Fermented Chive (Allium schoenoprasum) with Lactobacillus plantarum: A Potential Antibiotic Alternative Feed Additive for Broilers Challenged with Escherichia coli

Abstract

This study aimed to evaluate the effects of fermented chive (Allium schoenoprasum) with Lactobacillus plantarum 1582 (FC) as an alternative to antibiotics for controlling Escherichia coli infection in broiler chickens. A total of 250 J-Dabaco male chickens were allocated into five experimental groups: NC (negative control), PC (positive control), FC1 (1% FC), FC3 (3% FC), and AB (antibiotic treatment). The PC, FC1, FC3, and AB groups were challenged with E. coli ExPEC_A338 on day 8 and monitored until day 35. The results indicated that FC supplementation, particularly at 3% (FC3 group), significantly improved body weight gain, feed intake, the survival rate, and the production efficiency index (PEI). The FC3 group exhibited optimal performance, potentially due to enhanced immune responses, as evidenced by higher IgA and IgG levels, and favorable cytokine regulation. Additionally, FC maintained intestinal epithelial integrity by upregulating tight junction proteins (ZO-1, Claudin-2) and reducing inflammatory responses (IFN-γ, TNF-α). Furthermore, FC3 demonstrated the ability to inhibit pathogenic bacteria (Salmonella spp., E. coli), promote beneficial Lactobacillus spp., and enhance intestinal mucosal morphology (villus height and crypt depth). These findings suggest that FC supplementation, particularly at 3%, is a promising natural alternative to antibiotics for controlling E. coli infections in broiler production.

1. Introduction

Escherichia coli (E. coli) is a common bacterial pathogen in poultry worldwide, causing severe health issues and reduced productivity [1]. E. coli infections in poultry can lead to diseases, such as necrotic enteritis, airsacculitis, and septicemia, resulting in significant economic losses in the poultry industry [2]. Moreover, infected poultry and contaminated poultry products can serve as sources of zoonotic transmission, posing a public health risk. Therefore, controlling the spread of E. coli in poultry farming is of critical importance.

Antibiotics have been widely used for the prevention and treatment of E. coli infections in poultry. However, antibiotic overuse has contributed to the rise of antimicrobial resistance (AMR), posing a serious threat to both animal and human health. Additionally, antibiotic use can disrupt gut microbiota balance, negatively impacting poultry health and productivity. As a result, there is an urgent need to develop effective, safe, and environmentally friendly antibiotic alternatives.

Recently, medicinal plants have gained attention as potential alternatives due to their bioactive compounds with antimicrobial, antioxidant, and immunomodulatory properties. Among them, chive (Allium schoenoprasum), a widely used spice in Vietnam, is rich in flavonoids (especially quercetin) and organosulfur compounds, which may improve animal health [3]. However, direct dietary supplementation of chive may be limited in efficacy because plant cell walls restrict the bioavailability of these compounds [4].

Fermentation is an effective approach to enhance bioactivity by increasing the release of polyphenols, free amino acids, and organosulfur compounds while also boosting antioxidant properties [5]. Furthermore, fermentation supports the proliferation of beneficial gut bacteria, contributing to gut microbiota balance and intestinal health [6]. However, spontaneous fermentation using native microorganisms may be difficult to control and could lead to the production of harmful substances [7]. Therefore, selecting an appropriate bacterial strain is crucial for optimizing chive fermentation and maximizing its benefits.

Lactobacillus plantarum is one of the most commonly used probiotic species, known for its ability to adhere to the intestinal mucosa, produce digestive enzymes, modulate gut microbiota, and enhance immune responses [8]. Despite these benefits, L. plantarum alone may have limited efficacy in disease prevention. Combining probiotics with fermented medicinal plants is considered a promising strategy to enhance disease resistance and promote poultry health.

Our recent study successfully isolated L. plantarum 1582 from free-range native chicken feces, noting its capacity for chive fermentation, E. coli inhibition, and survivability in the chicken digestive tract [9]. Based on the potential of this strain, the present study aims to evaluate the effects of fermented chive with L. plantarum 1582 on the growth performance, gut health, and immune responses of E. coli-challenged broiler chickens.

2. Materials and Methods

2.1. Preparation of Fermented Chive

Chive (Allium schoenoprasum; GenBank ID: NC_057575.1), aged 4–5 months and cultivated under VietGAP biosecurity standards (TCVN 11892-1:2017) [10], was used as the raw material for the preparation. After preliminary processing, the chive was finely ground for fermentation.

