Next Article in Journal
Technological Innovations and Applications of Microbial Protein Production: From Genetic Engineering to Sustainable Manufacturing
Next Article in Special Issue
Effects of Different Levels of Thiamine Diphosphate on In Vitro Methane Reduction and Fermentation Characteristics of Korean Native Cow (Hanwoo)
Previous Article in Journal
Metabolic Engineering of Escherichia coli for Xylitol Production
Previous Article in Special Issue
Enhancing Rumen-Undegradable Protein via Processing Techniques in a Dual-Flow Continuous Culture System
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fermentation
Volume 11
Issue 3
10.3390/fermentation11030132
fermentation-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Comparison of Effects of Cold and Warm Water Intake in Winter on Growth Performance, Thermoregulation, Rumen Fermentation Parameters, and Microflora of Wandong Bulls (Bos taurus)

by
Jing Li
1,
Zhihao Cui
1,
Ming Wei
1,
Chunqing Yin
2 and
Peishi Yan
1,*
1
College of Animal Science & Technology, Nanjing Agricultural University, Nanjing 210095, China
2
College of Animal Science & Technology, Qingdao Agricultural University, Qingdao 266109, China
*
Author to whom correspondence should be addressed.
Fermentation 2025, 11(3), 132; https://doi.org/10.3390/fermentation11030132
Submission received: 29 January 2025 / Revised: 3 March 2025 / Accepted: 6 March 2025 / Published: 8 March 2025
(This article belongs to the Special Issue Ruminal Fermentation)
Browse Figures
Versions Notes

Abstract

:
Efficient farm practices are crucial for livestock health and performance, and cold stress is a major challenge for cattle in winter. This study aimed to preliminarily investigate the effects of cold and warm water intake in winter on the growth performance, thermal stress indicators, serum hormones and metabolites, rumen fermentation parameters, rumen fiber degrading enzyme, and rumen microflora of yellow cattle during winter. Eight Wandong Bulls (Bos taurus) were divided into two groups: group C, which received cold water (6.36 ± 1.99 °C), and group E, which received warm water (32.00 ± 3.12 °C) for 30 d. The results showed that warm water intake significantly increased ADG (p = 0.024) and DMI (p = 0.046) and decreased (p = 0.047) the ratio of feed intake to weight gain. Furthermore, the heat production, respiratory rate, surface temperature, and rectal temperature of cattle did not alter with water temperature, but the heat production value of the bulls increased (29.64 vs. 25.76 MJ/W0.75 h−1) with cold water intake compared to warm water. The concentrations of thyroxine (p = 0.021), serum urea nitrogen (p = 0.025), and glucose (p = 0.011) increased for the bulls drinking cold water compared to those drinking warm water. The concentrations of NH3-N (p = 0.048), total VFA (p = 0.010), acetate (p = 0.009), propionate (p = 0.009), cellulase (p < 0.01), and xylanase (p < 0.05) were lower in group C compared to group E. Total bacterial abundance, as well as specific species including Ruminococcus flavus, Ruminococcus albus, and Prevotella ruminicola, were lower (p < 0.05) in group C compared to group E. In conclusion, drinking warm water during winter enhanced growth performance by influencing energy metabolism, regulating serum hormones and metabolites, and modulating ruminal microflora of bulls compared to cold water intake.

1. Introduction

The cattle industry is becoming increasingly important in providing meat and dairy products to meet the demands of a growing global population [1]. However, cattle production is influenced by a variety of factors, including environmental conditions, forage availability, genetics, feeding practices, and disease [2,3,4]. Among these, temperature is a key factor that impacts animal health, productivity, and gut microbiota composition [5,6]. Cold stress, in particular, is a temperature-related factor that can lead to various health and performance issues. Castellani et al. emphasized that cold exposure adversely affects animal physiology [7]. For dairy cows and beef cattle, cold stress not only decreases productivity but also increases their susceptibility to diseases [8]. Wang et al. reported that long-term cold stress decreased growth performance, nutrient digestion, and rumen volatile fatty acid (VFA) production [9]. Moreover, Broucek et al. reported that cold stress reduced the average milk yield of dairy cows and increased the levels of glucose and free fatty acids in the blood [10]. Shi et al. found a natural outdoor cold environment (average: −13.05 °C) reduced growth performance, immune response and antioxidant capacity in sheep compared to an indoor warm environment (average: 1.82 and 8.28 °C) [11]. These findings underscore the need for effective environmental management strategies to protect animals from the harmful effects of cold stress.
The microbiota refers to the diverse community of microbes inhabiting the intestinal tract, including bacteria, protozoa, archaea, viruses, and fungi [12]. Often referred to as the “second genome”, these microorganisms play vital roles in digestion, metabolism, immunity, and maintaining the gut barrier [13]. The composition of this dynamic microbiota is influenced by a variety of factors, including genetics, nutrition, and environmental conditions [14]. Disruptions in this balance have been linked to a range of diseases such as inflammatory bowel disease [15], diarrhea [16], and liver disorders [17]. Water temperature has been reported to affect the rumen temperature, and the lower the water temperature, the longer the rumen recovery temperature [18]. In fact, the effect of water temperature on the rumen may be more direct due to the direct contact of water with rumen fluid and rumen microorganisms compared with temperature stress. In many regions of China, winters can be harsh, and continuous access to warm water in cowsheds is often unavailable. This is particularly common on smaller farms, where cattle are typically provided with cold water during the winter months. As a result, cattle production and health may be negatively impacted by the cold water. However, there is limited research on how water temperature influences the microbiota of Wandong Bulls during these cold winter months. Providing warm water to cattle in winter could become a new method to improve feeding efficiency of cattle and reduce the incidence of disease. In particular, small farms can use environmentally friendly energy, such as solar-heated water, to reduce costs. Therefore, we hypothesized that, compared to drinking warm water, drinking cold water would reduce growth performance, rumen fermentation, fiber enzyme concentrations, and microbial function in cattle while increasing thermoregulation, energy metabolism, and heat production. The objective of this study was to compare the growth performance, thermal stress indicators, serum hormones and metabolites, ruminal fermentation characteristics, fiber enzyme concentrations, and microbiota of bulls drinking warm versus cold water during the winter months, to explore an often-overlooked aspect of animal health in response to environmental conditions.

2. Materials and Methods

The animals were treated as approved by the Humane Animal Care and Ethics Committee of Nanjing Agricultural University, China.

