Evaluation of the Marine Bacterial Population in the Great Bitter Lake, Egypt, as a Source of Antimicrobial Secondary Metabolites
Abstract
:1. Introduction
2. Materials and Methods
2.1. Samples Collection
2.2. Quantification of PKSs Gene Clusters in Samples’ Total Community DNA
2.3. Isolation and Purification of Culturable Bacteria
2.4. Standard Indicator Microorganisms
2.5. Evaluation of the Antimicrobial Activity
2.5.1. Screening the Antagonistic Behavior of the Bacteria Isolates
2.5.2. Screening the Antimicrobial Activity of the Cell-Free Bacterial Metabolic Extract
2.6. Isolates Identification and Phylogenetic Analysis
2.6.1. Genomic DNA Extraction and Amplification and Sequencing of 16S rRNA Gene PCR Products
2.6.2. Phylogenetic Analysis
2.7. Screening of Bacillus Iturin Family Lipopeptides
2.8. Liquid Chromatography–Mass Spectroscopy Analysis of the Metabolic Extracts
3. Results
3.1. Biosynthetic Genes Abundance in Total Community-DNA (TC-DNA)
3.2. Isolation of Marine Bacteria
3.3. The Antagonistic Behavior and Antimicrobial Activity of the Bacterial Isolates and Their Metabolic Extracts
3.4. Phylogenetic Analysis
3.5. Amplification of Iturin Family Lipopeptides Coding Genes
3.6. Liquid Chromatography–Mass Spectroscopy Analysis of the Metabolic Extracts
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Dadgostar, P. Antimicrobial resistance: Implications and costs. Infect. Drug Resist. 2019, 12, 3903–3910. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Aminov, R.I. A brief history of the antibiotic era: Lessons learned and challenges for the future. Front. Microbiol. 2010, 1, 134. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hoffman, P.S. Antibacterial discovery: 21st century challenges. Antibiotiotics 2020, 9, 213. [Google Scholar] [CrossRef]
- Atanasov, A.G.; Zotchev, S.B.; Dirsch, V.M.; Orhan, I.E.; Banach, M.; Rollinger, J.M.; Barreca, D.; Weckwerth, W.; Bauer, R.; Bayer, E.A.; et al. Natural products in drug discovery: Advances and opportunities. Nat. Rev. Drug Discov. 2021, 20, 200–216. [Google Scholar] [CrossRef]
- Singh, B.P.; Rateb, M.E.; Rodriguez-Couto, S.; De Lourdes Teixeira De Moraes Polizeli, M.; Li, W.J. Editorial: Microbial secondary metabolites: Recent developments and technological challenges. Front. Microbiol. 2019, 10, 914. [Google Scholar] [CrossRef] [PubMed]
- Barzkar, N.; Jahromi, S.T.; Poorsaheli, H.B.; Vianello, F. Metabolites from marine microorganisms, micro, and macroalgae: Immense scope for pharmacology. Mar. Drugs 2019, 17, 464. [Google Scholar] [CrossRef] [Green Version]
- Bérdy, J. Bioactive microbial metabolites: A personal view. J. Antibiot. 2005, 58, 1–26. [Google Scholar] [CrossRef] [Green Version]
- Tran, P.N.; Yen, M.R.; Chiang, C.Y.; Lin, H.C.; Chen, P.Y. Detecting and prioritizing biosynthetic gene clusters for bioactive compounds in bacteria and fungi. Appl. Microbiol. Biotechnol. 2019, 103, 3277–3287. [Google Scholar] [CrossRef] [Green Version]
- Ridley, C.P.; Ho, Y.L.; Khosla, C. Evolution of polyketide synthases in bacteria. Proc. Natl. Acad. Sci. USA 2008, 105, 4595–4600. [Google Scholar] [CrossRef] [Green Version]