Fermentation was conducted following the method described by Hai et al. (2024) [9], with some modifications. Specifically, the chive bulbs were fermented with Lactobacillus plantarum 1582 (GenBank ID: MT597487.1) at a concentration of 10⁸ CFU/mL in a medium containing 5% NaCl and 3% glucose. The mixture was incubated at 37 °C under anaerobic conditions with shaking at 60 rpm for 72 h.

Following fermentation, both the fermented and non-fermented preparations were mixed with starch at a 3:7 ratio, dried at 50 °C to a moisture content of 3%, and finely ground. The final fermented product contained Lactobacillus spp. at a density of approximately 2.7–3 × 10⁸ CFU/g and was analyzed for key bioactive compounds (

Table 1. Bioactive and nutritional compounds in fresh chive and chive fermented with L. plantarum.

Component/Compound	Fresh Chive	Fermented Chive	Determination Method
Polyphenol (mg/g)	10–15	15–20	Folin-Ciocalteu
Quercetin (mg/g)	2–4	3–6	UV-Vis
Sulfur compounds
Allicin (mg/kg)	1–1.5	1–1.5	GC-MS
Thiosulfate (mg/g)	5–7	~2–3	GC
S-allyl cysteine (mg/g)	0.1–0.3	1–3	GC-MS
Organic acids
Lactic acid (%)	negligibility	0.5–1.5	HPLC
Acetic acid (%)	negligibility	0.1–0.5	HPLC
Citric acid (%)	~0.2–0.5	~0.5–1	HPLC
Crude protein (g/kg)	16.3–20.1	16.2–22.3	AOAC
Crude fat (g/kg)	6–9	3–4	AOAC
Crude fiber (g/kg)	22.3–26.8	21.4–24.5	AOAC
Metabolizable energy (kCal/100g)	330–370	360–380	AOAC

).

2.2. Pathogenic Bacteria

The virulent Escherichia coli strain ExPEC_A338 (GenBank ID: CP142559.1) was isolated from the feces of indigenous chickens suffering from diarrhea suspected to be caused by E. coli. The strain was preserved at the Bacteriology and Infectious Diseases Laboratory, Faculty of Animal Science and Veterinary Medicine, Hue University of Agriculture and Forestry. Prior to experimentation, the bacteria were activated in Luria–Bertani broth for three generations, centrifuged (3500× g, 15 min, 4 °C), and washed twice with phosphate-buffered saline (PBS, pH 7.2).

2.3. Experimental Animals

Male J-Dabaco broiler chickens were obtained from Dabaco Company (Vietnam) and reared for the entire experimental period (1–35 days of age) in a well-maintained cross-ventilated housing system. During the first week, the chicks were brooded together in a circular brooder with microbiologically treated rice husk bedding. From days 8 to 35, the birds were housed in wire cages (dimensions: 0.9 × 0.5 × 0.5 m). Continuous fluorescent lighting was provided throughout the experiment. The ambient temperature was maintained at 35 °C during the first two weeks and then gradually reduced to 25 °C until the end of the trial. The diet was formulated using locally sourced ingredients, such as yellow corn, soybean meal, and fishmeal, to meet the nutritional standards for broiler chickens, as specified by the Vietnam Ministry of Agriculture and Rural Development (10 TCN 661-2005) [11]. The birds had ad libitum access to feed and antibiotic-free drinking water throughout the experiment.

The raw materials and medicinal ingredients (if applicable) were mixed using an HM-150 mixer (Hai Minh Co., Ltd., HCM City, Vietnam; 5.5 kW, 50 rpm, ~1500 kg/h). The mixed feed was then pelleted using an S270 pellet mill (Binh Quan Group, HCM city, Vietnam; 11 kW, 1450 rpm, ~500 kg/h) with a die size of 3 mm for the starter phase and 5 mm for the finisher phase, maintaining a moisture content of approximately 3%.

2.4. Experimental Design

A total of 250 one-day-old male chicks were randomly assigned to five groups, with five replicates per group (10 birds per cage): (1) negative control (NC, no supplementation, no E. coli infection), (2) positive control (PC, no supplementation, E. coli infection), (3) low-dose of FC (1%, FC1), (4) high-dose of FC (3%, FC3), and (5) antibiotic-treated group with Terra-Neocine (AB).

Table 2. Ingredients and the calculated composition of the experimental diets (as-fed basis, %, unless otherwise stated).