2.1. Experimental Design

In this study, eight Wandong Bulls (Bos taurus) (initial body weight of 365.45 ± 22.90 kg) were housed on a local cattle farm in Chuzhou, China, and were divided into two groups: group C (cold water) and group E (warm water). In December, when the local temperature averaged 5.74 ± 2.63 °C, bulls in group C received cold water at 6.36 ± 1.99 °C, while bulls in group E were given warm water at 32.00 ± 3.12 °C. The bulls were individually housed in pens with free access to water and were fed ad libitum a total mixed ration (TMR) with a concentrate-to-forage ratio of 1:9. Diet composition and nutrient levels are shown in Table 1. The bulls were housed on slatted wooden flooring equipped with a manure treatment system to mitigate thermal interference from the external environment and maintain thermoneutral resting surfaces. All experimental units were maintained in standardized pen dimensions with identical spatial orientation relative to ventilation inlets, ensuring uniform microenvironmental parameters including air exchange rate, relative humidity, and particulate matter concentration. Cold water was conventionally supplied to bulls exposed to low temperatures in winter, with an actual water temperature of 5.74 ± 2.63 °C. Warm water was supplied by a constant-temperature water tank equipped with a temperature control and detection system, and the temperature was set to 30 °C (actual water temperature: 32.00 ± 3.12 °C). This study included a 7-day adaptation period, followed by a 30-day data and sample collection period.

2.2. Data and Sample Collection

The initial and final weights of each bull were recorded before morning feeding to calculate the average daily gain (ADG). The dry matter intake (DMI) of each bull was recorded every day and the ratio of feed intake to weight gain (F:G ratio) was calculated according to DMI and weight gain. Heat production in bulls was measured using a 80 × 80 × 136 cm respiratory metabolic apparatus equipped with a feeding and drinking trough on days 25, 26, and 27 of the collection period. The respiratory metabolic apparatus mixes indoor air through three exhaust fans and is connected to a flexible pipe equipped with a high-precision gas float flowmeter (MF5700, Siargo Ltd., Santa Clara, CA, USA) and a gas pump. The collected gas is sent to a paramagnetic oxygen analyzer (Model 8000M, SIGNAL®, London, UK) via a water vapor filter. Bulls’ heat production was measured with interval rotation to ensure that the environment of the two groups of test cattle was consistent and was calculated according to the formula described by McLean et al. [19]:
Heat production = −0.2047 × ∆F(O2) × V × 60/kg0.75
where “∆F(O2)” is the oxygen concentration difference between intake and exhaust and “V” is the exhaust volume per unit of time of the breathing chamber under standard conditions. The respiratory rate of cattle was recorded through a breathing cage. Bull surface temperature at different ambient temperatures (5–9, 9–11, and 14–16 °C) was analyzed using a hand-held infrared thermometer (59 Mini, Fluke®, Everett, WA, USA), based on the weighted average of the body surface temperature of different parts of the bull and the proportion of the skin area of the part to the total body area. Rectal temperature was measured using a hand-held bovine rectal thermometer (29110, Jinan Borui Agriculture and Animal Husbandry Products Co., Ltd., Jinan, China) inserted 15 cm into the anus of each bull daily.
Blood samples were collected from the jugular vein of each bull using vacutainer tubes (gel and clot activator) before morning feeding on day 30 of the collection period. The collected samples were then centrifuged at 3000 rpm for 15 min at 4 °C to separate the serum, which was stored at −20 °C until further analysis.
Rumen fluid samples were collected using a rumen catheter through the mouth on days 28, 29, and 30 of the collection period. The pH values of fresh rumen fluid samples were measured using a pH meter (PHS-3E, INESA Scientific Instrument Co., Ltd., Shanghai, China). The rumen fluid samples were divided into three portions: two were mixed with either 25% HPO3 (v/v) or 1% H2SO4 (v/v) and stored at −20 °C until laboratory analysis, and the third portion was collected into cryotubes, immediately frozen in liquid nitrogen, and stored at −80 °C for DNA extraction.

2.3. Laboratory Analysis

2.3.1. Nutritional Composition

The samples of the TMR were analyzed for dry matter (method 930.15), crude protein (method 990.03), ether extract (method 920.39), and ash (method 942.05), as outlined by AOAC (2005) [20]. The content of organic matter in the TMR was calculated according to the difference between 100% and ash. The contents of NDF (heat-stable α-amylase-treated) and ADF in the TMR were determined according to the method described by Van Soest et al. (1991) [21].

2.3.2. Serum Indices

The concentrations of triiodothyronine, growth hormone, serum urea nitrogen, glucose, and total protein in serum were determined using commercial ELISA kits (Feiya Biology Co., Ltd., Jiangsu, China), and the serum thyroxine concentration was analyzed using a commercial ELISA kit (Beijing Rigor Bioscience Development Co., Ltd., Beijing, China). The specific operation steps were performed according to the manufacturer’s instructions. The absorbance of the reaction was measured with a microplate reader (Multiskan Go, Thermo Fisher Scientific Oy, Vantaa, Finland) and the serum hormones and metabolite concentrations were calculated according to the formula in the instructions.

2.3.3. Ruminal Fermentation Characteristics and Cellulases

VFAs in rumen fluid samples from both group C and group E were analyzed using a gas chromatograph (Shimadzu GC-4800A, Kyoto, Japan) equipped with a 30 m × 0.32 mm × 0.25 mm capillary column and flame ionization detection. The temperatures of injector oven, column oven, and detector were set at 230, 160, and 240 °C, respectively. The NH3-N concentration in the rumen fluid was measured according to the indophenol colorimetric method described by Broderick and Kang (1980) [22]. The rumen fluid was centrifuged at 12,000× g for 20 min, and 40 μL of the supernatant was mixed with 2.5 mL phenol chromogenic agent and 2 mL hypochlorite solution in turn, and the color was developed in a water bath at 37 °C for 30 min. The NH3-N concentration was calculated according to the absorbance of the solution at the wavelength of 550 nm and the standard curve of NH3-N.
The concentrations of rumen cellulases were measured using bovine-specific cellulase and xylanase ELISA kits provided by Feiya Biology Co., Ltd. (Yancheng, China) and Lvye Biology Co., Ltd. (Kunming, China) The rumen fluid samples were preliminarily treated with ultrasonic disruption to ensure the optimal decomposition of the microbial cell wall to enhance the extraction of enzymes, following the manufacturer’s instructions for subsequent operations.

2.3.4. Ruminal Flora Quantitative Analysis

Total bacterial DNA was extracted from the rumen fluid samples collected from group C and group E using the APINeasy DNA Kit for feces (Beijing ZEPING Bioscience and Technology Co., Ltd., Beijing, China). The purity of the extracted DNA was assessed through agarose gel electrophoresis (1.5%), as recommended in a previous study [23]. The concentration of the DNA products was measured using a UV spectrophotometer (NanoDrop 2000, Thermo Scientific, Waltham, MA, USA). All samples were adjusted to a standardized concentration of 50 ng/µL for subsequent analyses.
To quantify bacterial concentrations, real-time PCR was conducted using specific primers targeting total bacteria, Ruminococcus albus (R. albus), Ruminococcus flavus (R. flavus), Butyrivibrio fibrisolvens (B. fibrisolvens), Fibrobacter succinogenes (F. succinogenes), Methanogens, Succinimonas amylolytica (S. amylolytica), Streptococcus bovis (S. bovis), and Prevotella ruminicola (P. ruminicola), as listed in Table 2. Initially, PCR amplification was performed, and the resulting products were purified using the GenElute Gel Recovery Kit (Sigma-Aldrich, St. Louis, MO, USA). Following purification, the concentrations of the PCR products were assessed, and gradual dilutions were prepared to generate standard curves for real-time PCR quantification. Finally, bacterial concentrations were calculated based on the quantitative analysis methods described by Li et al. (2014) [24] to provide details of the microbial community and its response to varying water temperatures in the feed of Eastern Anhui Yellow cattle.