- Olishevska, S.; Nickzad, A.; Déziel, E. Bacillus and Paenibacillus secreted polyketides and peptides involved in controlling human and plant pathogens. Appl. Microbiol. Biotechnol. 2019, 103, 1189–1215. [Google Scholar] [CrossRef]
- Penesyan, A.; Kjelleberg, S.; Egan, S. Development of novel drugs from marine surface associated microorganisms. Mar. Drugs 2010, 8, 438–459. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wiese, J.; Imhoff, J.F. Marine bacteria and fungi as promising source for new antibiotics. Drug Dev. Res. 2019, 80, 24–27. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Elton, C.S. Charles Elton the Ecology of Invasions by Animals and Plants; University of Chicago Press: Chicago, IL, USA, 2000. [Google Scholar]
- El-serehy, H.A.; Abdallah, H.S.; Al-misned, F.A.; Irshad, R.; Al-farraj, S.A.; Almalki, E.S. Aquatic ecosystem health and trophic status classification of the Bitter Lakes along the main connecting link between the Red Sea and the Mediterranean. Saudi J. Biol. Sci. 2018, 25, 204–212. [Google Scholar] [CrossRef]
- Mahapatra, G.P.; Raman, S.; Nayak, S.; Gouda, S.; Das, G.; Patra, J.K. Metagenomics Approaches in Discovery and Development of New Bioactive Compounds from Marine Actinomycetes. Curr. Microbiol. 2020, 77, 645–656. [Google Scholar] [CrossRef] [PubMed]
- Xiong, Z.; Wang, J.; Hao, Y.; Wang, Y. Recent Advances in the Discovery and Development of Marine Microbial Natural Products. Mar. Drugs 2013, 11, 700–717. [Google Scholar] [CrossRef] [Green Version]
- Le, T.H.; Sivachidambaram, V.; Yi, X.; Li, X.; Zhou, Z. Quantification of polyketide synthase genes in tropical urban soils using real-time PCR. J. Microbiol. Methods 2014, 106, 135–142. [Google Scholar] [CrossRef]
- Metsä-Ketelä, M.; Salo, V.; Halo, L.; Hautala, A.; Hakala, J.; Mäntsälä, P.; Ylihonko, K. An efficient approach for screening minimal PKS genes from Streptomyces. FEMS Microbiol. Lett. 1999, 180, 1–6. [Google Scholar] [CrossRef]
- Fierer, N.; Jackson, J.A.; Vilgalys, R.; Jackson, R.B. Assessment of soil microbial community structure by use of taxon-specific quantitative PCR assays. Appl. Environ. Microbiol. 2005, 71, 4117–4120. [Google Scholar] [CrossRef] [Green Version]
- Joint, I.; Mühling, M.; Querellou, J. Culturing marine bacteria—An essential prerequisite for biodiscovery: Minireview. Microb. Biotechnol. 2010, 3, 564–575. [Google Scholar] [CrossRef] [Green Version]
- Yang, Y.W.; Chen, M.K.; Yang, B.Y.; Huang, X.J.; Zhang, X.R.; He, L.Q.; Zhang, J.; Hua, Z.C. Use of 16S rRNA gene-targeted group-specific primers for real-time PCR analysis of predominant bacteria in mouse feces. Appl. Environ. Microbiol. 2015, 81, 6749–6756. [Google Scholar] [CrossRef] [Green Version]
- Ismail, A.; Ktari, L.; Ahmed, M.; Bolhuis, H.; Boudabbous, A.; Stal, L.J.; Cretoiu, M.S.; El Bour, M. Antimicrobial activities of bacteria associated with the brown alga padina pavonica. Front. Microbiol. 2016, 7, 1072. [Google Scholar] [CrossRef] [Green Version]