Nutrient	Starter Phase (<19 Days of Age)					Finisher Phase (≥19 Days of Age)
	NC	PC	AB	FC1	FC3	NC	PC	AB	FC1	FC3
Ingredient composition
Fermented chive (FC)	0			1	3	0			1	3
Yellow corn	47			47.1	47.2	58.5			58.6	58.6
Soybean meal (36.7% CP)	44.28			43.08	40.98	33.78			32.58	30.68
Fish meal	5			5.1	5.1	4			4.1	4
CaCO3 (38%)	2			2	2	2			2	2
CaHPO4	1			1	1	1			1	1
Sodium chloride	0.3			0.3	0.3	0.3			0.3	0.3
Choline chloride (50%)	0.02			0.02	0.02	0.02			0.02	0.02
DL-Methionine (99.5%)	0.2			0.2	0.2	0.2			0.2	0.2
Vitamin premix 1	0.1			0.1	0.1	0.1			0.1	0.1
Mineral premix 2	0.1			0.1	0.1	0.1			0.1	0.1
Calculated nutritional values
Crude protein	22.2			21.3	22.2	18.0			18.1	18.1
Crude fat	4.48			4.43	4.32	5.48			5.40	5.36
Crude fiber	5.05			5.06	5.13	5.05			5.08	5.09
Calcium	1.10			1.09	1.06	1.00			1.03	1.01
Phosphorus	0.51			0.50	0.50	0.44			0.45	0.45
Lysine	1.32			1.30	1.30	1.04			1.02	1.01
Metabolizable energy (kCal/kg)	3000			3000	3000	3200			3200	3200

¹ Each kilogram of vitamin premix contained 10 mg nicotinamide, 0.02 mg cholecalciferol, 0.3 mg folic acid, 2 mg pyridoxine HCl, 1.8 mg all-trans-retinyl acetate, 8 mg cyanocobalamin, 2.2 mg menadione, 8.3 mg alpha-tocopherol acetate, 160 mg choline chloride, and 20 mg D-biotin. ² Each kilogram of mineral premix contained 60 µg selenium (Se), 200 µg cobalt (Co) from CoSO₄, 800 µg iodine (I) from KI, 2 mg copper (Cu) from CuSO₄·5H₂O, 24 mg zinc (Zn) from ZnO, 16 mg iron (Fe) from FeSO₄·7H₂O, and 32 mg manganese (Mn) from MnSO₄·H₂O.

presents the ingredients and the calculated nutritional composition of the experimental diets. The chickens in groups 2–5 were orally challenged with E. coli ExPEC_A338 (2.9 × 10⁸ CFU/mL) on day 8. The chickens in group 5 were supplemented with Terra-Neocine (Mebipha Co., Hanoi, Vietnam) at a dose of 2 g/1 L of drinking water, continuously used for 3 days before E. coli infection and 5 days after. The supplemented treatments constituted 1% and 3% of the diet throughout this study.

On day 11 of the experiment, three birds per replicate were randomly selected for sample collection. Blood samples were collected to assess serum immunoglobulin levels, while small intestinal samples were obtained for immune gene expression analysis, and ileal samples were collected to evaluate microbial density. At the end of the experiment (day 35), three chickens per replicate were again randomly selected for sample collection to examine immune organs and perform histopathological analysis (Figure 1).

2.5. Indicators and Research Methods

Growth performance assessment: The feed intake (FI) of the chicks in each treatment was determined daily at 07:00 h, as well as the survival rate and body weight (BW), to determine the following indicators: Weight gain (BWG) = Final BW − Initial BW; Feed conversion ratio (FCR) = FI/BWG; and Production efficiency index (PEI) = BWG (kg) × Survival rate (%)/Number of experimental days (day) × FCR × 100 [12]

Immunoglobulin content: Blood samples were centrifuged (3000 rpm, 10 min), and then, the serum was separated and stored at -20 °C. Concentrations of IgA (MBS705241), IgM (MBS706158), and IgG (MBS260043) were determined by ELISA (MyBioSource, San Diego, CA, USA), optical density was measured at 450 nm, and immunoglobulin concentrations were calculated based on the standard curve.

Immune gene expression: Total RNA was extracted from the ileal mucosa using a Treezol kit (Invitrogen, Carlsbad, CA, USA) and checked using a Nanodrop Lite (Thermo Fisher, Waltham, MA, USA). cDNA was synthesized using a FIRE Script RT cDNA kit (Solid Biodyne, Tartu, Estonia). Immune genes (IL-4, IL-1β, TNF-α, IFN-γ, ZO-01, claudin-2, occludin) and reference gene GAPDH were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China) (

Table 3. Primer sequences used in RT-qPCR.

