-mediated stress tolerance of Malus prunifolia. Plant Biotechnol. J. 2022, 20, 1015–1017. [Google Scholar] [CrossRef]
- Velasco, R.; Zharkikh, A.; Affourtit, J.; Dhingra, A.; Cestaro, A.; Kalyanaraman, A.; Fontana, P.; Bhatnagar, S.K.; Troggio, M.; Pruss, D. The genome of the domesticated apple (Malus × domestica Borkh.). Nat. Genet. 2010, 42, 833. [Google Scholar] [CrossRef]
- Zhang, L.; Hu, J.; Han, X.; Li, J.; Gao, Y.; Richards, C.M.; Zhang, C.; Tian, Y.; Liu, G.; Gul, H. A high-quality apple genome assembly reveals the association of a retrotransposon and red fruit colour. Nat. Commun. 2019, 10, 1494. [Google Scholar] [CrossRef]
- Vance, C.; Kirk, T.; Sherwood, R. Lignification as a mechanism of disease resistance. Annu. Rev. Phytopathol. 1980, 18, 259–288. [Google Scholar] [CrossRef]
- Vanholme, R.; Demedts, B.; Morreel, K.; Ralph, J.; Boerjan, W. Lignin biosynthesis and structure. Plant Physiol. 2010, 153, 895–905. [Google Scholar] [CrossRef] [PubMed]
- Bhuiyan, N.H.; Selvaraj, G.; Wei, Y.; King, J. Role of lignification in plant defense. Plant Signal. Behav. 2009, 4, 158–159. [Google Scholar] [CrossRef] [PubMed]
- Xu, L.; Zhu, L.; Tu, L.; Liu, L.; Yuan, D.; Jin, L.; Long, L.; Zhang, X. Lignin metabolism has a central role in the resistance of cotton to the wilt fungus Verticillium dahliae as revealed by RNA-Seq-dependent transcriptional analysis and histochemistry. J. Exp. Bot. 2011, 62, 5607–5621. [Google Scholar] [CrossRef]
- Lee, M.H.; Jeon, H.S.; Kim, S.H.; Chung, J.H.; Roppolo, D.; Lee, H.J.; Cho, H.J.; Tobimatsu, Y.; Ralph, J.; Park, O.K. Lignin-based barrier restricts pathogens to the infection site and confers resistance in plants. EMBO J. 2019, 38, e101948. [Google Scholar] [CrossRef]







| HF Reference Position | 58 R | 161 R | G935 R | 47 S | 115 S | 132 S | Intron or Exon | Codon Change | Amino Acid Change |
|---|---|---|---|---|---|---|---|---|---|
| 41 | A > G | A > G | A > G | A > G | A > G | A > G | Exon | TCA > TCG | None |
| 42 | T > C | T > C | T > C | Exon | TAT > CAT | Y > H | |||
| 296 | G > A | G > A | G > A | G > A | Exon | GCG > GCA | None | ||
| 364 | A > T | A > T | A > T | A > T | Exon | TAT > TTT | Y > F | ||
| 614/615 | G INS | G INS | A INS | G INS | G INS | Intron | NA | NA | |
| 630 | C > T | C > T | C > T | C > T | Intron | NA | NA | ||
| 786 | G > T | G > T | G > T | G > T | G > T | G > T | Exon | GTG > GTT | None |
| 885 | G > T | G > T | Intron | NA | NA | ||||
| 995 | G > A | G > A | G > A | G > A | Intron | NA | NA | ||
| 1164 | G > A | Exon | GGA > AGA | G > R |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhu, Y.; Ortiz-Uriarte, B.; Rainbow, J.; Zhou, Z. The Expression and Sequence Analysis of MdMATE52 in Apple Roots During Activation of Defense Against Pythium ultimum Infection. Horticulturae 2024, 10, 1204. https://doi.org/10.3390/horticulturae10111204
Zhu Y, Ortiz-Uriarte B, Rainbow J, Zhou Z. The Expression and Sequence Analysis of MdMATE52 in Apple Roots During Activation of Defense Against Pythium ultimum Infection. Horticulturae. 2024; 10(11):1204. https://doi.org/10.3390/horticulturae10111204
Chicago/Turabian StyleZhu, Yanmin, Bianca Ortiz-Uriarte, Jordan Rainbow, and Zhe Zhou. 2024. "The Expression and Sequence Analysis of MdMATE52 in Apple Roots During Activation of Defense Against Pythium ultimum Infection" Horticulturae 10, no. 11: 1204. https://doi.org/10.3390/horticulturae10111204
APA StyleZhu, Y., Ortiz-Uriarte, B., Rainbow, J., & Zhou, Z. (2024). The Expression and Sequence Analysis of MdMATE52 in Apple Roots During Activation of Defense Against Pythium ultimum Infection. Horticulturae, 10(11), 1204. https://doi.org/10.3390/horticulturae10111204