2.4. Statistical Analysis

The valid difference analysis between bulls drinking warm and cold water was performed using a t-test in SPSS (version 27.0), and the assumption of normality was assessed using the Shapiro–Wilk test. All results were presented as mean values ± standard deviation (SD), with statistical significance recognized at p < 0.05, whereas a tendency was considered at 0.05 ≤ p < 0.10.

3. Results

3.1. Growth Performance

The initial body weight (BW) and final BW did not differ between groups C and E (Table 3). However, drinking warm water increased ADG (p = 0.024) and DMI (p = 0.046), and decreased (p = 0.047) the F:G ratio of bulls.

3.2. Thermal Stress Indicators

The heat production, respiratory rate, surface temperature, and rectal temperature of cattle were not different with varying water temperature (Table 4).

3.3. Serum Hormones and Metabolites

The concentrations of triiodothyronine (trend, p = 0.058), thyroxine (p = 0.021), serum urea nitrogen (p = 0.025), glucose (p = 0.011), and total protein (trend, p = 0.063) increased in bulls drinking cold water compared to warm water (Table 5).

3.4. Ruminal Fermentation Characteristics and Fiber Enzyme Concentrations

The rumen pH of bulls decreased (trend, p = 0.061) in group E compared to group C. The concentrations of NH3-N (p = 0.048), total VFA (p = 0.010), acetate (p = 0.009), propionate (p = 0.009), butyrate (trend, p = 0.066), isobutyrate (trend, p = 0.074), and valerate (trend, p = 0.091) concentrations were lower in group C compared to group E, whereas the A:P ratio did not change (Table 6).
Bulls drinking warm water had significantly increased concentrations of cellulase (p < 0.01) and xylanase (p < 0.05) in their rumen fluid compared to bulls drinking cold water (Figure 1).

3.5. Rumen Bacterial Abundance

Rumen bacterial analysis revealed that total bacterial abundance as well as specific species including Ruminococcus flavus (R. flavus), Ruminococcus albus (R. albus), and Prevotella ruminicola (P. ruminicola) were significantly lower (p < 0.05) in group C compared to group E. Conversely, there was no difference or trend between the two groups in the abundance of Fibrobacter succinogenes (F. succinogenes), Methanogens, Succinimonas amylolytica (S. amylophilus), and Streptococcus bovis (S. bovis) (Figure 2).

4. Discussion

4.1. Growth Performance

Cold temperature is a well-documented stressor that can impair antioxidant activity, immune function, and overall growth performance in animals [25,26]. In this study, we observed that bulls provided with cold water exhibited less weight gain compared to those given warm water. This finding is consistent with previous studies that show similar effects in beef cattle receiving warmer water during cold seasons [25], as well as in weaned piglets [27] and yaks [28]. Together, these findings reinforce the conclusion that cold water has a negative impact on animal performance, likely due to the increased metabolic demands associated with maintaining body temperature. Moreover, the digestion and absorption of feed in the digestive tract determines feed efficiency, and low feed digestibility may reduce feed efficiency and thus affect weight gain [29]. In our study, bulls drinking warm water during the winter showed enhanced cellulase and xylanase concentrations, suggesting that warm water may promote feed digestion by boosting cellulase concentrations in the rumen, thereby improving weight gain and feed efficiency. Additionally, cold stress is known to increase feed intake, as animals generate more heat to maintain body temperature [30]. Conversely, cold stress stimulates feed intake to enhance heat production. For example, Kennedy et al. reported that cold exposure increased the DMI of sheep but decreased the digestibility of dry matter and organic matter [31]. However, in the current study, bulls drinking cold water reduced the feed intake, perhaps because cold water reduced the activity of microorganisms, cellulase, and xylanase in the rumen of bulls, resulting in a decrease in the digestion rate of feed and increasing the retention time of feed in the rumen, thus reducing the feed intake [32]. Furthermore, Serviento et al. reported a reduction in the water intake of dairy cows when the ambient temperature was reduced from 17.25 °C to 8.27 °C [33]. In fact, water intake of cattle is positively correlated with DMI; the decrease in water temperature in this study may reduce the water intake, thereby reducing the DMI [34]. It is worth noting that while warm water intake increased the ADG of bulls in this study, it did not affect FBW. This may be due to the short experimental period and the small sample size, which reduced the statistical power to detect differences in FBW.

4.2. Thermal Stress Indicators

Cold-stimulated ruminants adapt to temperature reduction by increasing heat production and reducing heat dissipation [35]. In this study, cold water intake increased heat production (29.64 vs. 25.76 MJ/W0.75 h−1), likely as a result of the body’s efforts to maintain thermal balance. In fact, when temperatures rise, cattle can increase the frequency of their breathing to facilitate heat exchange and help regulate body temperature [36]. Conversely, in response to colder temperatures, cattle reduce their respiratory rate to conserve heat. However, in this study, water temperature did not alter the respiratory rate of the bulls, which may be due to the limited change in energy exchange between the bulls and the environment at the same temperature. Furthermore, this study found that cold water intake did not affect the bulls’ body surface or rectal temperature, which may reflect the final outcome of the body’s heat balance regulation. Although heat production and levels of triiodothyronine, thyroxine, and glucose increased, these changes likely helped elevate body temperature. However, the heat produced was counterbalanced by the cold water intake, which may have prevented any observable changes in the bulls’ body surface or rectal temperature.

4.3. Serum Hormones and Metabolites

Cold exposure alters the concentrations of corticosterone, triiodothyronine, and thyroxine in the bulls’ bloodstream through the regulation of the hypothalamic–pituitary–adrenal and hypothalamic–pituitary–thyroid axes. These hormonal changes help maintain body temperature stability and enable the cattle to adapt to environmental temperature fluctuations [37]. In this study, the higher concentrations of triiodothyronine and thyroxine in the serum of bulls drinking cold water suggest that cold water exposure imposed additional cold stress, prompting a physiological response to maintain thermal balance during the winter months.
Glucose, as a vital energy source, plays a crucial role in providing heat through energy metabolism [38]. In this study, the bulls drinking cold water in winter had elevated serum glucose concentration. This likely indicates that the cold water stimulated the bulls to release more heat to maintain body temperature, which in turn resulted in increased glucose concentration. Wang et al. also reported a significant increase in serum glucose concentrations in beef cattle subjected to long-term cold stress [9].
Serum urea nitrogen and total protein levels reflect the protein balance in cattle [39]. It has been reported that long-term cold stress can increase the secretion of glucocorticoids in cattle, thereby enhancing the decomposition of proteins to obtain energy and leading to an increase in serum urea nitrogen concentration [11,40]. Moreover, the synthesis of cold shock proteins in organisms increased to protect and maintain the normal physiological functions of the body when the ambient temperature decreases [41]. Therefore, the serum concentrations of urea nitrogen and total protein were both increased in bulls drinking cold water compared to warm water.