Gene	Sequence Primer (5′ to 3′)			Genbank ID
	Forward Primer	Reverse Primer	Size (bp)
Tight-binding protein
ZO-1	CTTCAGGTGTTTCTCTTCCTCCTC	CTGTGGTTTCATGGCTGGAT	121	XM_413773.4
Occludin	GCAGATGTCCAGCGGTFC1CFC1C	CGAAGAAGCAGATGAGGCAGAG	89	NM_205128.1
Claudin-2	CAFC1CTCCTGGGTCTGGTTGGT	GACAGCCATCCGCATCTTCT	198	NM_001013611.2
Pro-inflammatory cytokines
IL-4	GTGCCCACGCT GTGCTFC1C	AGGAAACCTCT CCCTGGATGTC	82	GU119892.1
IL-1β	GFC1CCGAGFC1C AACCCCTGC	AGCAACGGGAC GGT AATGAA	204	NM_204524.1
TNF-α	CTCAGGACAGC CFC1TGCCAACA	CCACCACACGA CAG CCAAGT	177	XM_015294125.2
IFN-γ	CCTCGCAACCT TCACCTCAC	CGCTGFC1ATCG TTG TCTTGGAG	76	FJ977575.1
GAPDH	AACTTTGGCAT TGTGGAGGG	ACGCTGGGATG ATGTTCTGG	130	NM_204305.1

). RT-qPCR was performed on a Quant Studio™ 5 (Thermo Fisher, USA) with an amplification cycle consisting of 95 °C (1 min), 40 cycles of 95 °C (15 s), and 60 °C (60 s). Gene expression was calculated using the 2−ΔΔCt method (Livak and Schmittgen, 2001) [13] with GAPDH as the reference gene.

Microbial density determination: Escherichia coli, Salmonella spp., and Lactobacillus spp. were isolated from ileal digesta using selective media, including eosin methylene blue (EMB) agar (supplemented with 1% CaCO₃), Salmonella–Shigella (SS) agar, and de Man, Rogosa, and Sharpe (MRS) agar, following ISO standards 13349/2001, 6579/2003, 7937/2004, and ISO/Dis 11290/1994. A 1 g sample was homogenized with 9 mL of sterile 0.1% peptone solution and serially diluted (10⁻¹ to 10⁻⁷). Three dilutions (10⁻³, 10⁻⁵, 10⁻⁷) were selected for plating, with 100 µL spread onto appropriate selective media in Petri dishes. The plates were incubated at 37 °C for 24 h, and colony-forming units (CFUs) were counted and expressed as log₁₀ (CFU/g).

Immune organ index: The immune organs, including the bursa of Fabricius, thymus, and spleen, were weighed. The immune organ index was calculated as the organ weight (g) per 100 g of live body weight.

Histopathological examination: Duodenum, jejunum, and ileal samples were fixed in 10% formalin saline for 24 h and processed according to the method described by Layton et al. (2019) [14]. Tissue segments (1 cm) were dehydrated in graded ethanol solutions (70%, 90%, 100%) for 2 h each, cleared with xylene (twice for 1 h each), and embedded in molten paraffin wax (twice for 1 h each) before block embedding. Tissue sections (5 µm thick) were prepared using a rotary microtome (Leica RT 25, New Milton, Hampshire, UK), mounted on glass slides, dried, and stained with hematoxylin and eosin (H&E). Morphological characteristics, including villus height and crypt depth, were analyzed using a Nikon Eclipse E200 microscope (Nikon Instruments Inc., Melville, NY, USA) and Image-Pro Plus software (version 6.0, Media Cybernetics, Rockville, MD, USA).

2.6. Statistical Analysis

The data collected in this study were processed using Excel 2019 and statistically analyzed using IBM. SPSS 22.0. The results were expressed as mean ± standard error of the mean (SEM). A one-way ANOVA followed by post hoc Bonferroni tests was used to determine statistical significance, while the chi-square (χ²) test was employed to analyze percentage differences at a significance level of α = 0.05.

3. Results

3.1. Effect of Supplementary Fermented Chive on the Productivity of Broiler Chickens

The results presented in

Table 4. Effect of fermented chive supplementation on the growth performance of broiler chickens.

Target	NC	PC	FC1	FC3	AB	Pooled SEM	p-Value
Pre-challenged period (1–7 days old)
BWG (g/head)	25.5	26.9	26.5	25.6	26.6	0.25	0.195
FI (g/head)	45.5	45.5	45.5	45.6	45.6	0.29	0.341
FCR	1.78	1.74	1.76	1.81	1.75	0.16	0.166
Post-challenged period (8–35 days old)
BWG (g/head)	699.3 a	633.7 b	686.7 ab	714.7 a	699.4 a	33.29	<0.001
FI (g/head)	1588 b	1471.3 c	1623.2 ab	1668.2 a	1630.8 ab	63.52	<0.001
FCR	2.28	2.32	2.35	2.33	2.33	0.13	0.069
Full time (1–35 days old)
BWG (g/head)	724.4 ab	659.4 c	711.9 b	739.5 a	725.0 ab	34.92	<0.001
FI (g/head)	1634.4 ab	1516.5 c	1668.4 ab	1713.5 a	1576.2 bc	89.51	<0.001
FCR	2.26 ab	2.30 ab	2.34 a	2.32 a	2.17 b	0.131	<0.001
PEI	89.94 a	57.37 c	72.92 b	83.91 a	85.77 a	3.57	<0.001