- Elsayed, T.R.; Grosch, R.; Smalla, K. Potato plant spheres and to a lesser extent the soil type influence the proportion and diversity of bacterial isolates with in vitro antagonistic activity towards Ralstonia solanacearum. FEMS Microbiol. Ecol. 2021, 97, fiab038. [Google Scholar] [CrossRef] [PubMed]
- Madeira, F.; Park, Y.M.; Lee, J.; Buso, N.; Gur, T.; Madhusoodanan, N.; Basutkar, P.; Tivey, A.R.N.; Potter, S.C.; Finn, R.D.; et al. The EMBL-EBI search and sequence analysis tools APIs in 2019. Nucleic Acids Res. 2019, 47, W636–W641. [Google Scholar] [CrossRef] [Green Version]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
- Kimura, M. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 1980, 16, 111–120. [Google Scholar] [CrossRef] [PubMed]
- Raaijmakers, J.M.; de Bruijn, I.; Nybroe, O.; Ongena, M. Natural functions of lipopeptides from Bacillus and Pseudomonas: More than surfactants and antibiotics. FEMS Microbiol. Rev. 2010, 34, 1037–1062. [Google Scholar] [CrossRef] [Green Version]
- Gond, S.K.; Bergen, M.S.; Torres, M.S.; White, J.F. Endophytic Bacillus spp. produce antifungal lipopeptides and induce host defence gene expression in maize. Microbiol. Res. 2015, 172, 79–87. [Google Scholar] [CrossRef]
- Van Santen, J.A.; Jacob, G.; Singh, A.L.; Aniebok, V.; Balunas, M.J.; Bunsko, D.; Neto, F.C.; Castaño-Espriu, L.; Chang, C.; Clark, T.N.; et al. The Natural Products Atlas: An Open Access Knowledge Base for Microbial Natural Products Discovery. ACS Cent. Sci. 2019, 5, 1824–1833. [Google Scholar] [CrossRef] [Green Version]
- Feichtmayer, J.; Deng, L.; Griebler, C. Antagonistic microbial interactions: Contributions and potential applications for controlling pathogens in the aquatic systems. Front. Microbiol. 2017, 8, 2192. [Google Scholar] [CrossRef]
- Mondol, M.A.M.; Shin, H.J.; Islam, M.T. Diversity of secondary metabolites from marine bacillus species: Chemistry and biological activity. Mar. Drugs 2013, 11, 2846–2872. [Google Scholar] [CrossRef] [Green Version]
- Zhao, H.; Shao, D.; Jiang, C.; Shi, J.; Li, Q.; Huang, Q.; Rajoka, M.S.R.; Yang, H.; Jin, M. Biological activity of lipopeptides from Bacillus. Appl. Microbiol. Biotechnol. 2017, 101, 5951–5960. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Liu, S.; Jiang, Z.; Sun, C. Catechol amide iron chelators produced by a mangrove-derived Bacillus subtilis. Tetrahedron 2017, 73, 5245–5252. [Google Scholar] [CrossRef]
- Mondol, M.A.M.; Kim, J.H.; Lee, M.A.; Tareq, F.S.; Lee, H.S.; Lee, Y.J.; Shin, H.J. Ieodomycins A-D, antimicrobial fatty acids from a marine Bacillus sp. J. Nat. Prod. 2011, 74, 1606–1612. [Google Scholar] [CrossRef] [PubMed]
- Azumi, M.; Ogawa, K.-I.; Fujita, T.; Takeshita, M.; Yoshida, R.; Furumai, T.; Igarashi, Y. Bacilosarcins A and B, novel bioactive isocoumarins with unusual heterocyclic cores from the marine-derived bacterium Bacillus subtilis. Tetrahedron 2008, 64, 6420–6425. [Google Scholar] [CrossRef]
- Asolkar, R.N.; Kamat, V.P.; Wagner-Döbler, I.; Laatsch, H. Limnazine, the first bacterial azine derivative from Bacillus sp. GW90a. J. Nat. Prod. 2002, 65, 1664–1666. [Google Scholar] [CrossRef]