4.4. Ruminal Fermentation Characteristics and Cellulase

Warm water intake during winter may promote the production of beneficial VFAs such as acetate and propionate, which are microbial byproducts that support energy metabolism and gut health [42,43]. The increase in total VFA concentration in the rumen of bulls drinking warm water could be due to the enhanced activity of rumen microorganisms and feed digestion, which in turn boosts VFA production. In addition, as an important energy substance of the body, VFA may be rapidly consumed to maintain body temperature balance, while the intake of cold water consumes the body’s heat to maintain body temperature, resulting in a decrease in total volatile acid in the rumen fluid of bulls fed with cold water. Acetate is primarily produced by anaerobic bacteria such as Bacteroides spp. and Akkermansia muciniphila [44], which contributes to energy and lipid metabolism, immunity, and stress resilience [45]. Propionate is mostly generated through carbohydrate metabolism, supporting lipid metabolism, mitochondrial function, and immune health [46,47]. The higher concentrations of acetate and propionate in bulls drinking warm water further indicate that higher water temperature may facilitate lipid metabolism to enhance resilience and growth performance during cold periods. NH3-N is the product of protein degradation in the rumen, which is affected by many factors such as dietary nitrogen content, protein degradation rate, microbial synthesis efficiency, rumen wall absorption, and energy level. The intake of warm water in this study increased the NH3-N concentration in rumen fluid, perhaps because warm water enhanced the activity of proteolytic bacteria such as P. ruminicola in the rumen and promoted the digestion of protein in feed [48]. In addition, considering the potential for microbial adaptation over time, prolonged exposure to cold water may induce cold adaptation within the rumen microbial community [49]. Initially, lower temperatures are likely to suppress microbial activity and fermentation efficiency, resulting in reduced NH3-N concentrations. However, with sustained cold exposure, we speculate that the microbial population may adapt through the selection of cold-tolerant species or the modification of metabolic pathways to maintain nitrogen utilization efficiency. This adaptation may eventually compensate for the initial reductions in fermentation, potentially narrowing the NH3-N differences between groups over time. Since our study lasted only one month, it remains unclear whether such long-term microbial shifts occurred. Future research with a prolonged experimental period would be necessary to confirm the adaptive responses of rumen microbes to cold exposure. Furthermore, the production of NH3-N in the rumen is dependent on the availability of nitrogen from feed. Cold water intake reduced nitrogen intake in bulls by decreasing DMI, thereby limiting the substrate available for ammonia nitrogen production.
Cellulase and xylanase, two key enzymes produced by microbes, play crucial roles in converting lignocellulose into animal feed or fermentable sugars for ethanol production, with widespread applications in food, medicine, and agriculture [50,51]. In this study, bulls provided with warm water showed significantly higher concentrations of cellulase and xylanase, consistent with findings in beef cattle [25]. In fact, cellulase and xylanase in the rumen are metabolism products of bacteria such as F. succinogenes, R. albus, and R. flavefaciens, and their concentrations are closely related to the activity of rumen microorganisms [52]. He et al. reported that feeding cold water to beef cattle in winter reduced the concentrations of cellulase and xylanase in the rumen, which was consistent with this study [25]. The current study showed that bulls provided with warm water exhibited a significantly higher abundance of total bacteria, B. fibrisolvens, R. albus, R. flavefaciens, and P. ruminicola, which may have contributed to the observed increase in rumen cellulase and xylanase concentrations.

4.5. Rumen Bacterial Abundance

Microorganisms play a crucial role in feed digestion and overall animal health [53]. B. fibrisolvens, R. albus, R. flavefaciens, and P. ruminicola are known ruminal fiber-degrading bacteria that produce digestive enzymes to break down fiber and contribute to feed digestion in the rumen. Brod et al. reported that the lower (30 to 0 °C) the temperature of water consumed by sheep, the longer the time (72 to 108 min) for the rumen to return to normal temperature [18]. Similar studies reported that cold water intake significantly reduced rumen temperature compared to warm water intake [54]. In the present study, cold water intake decreased the abundance of rumen microorganisms, likely due to reduced microbial activity caused by lower rumen temperature [25]. In addition, B. fibrisolvens is a prominent rumen bacterium that ferments polysaccharides, assisting in cellulose breakdown [47], and also acts as a probiotic that promotes the production of beneficial metabolites such as butyrate and lactate [55]. R. albus, another probiotic and cellulolytic bacterium, enhances fiber digestion and oxidative resistance [56]. Similarly, R. flavefaciens is a key fiber-degrading anaerobe associated with improved weight gain, feed digestibility, and fermentation efficiency [57,58]. P. ruminicola (cellulolytic species) has been found in higher abundance in cows supplemented with riboflavin [59] and in high-yielding dairy cattle [60]. These findings suggest that warm water intake during the cold period may enhance cellulose metabolism by promoting the colonization of these beneficial probiotic bacteria in the rumen, ultimately supporting better digestion and improved growth performance.

5. Conclusions

Drinking warm water in winter led to improved growth performance in bulls due to the promotion of ADG and DMI and a reduction in the F:G ratio. This improvement may be attributed to reduced energy loss and increased ruminal VFA concentrations. Additionally, warm water intake alleviated the stress associated with maintaining thermal balance from cold water, as evidenced by lower concentrations of thyroxine, serum urea nitrogen, and glucose in the blood. Furthermore, warm water intake enhanced rumen fermentation by increasing the abundance of total bacteria and fiber-digesting bacteria and the concentration of cellulase and xylanase in the rumen. Therefore, providing warm water to bulls is crucial for improving their growth during the winter months. However, this is a preliminary study with a limited sample size, and the results should be interpreted with caution. Further studies with larger sample sizes are necessary to confirm these findings.

Author Contributions

Conceptualization, P.Y.; data curation, J.L.; formal analysis, J.L. and Z.C.; funding acquisition, P.Y.; investigation, M.W. and C.Y.; resources, P.Y.; supervision, P.Y.; writing—original draft, J.L.; writing—review and editing, P.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the Public Welfare Industry (Agriculture) Scientific Research Projects (201303145) and the National Natural Science Foundation of China (3150930).