Note: In the same row, values with different lower-case letters (a, b and c) indicate statistically significant differences (p < 0.05). Weight gain (BWG), feed intake (FI), feed conversion ratio (FCR), production efficiency index (PEI).

and Figure 2 indicate that during the initial phase of the experiment (prior to E. coli infection), there were no significant differences (p > 0.05) among the groups in terms of body weight gain (BWG), feed intake (FI), or the feed conversion ratio (FCR). All groups maintained a 100% survival rate, suggesting that dietary supplementation with FC-based products (FC3 or FC1) did not adversely affect the normal growth of the chickens.

Following E. coli challenge, the FC3 group exhibited the highest BWG (714.6 g/bird), which was significantly higher than that of the PC group (p = 0.025) and comparable to that of the AB group. The feed intake in the FC3 group was also the highest (1668.1 g/bird), suggesting improved palatability or increased metabolic demand, which contributed to greater weight gain. Overall, both the FC3 and FC1 groups mitigated the adverse effects of E. coli infection on growth performance, with improvements in BWG of 11.2% and 10.8% and increases in FI of 11.3% and 11.0% compared to the PC group. Notably, the FC3 group showed a statistically significant difference (p < 0.05) in comparison to the PC group.

Regarding survival rate, the FC3 group achieved 93.34%, which was significantly higher than the PC group (73.34%) and comparable to the AB group (96.68%). The chickens challenged with E. coli exhibited hemorrhagic intestines, purulent pericarditis, caseous abdominal exudate, and fibrinous liver deposits (Figure 3). The production efficiency index (PEI) of the FC3 group (83.91) was also significantly higher (p < 0.05) than that of the FC1 (72.92) and PC (57.37) groups and comparable to the AB (85.77) and NC (89.94) groups.

3.2. Effect of Fermented Chive Supplementation on Immune Function

The results presented in

Table 5. Immune organ indices and serum immunoglobulin levels in experimental broiler chickens.

Treatment	Immune Organ Index (g/kg BW)			Immunoglobulin Concentration (g/L)
	Bursa of Fabricius	Spleen	Thymus	IgA	IgM	IgG
NC	2.01 b	1.82 b	3.44	3.23 b	3.22 b	1.93
PC	1.98 b	1.79 b	3.82	2.19 a	2.18 a	1.88
FC1	2.04 b	1.83 b	3.74	3.22 b	3.63 b	2.02
FC3	2.44 a	2.25 a	3.92	2.90 b	3.32 b	1.96
AB	1.99 b	1.79 b	3.51	2.46 ab	2.69 ab	1.98
Pooled SEM	0.02	0.02	0.06	0.04	0.04	0.03
p-value	<0.01	<0.01	0.262	<0.01	<0.01	0.618

Note: In the same row, values with different lower-case letters (a and b) indicate statistically significant differences (p < 0.05).

indicate that the bursa fabricius index (2.44 g/kg) and spleen index (2.25 g/kg) in the FC3 group were significantly higher (p < 0.05) compared to the other groups. Meanwhile, the thymus index showed no significant differences among the experimental groups, ranging from 3.4 g/kg to 3.9 g/kg.

The immunoglobulin (IgA, IgM, IgG) concentrations in the serum of the experimental chickens at 35 days of age (27 days post-infection) revealed significant differences in the IgA and IgM levels among treatments (p < 0.01). Specifically, the E. coli-challenged group (PC) (2.18–2.19 g/L) exhibited significantly lower values (p < 0.01) compared to the NC and FC1 groups (3.22–3.23 and 3.22–3.63 g/L, respectively).

The results in

Table 6. Effects of fermented chive supplementation on immune gene expression levels in broiler chickens.

Gene	NC	PC	FC1	FC3	AB	Pooled SEM	p-Value
Tight-binding protein
ZO-1	0.93 b	0.82 b	0.95 b	3.02 a	0.96 b	0.13	<0.001
Occludin	1.12	1.16	0.97	1.08	1.19	0.13	0.146
Claudin-2	0.91 bc	0.42 d	1.23 b	2.75 a	1.15 b	0.14	<0.001
Pro-inflammatory cytokines
IL-4	2.33 b	1.85 b	3.12 a	3.29 a	3.38a	0.19	<0.001
IL-1β	1.24	1.27	1.37	1.34	1.34	0.24	0.949
TNF-α	1.14 c	2.01 a	1.62 b	1.22 c	1.19 c	0.08	<0.001
IFN-γ	1.84 c	3.59 a	2.88 b	2.14 bc	2.12 bc	0.15	<0.001

Note: In the same row, values with different lower-case letters (a, b, c and d) indicate statistically significant differences (p < 0.05).

show that the FC3 group exhibited a significant improvement in the intestinal epithelial barrier, with ZO-1 levels being 3.7 times higher (p = 0.025) than those in the PC group. Claudin-2 expression also increased significantly (p = 0.019), whereas occludin levels showed no significant differences among the groups.