- Zhou, S.Y.; Hu, Y.J.; Meng, F.C.; Qu, S.Y.; Wang, R.; Andersen, R.J.; Liao, Z.H.; Chen, M. Bacillamidins A-G from a marine-derived bacillus pumilus. Mar. Drugs 2018, 16, 326. [Google Scholar] [CrossRef] [Green Version]
- Yoo, J.S.; Zheng, C.J.; Lee, S.; Kwak, J.H.; Kim, W.G. Macrolactin N, a new peptide deformylase inhibitor produced by Bacillus subtilis. Bioorg. Med. Chem. Lett. 2006, 16, 4889–4892. [Google Scholar] [CrossRef]
- Bai, J.; Liu, D.; Yu, S.; Proksch, P.; Lin, W. Amicoumacins from the marine-derived bacterium Bacillus sp. with the inhibition of NO production. Tetrahedron Lett. 2014, 55, 6286–6291. [Google Scholar] [CrossRef]
- Hai, Y.; Wei, M.Y.; Wang, C.Y.; Gu, Y.C.; Shao, C.L. The intriguing chemistry and biology of sulfur-containing natural products from marine microorganisms (1987–2020). Mar. Life Sci. Technol. 2021, 3, 488–518. [Google Scholar] [CrossRef]
- Nagao, T.; Adachi, K.; Sakai, M.; Nishijima, M.; Sano, H. Novel macrolactins as antibiotic lactones from a marine bacterium. J. Antibiot. 2001, 54, 333–339. [Google Scholar] [CrossRef] [Green Version]
- Peng, C.; Wang, H.; Jiang, Y.; Yang, J.; Lai, H.; Wei, X. Exploring the Abundance and Diversity of Bacterial Communities and Quantifying Antibiotic-Related Genes Along an Elevational Gradient in Taibai Mountain, China. Microb. Ecol. 2018, 76, 1053–1062. [Google Scholar] [CrossRef]
- D’hondt, S.; Inagaki, F.; Zarikian, C.A.; Abrams, L.J.; Dubois, N.; Engelhardt, T.; Evans, H.; Ferdelman, T.; Gribsholt, B.; Harris, R.N.; et al. Presence of oxygen and aerobic communities from sea floor to basement in deep-sea sediments. Nat. Geosci. 2015, 8, 299–304. [Google Scholar] [CrossRef] [Green Version]
- Ghanem, N.B.; Sabry, S.A.; El-Sherif, Z.M.; Abu El-Ela, G.A. Isolation and enumeration of marine actinomycetes from seawater and sediments in Alexandria. J. Gen. Appl. Microbiol. 2000, 46, 105–111. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vijayabaskara Sethubathi, G.V.; Sivakumar, K.; Thangaradjou, T.; Kannan, L. Ecology and population density of the marine actinobacteria of little Andaman island, India. Indian. J. Mar. Sci. 2013, 42, 390–401. [Google Scholar]
- Sedeek, A.M.; Ismail, M.M.; Elsayed, T.R.; Ramadan, M.A. Recent methods for discovering novel bioactive metabolites, specifically antimicrobial agents, from marine-associated microorganisms. Lett. Appl. Microbiol. 2022, in press. [Google Scholar] [CrossRef]
- Stincone, P.; Brandelli, A. Marine bacteria as source of antimicrobial compounds. Crit. Rev. Biotechnol. 2020, 40, 306–319. [Google Scholar] [CrossRef]
- Devi, P.; Wahidullah, S.; Rodrigues, C.; Souza, L.D. The sponge-associated bacterium Bacillus licheniformis SAB1: A source of antimicrobial compounds. Mar. Drugs 2010, 8, 1203–1212. [Google Scholar] [CrossRef]
- Alvarez-Ordóñez, A.; Begley, M.; Clifford, T.; Deasy, T.; Considine, K.; O’Connor, P.; Paul Ross, R.; Hill, C. Investigation of the Antimicrobial Activity of Bacillus licheniformis Strains Isolated from Retail Powdered Infant Milk Formulae. Probiotics Antimicrob. Proteins 2014, 6, 32–40. [Google Scholar] [CrossRef]