Institutional Review Board Statement

The animals were treated as approved by the Humane Animal Care and Ethics Committee of the Nanjing Agricultural University, China (No. SYXK2011-0036; date: 13 July 2011).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author. The data are not publicly available due to further scientific use.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Gleason, C.B.; White, R.R. Beef species-ruminant nutrition cactus beef symposium: A role for beef cattle in sustainable U.S. food production1. J. Anim. Sci. 2019, 97, 4010–4020. [Google Scholar] [CrossRef] [PubMed]
  2. Martin, G.B.; Fordyce, G.; McGowan, M.R.; Juengel, J.L. Perspectives for reproduction and production in grazing sheep and cattle in Australasia: The next 20 years. Theriogenology 2024, 230, 174–182. [Google Scholar] [CrossRef] [PubMed]
  3. Sorbolini, S.; Bongiorni, S.; Cellesi, M.; Gaspa, G.; Dimauro, C.; Valentini, A.; Macciotta, N.P. Genome wide association study on beef production traits in Marchigiana cattle breed. J. Anim. Breed. Genet. = Z. Fur Tierz. Und Zucht. 2017, 134, 43–48. [Google Scholar] [CrossRef] [PubMed]
  4. Zachut, M.; Šperanda, M.; de Almeida, A.M.; Gabai, G.; Mobasheri, A.; Hernández-Castellano, L.E. Biomarkers of fitness and welfare in dairy cattle: Healthy productivity. J. Dairy Res. 2020, 87, 4–13. [Google Scholar] [CrossRef]
  5. Chauhan, S.S.; Rashamol, V.P.; Bagath, M.; Sejian, V.; Dunshea, F.R. Impacts of heat stress on immune responses and oxidative stress in farm animals and nutritional strategies for amelioration. Int. J. Biometeorol. 2021, 65, 1231–1244. [Google Scholar] [CrossRef]
  6. Hylander, B.L.; Repasky, E.A. Temperature as a modulator of the gut microbiome: What are the implications and opportunities for thermal medicine? Int. J. Hyperth. Off. J. Eur. Soc. Hyperthermic Oncol. N. Am. Hyperth. Group 2019, 36, 83–89. [Google Scholar] [CrossRef]
  7. Castellani, J.W.; Tipton, M.J. Cold Stress Effects on Exposure Tolerance and Exercise Performance. Compr. Physiol. 2015, 6, 443–469. [Google Scholar]
  8. Fu, X.; Zhang, Y.; Zhang, Y.G.; Yin, Y.L.; Yan, S.C.; Zhao, Y.Z.; Shen, W.Z. Research and application of a new multilevel fuzzy comprehensive evaluation method for cold stress in dairy cows. J. Dairy Sci. 2022, 105, 9137–9161. [Google Scholar] [CrossRef]
  9. Wang, S.; Li, Q.; Peng, J.; Niu, H. Effects of Long-Term Cold Stress on Growth Performance, Behavior, Physiological Parameters, and Energy Metabolism in Growing Beef Cattle. Animals 2023, 13, 1619. [Google Scholar] [CrossRef]
  10. Broucek, J.; Letkovicova, M.; Kovalcuj, K. Estimation of cold stress effect on dairy cows. Int. J. Biometeorol. 1991, 35, 29–32. [Google Scholar] [CrossRef]
  11. Shi, L.; Xu, Y.; Jin, X. Influence of Cold Environments on Growth, Antioxidant Status, Immunity and Expression of Related Genes in Lambs. Animals 2022, 12, 2535. [Google Scholar] [CrossRef] [PubMed]
  12. Jiang, Y.; Jia, D.; Sun, Y.; Ding, N.; Wang, L. Microbiota: A key factor affecting and regulating the efficacy of immunotherapy. Clin. Transl. Med. 2023, 13, e1508. [Google Scholar] [CrossRef]
  13. Jia, X.; Xu, W.; Zhang, L.; Li, X.; Wang, R.; Wu, S. Impact of Gut Microbiota and Microbiota-Related Metabolites on Hyperlipidemia. Front. Cell. Infect. Microbiol. 2021, 11, 634780. [Google Scholar] [CrossRef] [PubMed]
  14. Gomaa, E.Z. Human gut microbiota/microbiome in health and diseases: A review. Antonie Van Leeuwenhoek 2020, 113, 2019–2040. [Google Scholar] [CrossRef]
  15. Nishino, K.; Nishida, A.; Inoue, R.; Kawada, Y.; Ohno, M.; Sakai, S.; Inatomi, O.; Bamba, S.; Sugimoto, M.; Kawahara, M.; et al. Analysis of endoscopic brush samples identified mucosa-associated dysbiosis in inflammatory bowel disease. J. Gastroenterol. 2018, 53, 95–106. [Google Scholar] [CrossRef]
  16. Li, Y.; Xia, S.; Jiang, X.; Feng, C.; Gong, S.; Ma, J.; Fang, Z.; Yin, J.; Yin, Y. Gut Microbiota and Diarrhea: An Updated Review. Front. Cell. Infect. Microbiol. 2021, 11, 625210. [Google Scholar] [CrossRef] [PubMed]
  17. Szóstak, N.; Figlerowicz, M.; Philips, A. The emerging role of the gut mycobiome in liver diseases. Gut Microbes 2023, 15, 2211922. [Google Scholar] [CrossRef] [PubMed]
  18. Brod, D.L.; Bolsen, K.K.; Brent, B.E. Effect of water temperature on rumen temperature, digestion and rumen fermentation in sheep. J. Anim. Sci. 1982, 54, 179–182. [Google Scholar] [CrossRef]
  19. Mclean, J.; Tobin, G. Animal and Human Calorimetry; Cambridge University Press: Cambridge, UK, 2007. [Google Scholar]
  20. Berbert Queiroz, D.M.; Melo, E.C. AOAC. 2005. Official Methods of Analysis of AOAC International. J. AOAC Int. 1997, 80, 127A. [Google Scholar]
  21. van Soest, P.J.; Robertson, J.B.; Lewis, B.A. Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J. Dairy Sci. 1991, 74, 3583–3597. [Google Scholar] [CrossRef]
  22. Broderick, G.A.; Kang, J.H. Automated simultaneous determination of ammonia and total amino acids in ruminal fluid and in vitro media. J. Dairy Sci. 1980, 63, 64–75. [Google Scholar] [CrossRef] [PubMed]
  23. Gu, Z.; Zhu, Y.; Jiang, S.; Xia, G.; Li, C.; Zhang, X.; Zhang, J.; Shen, X. Tilapia head glycolipids reduce inflammation by regulating the gut microbiota in dextran sulphate sodium-induced colitis mice. Food Funct. 2020, 11, 3245–3255. [Google Scholar] [CrossRef]
