Biosynthesis of Guanidinoacetate by Bacillus subtilis Whole-Cell Catalysis
Abstract
1. Introduction
2. Materials and Methods
2.1. Plasmids and Strains
2.2. Whole-Cell Catalysis of GAA
2.3. Analytical Methods
2.4. Design and Flow Screening of the Degenerate Primers
3. Results
3.1. Constructing GAA Biosynthetic Pathway in B. subtilis
3.2. Optimizing RBS and NCS of agaT
3.3. Knocking-Out of the Substrate Catabolic Pathway
3.4. Enhancing Endogenous Ornithine Cycle of B. subtilis
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Larsen, S.D.; Connell, M.A.; Cudahy, M.M.; Evans, B.R.; May, P.D.; Meglasson, M.D.; O’Sullivan, T.J.; Schostarez, H.J.; Sih, J.C.; Stevens, F.C.; et al. Synthesis and biological activity of analogues of the antidiabetic/antiobesity agent 3-guanidinopropionic acid: Discovery of a novel aminoguanidinoacetic acid antidiabetic agent. J. Med. Chem. 2001, 44, 1217–1230. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Michiels, J.; Maertens, L.; Buyse, J.; Lemme, A.; Rademacher, M.; Dierick, N.A.; De Smet, S. Supplementation of guanidinoacetic acid to broiler diets: Effects on performance, carcass characteristics, meat quality, and energy metabolism. Poult. Sci. 2012, 91, 402–412. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- da Silva, R.P.; Clow, K.; Brosnan, J.T.; Brosnan, M.E. Synthesis of guanidinoacetate and creatine from amino acids by rat pancreas. Br. J. Nutr. 2014, 111, 571–577. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Appleyard, G.; Woods, D.D. The pathway of creatine catabolism by Pseudomonas ovalis. J. Gen. Microbiol. 1956, 14, 351–365. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yan, Z.; Yan, Z.; Liu, S.; Yin, Y.; Yang, T.; Chen, Q. Regulative Mechanism of Guanidinoacetic Acid on Skeletal Muscle Development and Its Application Prospects in Animal Husbandry: A Review. Front. Nutr. 2021, 8, 714567. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barón-Sola, Á.; Sanz-Alférez, S.; Del Campo, F.F. First evidence of accumulation in cyanobacteria of guanidinoacetate, a precursor of the toxin cylindrospermopsin. Chemosphere 2015, 119, 1099–1104. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- da Silva, R.P.; Nissim, I.; Brosnan, M.E.; Brosnan, J.T. Creatine synthesis: Hepatic metabolism of guanidinoacetate and creatine in the rat in vitro and in vivo. Am. J. Physiol. Endocrinol. Metab. 2009, 296, E256–E261. [Google Scholar] [CrossRef] [Scilit]
- Ostojic, S.M. Nutraceuticals for L-Arginine:glycine Amidinotransferase Modulation: An Overview. Curr. Top. Nutraceutical Res. 2021, 19, 235–239. [Google Scholar] [CrossRef] [Scilit]
- Muenchhoff, J.; Siddiqui, K.S.; Poljak, A.; Raftery, M.J.; Barrow, K.D.; Neilan, B.A. A novel prokaryotic L-arginine:glycine amidinotransferase is involved in cylindrospermopsin biosynthesis. FEBS J. 2010, 277, 3844–3860. [Google Scholar] [CrossRef] [Scilit]
- Humm, A.; Fritsche, E.; Steinbacher, S.; Huber, R. Crystal structure and mechanism of human L-arginine:glycine amidinotransferase: A mitochondrial enzyme involved in creatine biosynthesis. EMBO J. 1997, 16, 3373–3385. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Zhou, H.; Tao, Y.; Lin, B. Reconstitution of the Ornithine Cycle with Arginine:Glycine Amidinotransferase to Engineer Escherichia coli into an Efficient Whole-Cell Catalyst of Guanidinoacetate. ACS Synth. Biol. 2020, 9, 2066–2075. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, L.; Tian, R.; Shen, Q.; Liu, Y.; Liu, L.; Li, J.; Du, G. Pathway Engineering of Bacillus subtilis for Enhanced N-Acetylneuraminic Acid Production via Whole-Cell Biocatalysis. Biotechnol. J. 2019, 14, e1800682. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- van Dijl, J.M.; Hecker, M. Bacillus subtilis: From soil bacterium to super-secreting cell factory. Microb. Cell Fact. 2013, 12, 3. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, Y.; Liu, Y.; Lv, X.; Li, J.; Du, G.; Liu, L. CAMERS-B: CRISPR/Cpf1 assisted multiple-genes editing and regulation system for Bacillus subtilis. Biotechnol. Bioeng. 2020, 117, 1817–1825. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gibson, D.G. Enzymatic assembly of overlapping DNA fragments. In Methods in Enzymology; Academic Press: London, UK, 2011; Volume 498, pp. 349–361. [Google Scholar]
- Nguyen, H.D.; Phan, T.T.; Schumann, W. Expression vectors for the rapid purification of recombinant proteins in Bacillus subtilis. Curr. Microbiol. 2007, 55, 89–93. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yan, X.; Yu, H.J.; Hong, Q.; Li, S.P. Cre/lox system and PCR-based genome engineering in Bacillus subtilis. Appl. Environ. Microbiol. 2008, 74, 5556–5562. [Google Scholar] [CrossRef] [Scilit]
- Alper, H.; Fischer, C.; Nevoigt, E.; Stephanopoulos, G. Tuning genetic control through promoter engineering. Proc. Natl. Acad. Sci. USA 2005, 102, 12678–12683. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.; Cao, Y.; Liu, Y.; Liu, L.; Li, J.; Du, G.; Chen, J. Development and optimization of N-acetylneuraminic acid biosensors in Bacillus subtilis. Biotechnol. Appl. Biochem. 2020, 67, 693–705. [Google Scholar] [CrossRef] [Scilit]
- Tian, R.; Liu, Y.; Chen, J.; Li, J.; Liu, L.; Du, G.; Chen, J. Synthetic N-terminal coding sequences for fine-tuning gene expression and metabolic engineering in Bacillus subtilis. Metab. Eng. 2019, 55, 131–141. [Google Scholar] [CrossRef] [Scilit]
- Tian, R.; Liu, Y.; Cao, Y.; Zhang, Z.; Li, J.; Liu, L.; Du, G.; Chen, J. Titrating bacterial growth and chemical biosynthesis for efficient N-acetylglucosamine and N-acetylneuraminic acid bioproduction. Nat. Commun. 2020, 11, 5078. [Google Scholar] [CrossRef] [Scilit]
- Johnson, J.L.; West, J.K.; Nelson, A.D.; Reinhart, G.D. Resolving the fluorescence response of Escherichia coli carbamoyl phosphate synthetase: Mapping intra-and intersubunit conformational changes. Biochemistry 2007, 46, 387–397. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Du, J.; Wu, J.; Dai, G.; Wang, C.; Zhou, X.; Song, M.; Li, J.; Li, J. Metabolism of Escherichia coli is interfered by Bacillus subtilis glnA gene. Chin. J. Biotechnol. 2009, 25, 626–631. [Google Scholar]
- Papierz, M.; Gadomska, G.; Sobierajski, B.; Chmiel, A. Selection and activation of Escherichia coli strains for L-aspartic acid biosynthesis. Pol. J. Microbiol. 2007, 56, 71–76. [Google Scholar] [PubMed]




| Plasmids | |
|---|---|
| pHT01 | Ampr, Cmr, E. coli-B. subtilis shuttle vector |
| pHT01-PlytR-AgaT | pHT01 derivate with agaT cloned under the control of PlytR promoter |
| pHT01-P43-AgaT | pHT01 derivate with agaT cloned under the control of P43 promoter |
| pHT01-P333-AgaT | pHT01 derivate with agaT cloned under the control of P333 promoter |
| pHT01-P566-AgaT | pHT01 derivate with agaT cloned under the control of P566 promoter |
| pHT01-Px-AgaT-GFP | pHT01-Px-AgaT derivate with GFP via a short linker, X stands for different promoters, including PlytR, P43, P333, P566 |
| pHT01-AgaT-X | pHT01-P566-AgaT derivate with random mutation between the ribosome binding site and the first ten amino acids of agaT. X is from 1 to 8, which stands for eight different mutations. The sequences of the eight mutant plasmids are shown in Table 2. |
| Strains | |
| E. coli JM109 | recA1, endA1, thi, gyrA96, supE44, hsdR17Δ (lac-proAB)/F’[traD36,proAB+, laclq, lacZΔ M15] |