- Arena, A.; Maugeri, T.L.; Pavone, B.; Iannello, D.; Gugliandolo, C.; Bisignano, G. Antiviral and immunoregulatory effect of a novel exopolysaccharide from a marine thermotolerant Bacillus licheniformis. Int. Immunopharmacol. 2006, 6, 8–13. [Google Scholar] [CrossRef]
- Hamza, F.; Kumar, A.R.; Zinjarde, S. Antibiofilm potential of a tropical marine Bacillus licheniformis isolate: Role in disruption of aquaculture associated biofilms. Aquac. Res. 2016, 47, 2661–2669. [Google Scholar] [CrossRef]
- Freitas-Silva, J.; de Oliveira, B.F.R.; Vigoder, F.D.M.; Muricy, G.; Dobson, A.D.W.; Laport, M.S. Peeling the Layers Away: The Genomic Characterization of Bacillus pumilus 64-1, an Isolate with Antimicrobial Activity From the Marine Sponge Plakina cyanorosea (Porifera, Homoscleromorpha). Front. Microbiol. 2021, 11, 592735. [Google Scholar] [CrossRef] [PubMed]
- Saggese, A.; Culurciello, R.; Casillo, A.; Corsaro, M.M.; Ricca, E.; Baccigalupi, L. A marine isolate of bacillus pumilus secretes a pumilacidin active against staphylococcus aureus. Mar. Drugs 2018, 16, 180. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Martínez-Luis, S.; Gómez, J.F.; Spadafora, C.; Guzmán, H.M.; Gutiérrez, M. Antitrypanosomal alkaloids from the marine bacterium Bacillus pumilus. Molecules 2012, 17, 11146–11155. [Google Scholar] [CrossRef] [PubMed]
- Banerjee, A.; Mohammed Breig, S.J.; Gómez, A.; Sánchez-Arévalo, I.; González-Faune, P.; Sarkar, S.; Bandopadhyay, R.; Vuree, S.; Cornejo, J.; Tapia, J.; et al. Optimization and Characterization of a Novel Exopolysaccharide from Bacillus haynesii CamB6 for Food Applications. Biomolecules 2022, 12, 834. [Google Scholar] [CrossRef]
- Peypoux, F.; Guinand, M.; Michel, G.; Delcambe, L.; Das, B.C.; Lederer, E. Structure of Iturine A, a Peptidolipid Antibiotic from Bacillus subtilis. Biochemistry 1978, 17, 3992–3996. [Google Scholar] [CrossRef]
- Ramachandran, R.; Chalasani, A.G.; Lal, R.; Roy, U. A broad-spectrum antimicrobial activity of bacillus subtilis RLID 12.1. Sci. World J. 2014, 2014, 1–10. [Google Scholar] [CrossRef] [Green Version]
- Ouoba, L.I.I.; Diawara, B.; Jespersen, L.; Jakobsen, M. Antimicrobial activity of Bacillus subtilis and Bacillus pumilus during the fermentation of African locust bean (Parkia biglobosa) for Soumbala production. J. Appl. Microbiol. 2007, 102, 963–970. [Google Scholar] [CrossRef]
- Sawale, A.; Kadam, T.A.; Karale, M.A.; Kadam, O.A. Antimicrobial Activity of Secondary Metabolites from Halophilic Bacillus pumilus sp. Int. J. Curr. Microbiol. App. Sci. 2014, 3, 506–512. [Google Scholar]
- Todorova, S.; Kozhuharova, L. Characteristics and antimicrobial activity of Bacillus subtilis strains isolated from soil. World J. Microbiol. Biotechnol. 2010, 26, 1207–1216. [Google Scholar] [CrossRef]
- De Carvalho, C.C.C.R.; Fernandes, P. Production of metabolites as bacterial responses to the marine environment. Mar. Drugs 2010, 8, 705–727. [Google Scholar] [CrossRef]
- Wu, T.; Xiao, F.; Li, W. Macrolactins: Biological activity and biosynthesis. Mar. Life Sci. Technol. 2021, 3, 62–68. [Google Scholar] [CrossRef]