  24. Li, F.; Cao, Y.; Liu, N.; Yang, X.; Yao, J.; Yan, D. Subacute ruminal acidosis challenge changed in situ degradability of feedstuffs in dairy goats. J. Dairy Sci. 2014, 97, 5101–5109. [Google Scholar] [CrossRef]
  25. He, T.; Long, S.; Yi, G.; Wang, X.; Li, J.; Wu, Z.; Guo, Y.; Sun, F.; Liu, J.; Chen, Z. Heating Drinking Water in Cold Season Improves Growth Performance via Enhancing Antioxidant Capacity and Rumen Fermentation Function of Beef Cattle. Antioxidants 2023, 12, 1492. [Google Scholar] [CrossRef] [PubMed]
  26. Zhao, F.Q.; Zhang, Z.W.; Qu, J.P.; Yao, H.D.; Li, M.; Li, S.; Xu, S.W. Cold stress induces antioxidants and Hsps in chicken immune organs. Cell Stress Chaperones 2014, 19, 635–648. [Google Scholar] [CrossRef]
  27. Zhang, Z.; Li, Z.; Zhao, H.; Chen, X.; Tian, G.; Liu, G.; Cai, J.; Jia, G. Effects of Drinking Water Temperature and Flow Rate during Cold Season on Growth Performance, Nutrient Digestibility and Cecum Microflora of Weaned Piglets. Animals 2020, 10, 1048. [Google Scholar] [CrossRef] [PubMed]
  28. Liu, T.; Wang, Q.; Gao, C.; Long, S.; He, T.; Wu, Z.; Chen, Z. Drinking Warm Water Promotes Performance by Regulating Ruminal Microbial Composition and Serum Metabolites in Yak Calves. Microorganisms 2023, 11, 2092. [Google Scholar] [CrossRef] [PubMed]
  29. Callet, T.; Dupont-Nivet, M.; Cluzeaud, M.; Jaffrezic, F.; Laloë, D.; Kerneis, T.; Labbé, L.; Quillet, E.; Geurden, I.; Mazurais, D.; et al. Detection of new pathways involved in the acceptance and the utilisation of a plant-based diet in isogenic lines of rainbow trout fry. PLoS ONE 2018, 13, e0201462. [Google Scholar] [CrossRef]
  30. Sutter, F.; Borchardt, S.; Schuenemann, G.M.; Rauch, E.; Erhard, M.; Heuwieser, W. Evaluation of 2 different treatment procedures after calving to improve harvesting of high-quantity and high-quality colostrum. J. Dairy Sci. 2019, 102, 9370–9381. [Google Scholar] [CrossRef]
  31. Kennedy, P.M.; Milligan, L.P. Effects of cold exposure on digestion, microbial synthesis and nitrogen transformations in sheep. Br. J. Nutr. 1978, 39, 105–117. [Google Scholar] [CrossRef]
  32. Shen, Y.; Wang, H.; Ran, T.; Yoon, I.; Saleem, A.M.; Yang, W. Influence of yeast culture and feed antibiotics on ruminal fermentation and site and extent of digestion in beef heifers fed high grain rations1. J. Anim. Sci. 2018, 96, 3916–3927. [Google Scholar] [CrossRef] [PubMed]
  33. Serviento, A.M.; He, T.; Ma, X.; Räisänen, S.E.; Niu, M. Modeling the effect of ambient temperature on reticulorumen temperature, and drinking and eating behaviors of late-lactation dairy cows during colder seasons. Animal 2024, 18, 101209. [Google Scholar] [CrossRef] [PubMed]
  34. Wagner, J.J.; Engle, T.E. Invited Review: Water consumption, and drinking behavior of beef cattle, and effects of water quality. Appl. Anim. Sci. 2021, 37, 418–435. [Google Scholar] [CrossRef]
  35. Mun, S.; Park, K.; Lee, S. Evaluation of thermal sensitivity is of potential clinical utility for the predictive, preventive, and personalized approach advancing metabolic syndrome management. EPMA J. 2022, 13, 125–135. [Google Scholar] [CrossRef] [PubMed]
  36. Brcko, C.C.; da Silva, J.A.R.; Martorano, L.G.; Vilela, R.A.; Nahúm, B.S.; Silva, A.G.M.; Barbosa, A.V.C.; Bezerra, A.S.; Lourenço Júnior, J.B. Infrared Thermography to Assess Thermoregulatory Reactions of Female Buffaloes in a Humid Tropical Environment. Front. Vet. Sci. 2020, 7, 180. [Google Scholar] [CrossRef]
  37. Sejian, V.; Maurya, V.P.; Naqvi, S.M.K. Adaptive capability as indicated by endocrine and biochemical responses of Malpura ewes subjected to combined stresses (thermal and nutritional) in a semi-arid tropical environment. Int. J. Biometeorol. 2010, 54, 653–661. [Google Scholar] [CrossRef]
  38. Zhou, L.; Wang, Y.; Zhou, M.; Zhang, Y.; Wang, P.; Li, X.; Yang, J.; Wang, H.; Ding, Z. HOXA9 inhibits HIF-1α-mediated glycolysis through interacting with CRIP2 to repress cutaneous squamous cell carcinoma development. Nat. Commun. 2018, 9, 1480. [Google Scholar] [CrossRef]
  39. Geng, A.L.; Zhang, Y.; Zhang, J.; Zeng, L.C.; Chang, C.; Wang, H.H.; Yan, Z.X.; Chu, Q.; Liu, H.G. Effects of light regime on the hatching performance, body development and serum biochemical indexes in Beijing You Chicken. Poult. Sci. 2021, 100, 101270. [Google Scholar] [CrossRef]
  40. Kocalis, H.E.; Hagan, S.L.; George, L.; Turney, M.K.; Siuta, M.A.; Laryea, G.N.; Morris, L.C.; Muglia, L.J.; Printz, R.L.; Stanwood, G.D.; et al. Rictor/mTORC2 facilitates central regulation of energy and glucose homeostasis. Mol. Metab. 2014, 3, 394–407. [Google Scholar] [CrossRef]
  41. Huang, L.; Shakhnovich, E.I. Is there an en route folding intermediate for Cold shock proteins? Protein Sci. A Publ. Protein Soc. 2012, 21, 677–685. [Google Scholar] [CrossRef]
  42. He, J.; Zhang, P.; Shen, L.; Niu, L.; Tan, Y.; Chen, L.; Zhao, Y.; Bai, L.; Hao, X.; Li, X.; et al. Short-Chain Fatty Acids and Their Association with Signalling Pathways in Inflammation, Glucose and Lipid Metabolism. Int. J. Mol. Sci. 2020, 21, 6356. [Google Scholar] [CrossRef] [PubMed]
  43. Parada Venegas, D.; De la Fuente, M.K.; Landskron, G.; González, M.J.; Quera, R.; Dijkstra, G.; Harmsen, H.J.M.; Faber, K.N.; Hermoso, M.A. Short Chain Fatty Acids (SCFAs)-Mediated Gut Epithelial and Immune Regulation and Its Relevance for Inflammatory Bowel Diseases. Front. Immunol. 2019, 10, 277. [Google Scholar]