Regarding cytokines, IL-4 levels were higher in the AB, FC3, and FC1 groups, significantly surpassing (p < 0.05) those observed in the NC and PC groups. Conversely, TNF-α and IFN-γ levels were significantly reduced in the FC3 and AB groups (~41% and 20% lower than the PC group; p < 0.05).

The findings presented in

Table 7. Effects of fermented chive supplements on ileal microbial density in broiler chickens.

Bacteria	NC	PC	FC1	FC3	AB	Pooled SEM	p-Value
Salmonella spp.	4.61 b	6.68 a	4.63 b	4.21 b	4.54 b	0.34	<0.001
E. coli	6.67 ab	7.1 a	6.24 b	5.51 c	5.63 bc	0.48	<0.001
Lactobacillus spp.	4.84 bc	5.49 b	3.84 c	7.22 a	4.72 bc	0.79	<0.001

Note: In the same row, values with different lower-case letters (a, b and c) indicate statistically significant differences (p < 0.05).

suggest that supplementation with fermented chive (FC1 and FC3) significantly influenced the gut microbial density in the E. coli-challenged chickens. Compared to the positive control (PC) group, the FC1, FC3, and antibiotic (AB) groups exhibited a significant reduction in Salmonella spp. counts (p < 0.05), ranging from 4.2 to 4.6 log₁₀ CFU/g, compared to 6.7 log₁₀ CFU/g in the PC group. Similarly, E. coli counts were also significantly reduced (p < 0.05) to 5.5–6.2 log₁₀ CFU/g, compared to 7.1 log₁₀ CFU/g in the PC group.

Notably, the FC3 group demonstrated a remarkable increase in beneficial Lactobacillus spp. counts (p < 0.05), reaching 7.2 log₁₀ CFU/g, which was significantly higher (p < 0.05) than the other groups (3.8–4.7 log₁₀ CFU/g).

The histological analysis of the intestine (

Table 8. Effects of fermented chive supplementation on the intestinal histology (duodenum, jejunum, and ileum) of broiler chickens.

Items	NC	PC	FC1	FC3	AB	Pooled SEM	p-Value
Duodenum
VH (µm)	2489.3 a	1817.5 b	2150.5 ab	2190.6 ab	2244.6 ab	110.8	0.005
CD (µm)	186.7 c	379.6 a	306.4 b	276.4 b	291.4 b	21.09	<0.001
VH:CD	13.33 a	4.79 c	7.02 b	7.93 b	7.70 b	0.71	<0.001
Jejunum
VH (µm)	1304.1	1150.2	1182.6	1223	1277	46.8	0.119
CD (µm)	164.8 b	284.9 b	271.8 a	241.8 a	256.8 a	11.79	<0.001
VH:CD	7.91 a	4.04 c	4.39b c	5.06 b	4.97b	0.39	<0.001
Ileum
VH (µm)	902.7 b	786.9 c	936.8 b	1061.5 a	907.2 b	20.94	0.013
CD (µm)	152.8 c	206.44 a	184.69 ab	182.54 ab	171.65 bc	7.48	0.023
VH:CD	5.91 a	3.81 c	5.07 ab	5.82 a	5.29 ab	0.31	0.019

Note: In the same row, values with different lower-case letters (a, b and c) indicate statistically significant differences (p < 0.05); VH: villus height, CD: crypt depth.

and illustration Figure 4) demonstrated that across all intestinal segments (duodenum, jejunum, and ileum), FC supplementation, particularly at a 3% concentration (FC3), improved intestinal morphology by increasing VH and reducing CD across different intestinal segments. These effects were often comparable to the antibiotic group (AB) and, in some cases, approached the levels observed in the NC group.