Primer | Sequence (5′–3′) | Target | Ref. |
---|---|---|---|
PKS1-F PKS1-R | CGGGGCACCGCCATSAACMASGRCG CGCCCAGCGGGGTGSCSGTNCCGTG | PKS-I | [17] |
PF6 PR6 | TSGCSTGCTTGGAYGCSATC TGGAANCCGCCGAABCCGCT | PKS-II | [18] |
Eub338 Eub518 | ACTCCTACGGGAGGCAGCAG ATTACCGCGGCTGCTGG | Total bacterial 16S rRNA | [19] |
Firm352F Firm525R | CAGCAGTAGGGAATCTTC ACCTACGTATTACCGCGG | Firmicutes, 16S rRNA | [20] |
Isolate I.D | Recovery Medium | Standard Strain | ||||
---|---|---|---|---|---|---|
E.C | S.A | B.C | P.A | C.A | ||
R-1 | R2A | +/− | + | + | − | +/− |
R-4 | R2A | + | + | + | + | + |
N-5 | N.A | − | − | − | − | + |
R-11 | R2A | +/− | + | + | − | + |
N-13 | N.A | − | + | + | − | − |
R-19 | R2A | − | + | + | − | − |
R-20 | R2A | − | + | + | − | − |
S-30 | SCA | − | +/− | − | − | − |
N-34 | N.A | − | + | +/− | − | − |
S-41 | SCA | − | − | − | − | +/− |
Isolate I.D | Sequence Size | Most Related Strain (Accession Number) | Score | Query Coverage | Percent Identity |
---|---|---|---|---|---|
R-1 | 1030 | Bacillus licheniformis ATCC 14580 (NR_074923.1) | 1864 | 100% | 99.32% |
R-4 | 1050 | Bacillus pumilus ATCC 7061 (NR_043242.1) | 1906 | 100% | 99.43% |
R-11 | 1001 | Bacillus subtilis DSM 10 (NR_027552.1) | 1838 | 100% | 99.80% |
R-19 | 1002 | Bacillus haynesii NRRL B-41327 (NR_157609.1) | 1796 | 100% | 99.00% |
Isolate | Exact Mass (Daltons) | Probable Metabolite | Reported Bioactivity | Origin | BGC | Ref. |
---|---|---|---|---|---|---|
R-1 | 882.2382 | Tribenglthin A | Antioxidant | Soil Bacillus subtilis | NRPS | [33] |
184.1250 | Ieodomycin D | Antimicrobial | Marine Bacillus sp. | FAS | [34] | |
R-4 | 493.2298 | Bacilosarcin B | Plant growth inhibitor | Marine Bacillus subtilis | PKS-I/NRPS | [35] |
184.1288 | Ieodomycin D | Antimicrobial | Marine Bacillus sp. | FAS | [34] | |
R-11 | 376.2092 | Limnazine | - | Bacillus sp. GW90 | - | [36] |
310.2435 | Bacillamidin C | Antibacterial, cytotoxic | Marine Bacillus pumilus | - | [37] | |
386.2461 | Macrolactin N | Antibacterial | Soil Bacillus subtilis | PKS-I | [38] | |
R-19 | 372.1529 | Bacillcoumacin G | NO production inhibitor | Marine Bacillus sp. | PKS-I/NRPS | [39,40] |
402.2349 | Macrolactin G | Antibacterial | Marine Bacillus sp. PP19-H3 | PKS-I | [41] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sedeek, A.M.; Ismail, M.M.; Elsayed, T.R.; Ramadan, M.A. Evaluation of the Marine Bacterial Population in the Great Bitter Lake, Egypt, as a Source of Antimicrobial Secondary Metabolites. Fermentation 2022, 8, 309. https://doi.org/10.3390/fermentation8070309
Sedeek AM, Ismail MM, Elsayed TR, Ramadan MA. Evaluation of the Marine Bacterial Population in the Great Bitter Lake, Egypt, as a Source of Antimicrobial Secondary Metabolites. Fermentation. 2022; 8(7):309. https://doi.org/10.3390/fermentation8070309
Chicago/Turabian StyleSedeek, Abdelrahman M., Maha M. Ismail, Tarek R. Elsayed, and Mohamed A. Ramadan. 2022. "Evaluation of the Marine Bacterial Population in the Great Bitter Lake, Egypt, as a Source of Antimicrobial Secondary Metabolites" Fermentation 8, no. 7: 309. https://doi.org/10.3390/fermentation8070309