  44. Koh, A.; De Vadder, F.; Kovatcheva-Datchary, P.; Bäckhed, F. From Dietary Fiber to Host Physiology: Short-Chain Fatty Acids as Key Bacterial Metabolites. Cell 2016, 165, 1332–1345. [Google Scholar] [CrossRef]
  45. Erny, D.; Dokalis, N.; Mezö, C.; Castoldi, A.; Mossad, O.; Staszewski, O.; Frosch, M.; Villa, M.; Fuchs, V.; Mayer, A.; et al. Microbiota-derived acetate enables the metabolic fitness of the brain innate immune system during health and disease. Cell Metab. 2021, 33, 2260–2276.e7. [Google Scholar] [CrossRef] [PubMed]
  46. Haghikia, A.; Zimmermann, F.; Schumann, P.; Jasina, A.; Roessler, J.; Schmidt, D.; Heinze, P.; Kaisler, J.; Nageswaran, V.; Aigner, A.; et al. Propionate attenuates atherosclerosis by immune-dependent regulation of intestinal cholesterol metabolism. Eur. Heart J. 2022, 43, 518–533. [Google Scholar] [CrossRef]
  47. Wei, Y.; Liu, W.; Wang, R.; Chen, Y.; Liu, J.; Guo, X.; Can, C.; Yang, X.; Wang, D.; Hu, X.; et al. Propionate promotes ferroptosis and apoptosis through mitophagy and ACSL4-mediated ferroptosis elicits anti-leukemia immunity. Free. Radic. Biol. Med. 2024, 213, 36–51. [Google Scholar] [CrossRef]
  48. Luise, D.; Correa, F.; Stefanelli, C.; Simongiovanni, A.; Chalvon-Demersay, T.; Zini, M.; Fusco, L.; Bosi, P.; Trevisi, P. Productive and physiological implications of top-dress addition of branched-chain amino acids and arginine on lactating sows and offspring. J. Anim. Sci. Biotechnol. 2023, 14, 40. [Google Scholar] [CrossRef]
  49. Shen, L.; Zang, X.; Sun, K.; Chen, H.; Che, X.; Sun, Y.; Wang, G.; Zhang, S.; Chen, G. Complete genome sequencing of Bacillus sp. TK-2, analysis of its cold evolution adaptability. Sci. Rep. 2021, 11, 4836. [Google Scholar] [CrossRef]
  50. Ben Hmad, I.; Mokni Ghribi, A.; Bouassida, M.; Ayadi, W.; Besbes, S.; Ellouz Chaabouni, S.; Gargouri, A. Combined effects of α-amylase, xylanase, and cellulase coproduced by Stachybotrys microspora on dough properties and bread quality as a bread improver. Int. J. Biol. Macromol. 2024, 277, 134391. [Google Scholar] [CrossRef]
  51. Rabee, A.E.; Forster, R.; Sabra, E.A. Lignocelluloytic activities and composition of bacterial community in the camel rumen. AIMS Microbiol. 2021, 7, 354–367. [Google Scholar] [CrossRef]
  52. Yeoman, C.J.; Fields, C.J.; Lepercq, P.; Ruiz, P.; Forano, E.; White, B.A.; Mosoni, P. In Vivo Competitions between Fibrobacter succinogenes, Ruminococcus flavefaciens, and Ruminoccus albus in a Gnotobiotic Sheep Model Revealed by Multi-Omic Analyses. mBio 2021, 12, 2. [Google Scholar] [CrossRef]
  53. Zhao, Y.; Li, P.; Chen, N.; Liu, Y.; Liu, D.; Guo, Y. Effects of housing systems and glucose oxidase on growth performance and intestinal health of Beijing You Chickens. Poult. Sci. 2021, 100, 100943. [Google Scholar] [CrossRef]
  54. Petersen, M.K.; Muscha, J.M.; Mulliniks, J.T.; Roberts, A.J. Water temperature impacts water consumption by range cattle in winter. J. Anim. Sci. 2016, 94, 4297–4306. [Google Scholar] [CrossRef] [PubMed]
  55. Asanuma, N.; Kawato, M.; Hino, T. Presence of Butyrivibrio fibrisolvens in the digestive tract of dogs and cats, and its contribution to butyrate production. J. Gen. Appl. Microbiol. 2001, 47, 313–319. [Google Scholar] [CrossRef] [PubMed]
  56. Park, J.; Lee, J.; Yeom, Z.; Heo, D.; Lim, Y.H. Neuroprotective effect of Ruminococcus albus on oxidatively stressed SH-SY5Y cells and animals. Sci. Rep. 2017, 7, 14520. [Google Scholar] [CrossRef]
  57. Præsteng, K.E.; Pope, P.B.; Cann, I.K.; Mackie, R.I.; Mathiesen, S.D.; Folkow, L.P.; Eijsink, V.G.; Sundset, M.A. Probiotic dosing of Ruminococcus flavefaciens affects rumen microbiome structure and function in reindeer. Microb. Ecol. 2013, 66, 840–849. [Google Scholar] [CrossRef] [PubMed]
  58. Hassan, A.; Gado, H.; Anele, U.Y.; Berasain, M.A.M.; Salem, A.Z.M. Influence of dietary probiotic inclusion on growth performance, nutrient utilization, ruminal fermentation activities and methane production in growing lambs. Anim. Biotechnol. 2020, 31, 365–372. [Google Scholar] [CrossRef]
  59. Wu, H.M.; Zhang, J.; Wang, C.; Liu, Q.; Guo, G.; Huo, W.J.; Chen, L.; Zhang, Y.L.; Pei, C.X.; Zhang, S.L. Effects of riboflavin supplementation on performance, nutrient digestion, rumen microbiota composition and activities of Holstein bulls. Br. J. Nutr. 2021, 126, 1288–1295. [Google Scholar] [CrossRef]
  60. Lv, X.; Chen, L.; Zhou, C.; Zhang, G.; Xie, J.; Kang, J.; Tan, Z.; Tang, S.; Kong, Z.; Liu, Z.; et al. Application of different proportions of sweet sorghum silage as a substitute for corn silage in dairy cows. Food Sci. Nutr. 2023, 11, 3575–3587. [Google Scholar] [CrossRef]
Fermentation 11 00132 g001
Figure 1. Comparative analysis of rumen cellulase levels in bulls provided with cold versus warm water (*, p < 0.05; **, p < 0.01). C, bulls drinking cold water; E, bulls drinking warm water.
Figure 1. Comparative analysis of rumen cellulase levels in bulls provided with cold versus warm water (*, p < 0.05; **, p < 0.01). C, bulls drinking cold water; E, bulls drinking warm water.
Fermentation 11 00132 g001
Fermentation 11 00132 g002
Figure 2. Comparative analysis of rumen bacterial abundance in bulls provided with cold versus warm water (*, p < 0.05). C, bulls drinking cold water; E, bulls drinking warm water.
Figure 2. Comparative analysis of rumen bacterial abundance in bulls provided with cold versus warm water (*, p < 0.05). C, bulls drinking cold water; E, bulls drinking warm water.
Fermentation 11 00132 g002