| B. subtilis 168 | trpC2 |
| B. subtilis WB600 | B. subtilis 168 derived strain, Δ nprBΔ aprEΔ eprΔ bprΔ nprEΔ mpr |
| B1-1,2,3,4 | B. subtilis 168 harboring plasmid pHT01-Px-AgaT; X stands for different promoters; B1-1 through B1-4 contain plasmid pHT01-PlytR-AgaT, pHT01-P43-AgaT, pHT01-P333-AgaT, and pHT01-P566-AgaT, respectively. |
| B2-1,2,3,4 | B. subtilis 168 harboring plasmid pHT01-Px-AgaT-GFP; X stands for different promoters; B2-1 through B2-4 contain plasmid pHT01-PlytR-AgaT-GFP, pHT01-P43-AgaT-GFP, pHT01-P333-AgaT-GFP and pHT01-P566-AgaT-GFP, respectively. |
| B3-1,2,3,4,5,6,7,8 | B. subtilis 168 harboring plasmid pHT01-AgaT-X; X is from 1 to 8. B3-1 through B3-8 contain plasmid pHT01-AgaT-1,2,3,4,5,6,7,8, respectively. |
| B4-1,2 | B. subtilis WB600 harboring plasmid pHT01-AgaT-1 and pHT01-AgaT-7 |
| B5-1 | B4-2ΔgcvP (accession no. CP053102.1) |
| B5-2 | B4-2ΔargI |
| B6-1 | B4-2ΔargIΔgcvP |
| B6-2 | B4-2ΔargIΔnosA (accession no. CP053102.1) |
| B6-3 | B4-2ΔargIΔgcvPΔnosA |
| B7 | B6-2 overexpresses argF (accession no. CP053102.1), carAB (accession no. CP053102.1) glnA (accession no. CP053102.1) |
| B8 | B6-2 overexpresses argG (accession no. CP053102.1), argH (accession no. CP052842.1) |
| B9 | B6-2 overexpresses aspA (accession no. CP054177.1) |
| B10 | B6-2 overexpresses argF, carAB, glnA, argG, argH, aspA |
| Promoters | Sequence |
|---|---|
| PlytR | cgaacggtagaatcgtcgacctgAAACAATGAAACTTTTTTTTATAAAAAACGACTATTTTAGGATTTCATTCTTGTATTAAATAGAGTTGTATTTATTGGAAATTTAACTCATAATGAAAGTAATTTaaaggaggtgataaaa |
| P43 | tgataggtggtatgttttcgcttgaacttttaaatacagccattgaacatacggttgatttaataactgacaaacatcaccctcttgctaaagcggccaaggacgccgccgccggggctgtttgcgttcttgccgtgatttcgtgtaccattggtttacttatttttttgccaaggctgtaatggctgaaaattcttacatttattttacatttttagaaatgggcgtgaaaaaaagcgcgcgattatgtaaaatataaagtgatagcggtaccattataggtaagagaggaatgtacac |
| P333 | ttgaggaatcatagaattttgacttaaaaatttcagttgcttaatcctacaattcttgatataatattctcatagtttgaaaaaggaggtgataaaa |
| P566 | aaaaaacggcctctcgaaatagagggttgacactcttttgagaatatgttatattatcagaaaggaggtgataaaa |
| Pveg | ATTTTGTCAAAATAATTTTATTGACAACGTCTTATTAACGTTGATATAATTTAAATTTTATTTGACAAAAATGGGCTCGTGTTGTACAATAAATGTAGTG |
| Strains | Sequence |
|---|---|
| B1-4 | AGAAAGGAGGTGATAAAAATGAGAACAGATACAAGAATTGTTAATTCA |
| B3-1 | TACGGGGAGGGGATAAAAATGAGAACGGATACAAGAATCGTTAATTCT |
| B3-2 | GATAGGGAGGGGATAAAAATGAGAACCGATACAAGAATTGTTAATTCT |
| B3-3 | TCGTGGGAGGGGATAAAAATGAGAACGGACACCAGAATTGTTAATTCG |
| B3-4 | ATAGGGGAGGTCATAAAAATGAGAACGGATACAAGAATTGTTAATTCA |
| B3-5 | TCGCGGGAGGGGATAAAAATGAGAACCGACACAAGAATCGTTAATTCC |
| B3-6 | CCAAGGGAGGGGTTAAAAATGAGAACCGATACGAGAATTGTAAATTCG |
| B3-7 | GCCGAGGAGGGGTTAAAAATGAGAACGGATACCAGAATTGTGAACTCG |
| B3-8 | AACAGGGAGGGGATAAAAATGAGAACCGATACCAGAATCGTGAATTCT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yan, K.; Tian, R.; Zhang, L.; Lv, X.; Liu, L.; Liu, Y. Biosynthesis of Guanidinoacetate by Bacillus subtilis Whole-Cell Catalysis. Fermentation 2022, 8, 116. https://doi.org/10.3390/fermentation8030116
Yan K, Tian R, Zhang L, Lv X, Liu L, Liu Y. Biosynthesis of Guanidinoacetate by Bacillus subtilis Whole-Cell Catalysis. Fermentation. 2022; 8(3):116. https://doi.org/10.3390/fermentation8030116
Chicago/Turabian StyleYan, Kun, Rongzhen Tian, Linpei Zhang, Xueqin Lv, Long Liu, and Yanfeng Liu. 2022. "Biosynthesis of Guanidinoacetate by Bacillus subtilis Whole-Cell Catalysis" Fermentation 8, no. 3: 116. https://doi.org/10.3390/fermentation8030116
APA StyleYan, K., Tian, R., Zhang, L., Lv, X., Liu, L., & Liu, Y. (2022). Biosynthesis of Guanidinoacetate by Bacillus subtilis Whole-Cell Catalysis. Fermentation, 8(3), 116. https://doi.org/10.3390/fermentation8030116