Villus height (VH) was significantly reduced (p < 0.001) in the E. coli-challenged group (PC) compared to the negative control (NC) group. However, supplementation with fermented chive (FC1, FC3) and antibiotic treatment (AB) contributed to partial recovery of VH, particularly in the duodenum and ileum (p < 0.05). Crypt depth (CD) was notably increased in the PC group in all intestinal sections (p < 0.001), indicating potential villus damage and increased cellular turnover. FC supplementation, especially FC3, effectively alleviated this increase, leading to crypt depth values closer to those observed in the NC group. The villus height-to-crypt depth (VH:CD) ratio followed a similar pattern, with a significant reduction in the PC group across all intestinal segments (p < 0.05). This imbalance suggests compromised intestinal integrity and absorption capacity. Notably, FC supplementation, particularly FC3, contributed to restoring the VH:CD ratio, indicating improved intestinal health.

4. Discussion

4.1. Effects of Supplementation on the Productivity of Experimental Broiler Chickens

After colonizing the intestines of young chickens, E. coli can lead to septicemia and systemic infections, negatively affecting gut health and growth performance [15]. The present study demonstrates that supplementation with FC, particularly 3% concentration (FC3), positively influences the growth performance of E. coli-challenged chickens. Specifically, the FC3 group exhibited a significant increase in body weight gain (BWG), feed intake (FI), and survival rate, reaching levels comparable to the antibiotic-treated group (AB).

Additionally, both the FC3 and FC1 groups showed an improved production efficiency index (PEI) compared to the positive control (PC) group. However, no significant differences in the feed conversion ratio (FCR) were observed among the groups. This could be attributed to the lower feed intake in the PC group due to disease effects, which resulted in FCR values not reflecting clear differences between treatments.

The observed performance improvements may be linked to bioactive compounds present in chive, such as polyphenols, flavonoids, and organosulfur compounds, known for their antioxidant, anti-inflammatory, and antimicrobial properties (Table 1). These compounds potentially inhibit E. coli proliferation in the gastrointestinal tract, thereby enhancing gut health and supporting growth [16]. The fermentation process appears to enhance the efficacy of these bioactive compounds while reducing anti-nutritional effects, optimizing health and growth benefits for chickens [17]. Interestingly, fermentation not only preserves active compounds but also generates by-products, such as short-chain fatty acids, which nourish epithelial cells and maintain intestinal mucosal integrity.

Furthermore, FC3 functions as a synbiotic, combining prebiotics (from chive) and probiotics (from L. plantarum fermentation). This synbiotic effect promotes the survival of beneficial gut bacteria, increases lactic acid production to lower intestinal pH, and inhibits pathogenic E. coli [18]. Chive also provides nutrients for beneficial bacteria, supporting microbiota balance, improving digestion, and enhancing growth performance [19].

Our results align with recent studies, such as those by Adli et al. (2024) [20], who reported improved broiler growth performance with fermented herbal supplements, and Liu et al. (2025) [21], who observed increased BWG and an improved FCR in early-stage broilers supplemented with lactic acid bacteria. Although the FCR did not show significant differences, the higher PEI in both the FC3 and FC1 groups compared to the PC group suggests that chive-based supplementation optimizes production efficiency. These findings highlight the potential of chive-derived supplements, particularly FC3, as antibiotic alternatives, which is especially relevant in the context of reducing antibiotic use to mitigate antimicrobial resistance.

4.2. Effects of Fermented Chive Supplementation on Immune Function

The thymus and bursa of Fabricius are central organs for T and B cell production, while the spleen serves as a peripheral organ containing abundant lymphocytes, supporting immune function in broilers [22]. The weight of immune organs reflects the immune health of chickens [23]. Increased bursal and splenic weights in the FC3 group may be attributed to the probiotic L. plantarum in the FC supplement, which stimulates lymphoid tissue development and supports immune function [24]. Polysaccharides from FC, combined with probiotics, may act as prebiotics, balancing gut microbiota and enhancing immune responses, similar to findings of Sugiharto and Ranjitkar (2019) [25].

Antibodies, or immunoglobulins, are essential glycoproteins produced by B lymphocytes, playing a crucial role in immune defense against bacterial and viral infections. This study evaluated the impact of E. coli challenge on serum immunoglobulin (Ig) levels in broilers. The results indicated a significant increase in IgA and IgM levels following supplementation. Ismail et al. (2021) [26] reported that garlic powder supplementation (0.75 g/kg feed) significantly increased IgM and IgG, enhancing both mucosal and systemic immunity; however, IgM—an early immune response antibody—showed no notable change with garlic supplementation. The PC group exhibited the lowest IgA and IgG levels, reflecting immunosuppression and a higher risk of intestinal infections.

Supplementation significantly modulated the expression of pro-inflammatory and anti-inflammatory cytokines, enhancing intestinal immune responses. Tight junction integrity and gut permeability are maintained by proteins such as occludin, ZO-1, and claudin. Wu et al. (2021) [27] demonstrated that E. coli O157 severely damages intestinal epithelial permeability and mucosal barrier function in broilers, allowing gut pathogens to translocate to the liver and bloodstream. Increased expression of ZO-1 and Claudin-2 in supplemented groups indicates improved epithelial integrity, consistent with Zhu et al. (2023) [28].

When a pathogen invades the colon and damages tissues, the intestinal epithelium releases inflammatory mediators, closely linked to gut inflammatory responses [29]. Elevated IL-4 levels in both the high-dose FC (FC3) and low-dose FC (FC1) groups indicate the activation of Th2 immune responses, aligning with Xu et al. (2023) [17]. Conversely, decreased IFN-γ and TNF-α levels in the supplemented groups suggest anti-inflammatory effects, whereas the PC group exhibited the highest IFN-γ and TNF-α levels, indicative of severe inflammation, particularly during early life stages [30].

Fermented chive increased IL-4 levels (by 83.68% and 69.52%) while reducing TNF-α and IFN-γ (~42% and 21%), demonstrating immunoregulatory effects comparable to antibiotics. Chive-derived supplements also promoted immune organ development and reduced mortality rates, enhancing humoral immune responses. These effects can be attributed to bioactive compounds, such as saponins, flavonoids, and polysaccharides. Additionally, Lactobacillus stimulates IL-4 production, enhances B cell development, and suppresses inflammation [31]. These findings suggest that fermented chive-based supplements have the potential to enhance immune health and protect chickens from E. coli infections.

4.3. Effects of Fermented Chive Supplementation on Gut Health

In this study, E. coli-infected broilers from the positive control (PC) group exhibited the highest mortality rates, indicating that E. coli challenge triggered inflammation and compromised gut health. The gut microbiota forms a multilayered bacterial barrier in the intestines, playing a crucial role in nutrient absorption, gut protection, and immune regulation [32]. The findings suggest that chive supplementation effectively controlled pathogenic bacteria, such as E. coli and Salmonella spp., while increasing beneficial Lactobacillus populations, particularly in the FC3 group. These results align with previous research demonstrating that herbal additives can inhibit harmful bacteria, selectively promote beneficial microbes, and regulate gut microbiota composition [33].

The gastrointestinal tract is a complex system in which maintaining structural and functional stability plays an important role in nutrient absorption, resistance to infection, and overall physiological performance [34]. The present study demonstrated that dietary FC supplementation, particularly at a 3% inclusion level (FC3), improved intestinal histology by increasing VH and reducing CD, leading to a higher VH:CD ratio compared to the positive control (PC) group with E. coli-induced intestinal damage.

The improvements in gut health observed in this study are likely due to the fermented chive’s ability to inhibit E. coli, reduce intestinal damage, and promote recovery. The bioactive compounds in fermented chive, including antimicrobial and antioxidant agents, may enhance intestinal health by supporting epithelial cell turnover and maintaining the intestinal barrier. Lactic acid fermentation further contributes by producing active metabolites, such as propanoic acid, quercetin, and saponins, which possess antimicrobial and anti-inflammatory properties [16]. Additionally, Lactobacillus produces organic acids and other metabolites that lower intestinal pH, inhibit pathogenic bacteria, and support gut health [35].

The results of this study showed that the fermented chive improved intestinal morphology, thereby enhancing nutrient absorption efficiency. Chive-derived supplementation exhibited protective effects on intestinal mucosal morphology, significantly increasing VH while reducing CD, supporting improved gut integrity and nutrient absorption [36]. A higher VH:CD ratio may reduce the need to maintain intestinal structure, allowing more energy to be allocated to weight gain [37]. These mechanisms may explain how the fermented chive reduced the negative effects of E. coli on growth performance in the broiler chickens. Furthermore, maintaining intestinal structural integrity is closely linked to the stability of the intestinal immune system [38].

5. Conclusions

This study confirms the effectiveness of supplementing fermented chive with L. plantarum 1582 in improving performance, enhancing immunity, and protecting the gut microbiota of chickens infected with E. coli ExPEC_A338. The FC3 group achieved weight gain and feed intake levels comparable to those of the antibiotic (AB) and negative control (NC) groups, with significantly higher values than the positive control (PC) group. The mechanism of action of the supplement may involve immune enhancement (increased IgA and IgM levels, development of lymphoid organs), protection of the intestinal epithelial barrier (upregulation of ZO-1 and Claudin-2), and modulation of immune responses (increased IL-4, decreased IFN-γ and TNF-α). Additionally, the supplement inhibited pathogenic bacteria (Salmonella spp., E. coli), promoted beneficial bacteria (Lactobacillus spp.), and improved intestinal mucosal morphology. Fermented chive represents a promising antibiotic alternative in poultry farming, contributing to intestinal disease control and sustainable livestock production.