Table 1. Ingredients and chemical composition of experimental diets.
Table 1. Ingredients and chemical composition of experimental diets.
ItemContent
Ingredients, %
Corn silage85.50
Dry straw4.50
Ground corn7.00
Soybean meal2.50
Calcium carbonate0.04
Calcium hydrogen phosphate0.06
Sodium bicarbonate0.10
Sodium chloride0.08
Limestone0.13
Premix 10.09
Chemical composition, % of DM
Dry matter87.26
Organic matter94.47
Crude protein8.14
Ether extract6.53
Neutral detergent fiber61.95
Acid detergent fiber34.24
Calcium0.83
Phosphorus0.27
Metabolic energy (MJ kg−1) 27.30
1 Supplied per kilogram of dietary DM: VA 264 IU, VD 34 IU, VE 2.6 IU, Cu 1.2 mg, Mn 4.8 mg, Fe 6.0 mg, I 0.03 mg, Co 0.012 mg, Se 0.036 mg; 2 metabolic energy was a calculated value.
Table 2. Specific primers used for real-time PCR in this study.
Table 2. Specific primers used for real-time PCR in this study.
Target GenePrimersPrimer Sequence (5′→3′)Size (bp)
Total bacteriaFCGGCAACGAGCGCAACCC130
RCCATTGTAGCACGTGTGTAGCC
Ruminococcus albusFCCCTAAAAGCAGTCTTAGTTCG176
RCCTCCTTGCGGTTAGAACA
Ruminococcus flavusFCGAACGGAGATAATTTGAGTTTACTTAGG132
RCGGTCTCTGTATGTTATGAGGTATTACC
Butyrivibrio fibrisolvensFGCCTCAGCGTCAGTAATCG121
RGGAGCGTAGGCGGTTTTAC
Fibrobacter succinogenesFGTTCGGAATTACTGGGCGTAAA121
RCGCCTGCCCCTGAACTATC
MethanogensFTTCGGTGGATCDCARAGRGC232
RGBARGTCGWAWCCGTAGAATCC
Succinimonas amylolyticaFCGTTGGGCGGTCATTTGAAAC139
RCCTGAGCGTCAGTTACTATCCAGA
Streptococcus bovisFATGTTAGATGCTTGAAAGGAGCAA127
RCGCCTTGGTGAGCCGTTA
Prevotella ruminicolaFGAAAGTCGGATTAATGCTCTATGTTG102
RCATCCTATAGCGGTAAACCTTTGG
Table 3. Growth performance in bulls provided with cold water versus warm water.
Table 3. Growth performance in bulls provided with cold water versus warm water.
Group 2
Item 1CEp-Value
IBW, kg359.34 ± 10.62371.57 ± 14.560.523
FBW, kg399.98 ± 8.54420.08 ± 16.110.313
ADG, kg/d0.95 ± 0.051.15 ± 0.030.024
DMI, kg/d6.45 ± 0.926.76 ± 0.080.046
F:G, ratio6.71 ± 0.265.89 ± 0.220.047
1 IBW = initial body weight, FBW = final body weight, ADG = average daily gain, DMI = dry matter intake, F:G ratio = the ratio of feed intake and weight gain. 2 C, bulls drinking cold water; E, bulls drinking warm water.
Table 4. Thermal stress indicators in bulls provided with cold water versus warm water.
Table 4. Thermal stress indicators in bulls provided with cold water versus warm water.
Group 1
ItemCEp-Value
Heat production, MJ/W0.75 h−129.64 ± 6.9525.76 ± 4.520.385
Respiratory rate, min−18.94 ± 2.3810.44 ± 2.250.395
Body surface temperature, °C
Spatial temperature 5–9 °C15.97 ± 1.4916.19 ± 1.830.746
Spatial temperature 9–11 °C20.67 ± 1.6421.06 ± 0.430.673
Spatial temperature 14–16 °C23.00 ± 1.8923.96 ± 1.120.416
Rectal temperature, °C38.00 ± 0.5038.24 ± 0.230.417
1 C, bulls drinking cold water; E, bulls drinking warm water.
Table 5. Serum hormones and metabolites in bulls provided with cold water versus warm water.
Table 5. Serum hormones and metabolites in bulls provided with cold water versus warm water.
Group 1
ItemCEp-Value
Triiodothyronine, ng/mL1.53 ± 0.091.22 ± 0.090.058
Thyroxine, ng/mL134.28 ± 1.04128.99 ± 1.350.021
Growth hormone, ng/mL5.26 ± 0.155.38 ± 0.260.688
Serum urea nitrogen, mmol/L6.79 ± 0.405.55 ± 0.130.025
Glucose, mmol/L4.85 ± 0.094.40 ± 0.080.011
Total protein, g/L58.82 ± 3.6154.07 ± 2.450.063
1 C, bulls drinking cold water; E, bulls drinking warm water.
Table 6. Rumen pH and fermentation parameters in bulls provided with cold water versus warm water.
Table 6. Rumen pH and fermentation parameters in bulls provided with cold water versus warm water.
Group 2
ItemCEp-Value
Rumen pH7.27 ± 0.047.19 ± 0.030.061
NH3-N, mg/dL4.67 ± 0.195.23 ± 0.110.048
Total VFA, mM60.52 ± 2.1978.61 ± 4.340.010
Acetate, mM41.92 ± 1.6255.14 ± 3.040.009
Propionate, mM10.26 ± 0.4013.49 ± 0.750.009
Butyrate, mM4.53 ± 0.185.30 ± 0.290.066
Iso-butyrate, mM0.88 ± 0.081.09 ± 0.060.074
Valerate, mM1.19 ± 0.111.47 ± 0.080.091
Iso-valerate, mM1.25 ± 0.172.11 ± 0.210.139
A:P, ratio 14.36 ± 0.084.48 ± 0.170.539
1 A:P = the ratio of acetate and propionate; 2 C, bulls drinking cold water; E, bulls drinking warm water.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, J.; Cui, Z.; Wei, M.; Yin, C.; Yan, P. Comparison of Effects of Cold and Warm Water Intake in Winter on Growth Performance, Thermoregulation, Rumen Fermentation Parameters, and Microflora of Wandong Bulls (Bos taurus). Fermentation 2025, 11, 132. https://doi.org/10.3390/fermentation11030132

AMA Style

Li J, Cui Z, Wei M, Yin C, Yan P. Comparison of Effects of Cold and Warm Water Intake in Winter on Growth Performance, Thermoregulation, Rumen Fermentation Parameters, and Microflora of Wandong Bulls (Bos taurus). Fermentation. 2025; 11(3):132. https://doi.org/10.3390/fermentation11030132

Chicago/Turabian Style

Li, Jing, Zhihao Cui, Ming Wei, Chunqing Yin, and Peishi Yan. 2025. "Comparison of Effects of Cold and Warm Water Intake in Winter on Growth Performance, Thermoregulation, Rumen Fermentation Parameters, and Microflora of Wandong Bulls (Bos taurus)" Fermentation 11, no. 3: 132. https://doi.org/10.3390/fermentation11030132

APA Style

Li, J., Cui, Z., Wei, M., Yin, C., & Yan, P. (2025). Comparison of Effects of Cold and Warm Water Intake in Winter on Growth Performance, Thermoregulation, Rumen Fermentation Parameters, and Microflora of Wandong Bulls (Bos taurus). Fermentation, 11(3), 132. https://doi.org/10.3390/fermentation11030132

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop