Study on the Effect of Conditioners on the Degradation of Tetracycline Antibiotics in Deer Manure Composting
Round 1
Reviewer 1 Report
Comments and Suggestions for AuthorsA manuscript describes the effect of different conditioners on the degradation of tetracycline antibiotics in deer manure composting. This paper is written properly, contributes new, interesting and original data. However, there are some elements that should be explained and completed.
Introduction:
Line 33: “Deworming drugs” for antibiotics is not correct.
Line 36:” Most antibiotics defecate and accumulate in animal feces…” This sentence should be corrected, because most antibiotics are excreted with urine, not „defecate”. Plese provide what percentage of TCs are eliminated via urine.
Why authors chose Deer Manure for this study, while most of antibiotics are administered in livestock. Is there much deer farming in China?
Authors analysed only three TCs: oxytetracycline, chlortetracycline na tetracycline. Why doxycycline was not considered, while among all tetracyclines, this compound is the most stable. Besides in Europe, doxycycline is one of the most common antibiotics used in farm animals. According to EU Reports, most non-compliant results on the residues in food concern doxycycline.
Materials and Methods:
Line 104: How the homogenity of the material after adding the TCs was checked?
Line 104: „ tetracycline was added…” only one tetracycline was added?
Line 105: Why concentration of tetracycline increased by 10 time?
Line 104: In what concentrations TCs were given to the manure before experiment? Where did the analytical standards of TCs come from?
The paragraph „Chemicals and reagents” for analytical methods are lacking. Which equipment for UV detection was used?
Line 129: The sample preparation is not clear and needs to be rewrite!
„… Dry with nitrogen gas, purify with a solid-phase extraction column, pass through a 0.22 μm filter membranę…” Which SPE columns and columns were used? The evaporation of extract was before purification on SPE columns? What solvent to dry residue dissolve was used?
Results and discussion:
This part is described in detail, but many information concern data not exactly suggested by the title of this paper like changes in physical properties during four composting proces (Fig. 2), Changes in bacterial genus level and Shannon index during four composting processes (Fig. 3), Changes in relative abundance and Shannon index of genus level fungal populations dur-303 ing four composting processes (Fig 4) . Please, condiser rewrite the title to include additional elements providing in this paper.
Instead of a few above mention points, In discussion part, some general information about the stability of tetracyclines in the environment should be presented.
Suplementary material:
Table S1: The work relates to tetracyclines, while in Table S1 chloramphenicol is presented.
Table S4: Data for aureomycin??? are performed.
Author Response
Dear editor and reviewer:
Thank you so much for your letter. We are so appreciating for the chance to revise, and also thank the reviewers for giving us many constructive suggestions, which would help us to improve the quality of the paper. The letter provides valuable suggestions not only for the current article but also for our further studies. The manuscript has been revised considering all the comments from editor and reviewers. We have addressed the comments point by point and all modified parts have been highlighted in blue in the revised manuscript. The responses to the comments from editor/reviewers are listed as follows:
Responds to the reviewer’s comments:
Comments 1: Line 33: “Deworming drugs” for antibiotics is not correct.
Response 1: Thank you for pointing this out. I agree with this comment. Therefore, I checked the literature for confirmation and changed “Deworming drugs” to “anthelmintics” and cited the references.
Comments 2: Line 36:” Most antibiotics defecate and accumulate in animal feces…” This sentence should be corrected, because most antibiotics are excreted with urine, not „defecate”. Plese provide what percentage of TCs are eliminated via urine.
Response 2: Thank you for pointing this out. I agree with this comment. I modified the content and added the percentage of TCs eliminated through urine. I changed “Most antibiotics defecate and accumulate in animal feces, producing a large amount of antibiotic residues. Increased concentrations of antibiotic residues in soil can be environmentally damaging” to “Due to the high water solubility of most antibiotics, up to 90% of the administered dose can be excreted in urine, and as much as 75% can be eliminated through animal feces. Inadequate biodegradation of these excretions results in an accumulation of antibiotic residues in the soil, potentially harming the environment.” and cites the corresponding literature(line 39-40)
Comments 3: Why authors chose Deer Manure for this study, while most of antibiotics are administered in livestock. Is there much deer farming in China?
Response 3: Thank you for pointing this out. The reason for choosing deer manure for research is that the Chinese deer farming market has formed a certain scale and is constantly expanding. There are many professional deer farming sites across the country that are engaged in deer farming, such as Jilin in Northeast China, Hebei in North China, and Shaanxi in Northwest China. So we conducted research on deer manure and supplemented the reasons in the preface(line 32-35:” China is one of the world's major countries for raising and consuming deer products….. with over 55 million sika deer currently being raised”).
Comments 4: Authors analysed only three TCs: oxytetracycline, chlortetracycline na tetracycline. Why doxycycline was not considered, while among all tetracyclines, this compound is the most stable. Besides in Europe, doxycycline is one of the most common antibiotics used in farm animals. According to EU Reports, most non-compliant results on the residues in food concern doxycycline.
Response 4: Thank you for pointing this out. Your comments are very helpful for our study. I chose TC, CTC and OTC for my study because, according to the results of a national assessment of antibiotic content in animal manure in China in the literature reviewed, tetracyclines was the highest in animal manure, and among the 42 antibiotics assessed in it, oxytetracycline, tetracycline and chlortetracycline ranked in the top three. At the same time, one of the main ways of using livestock manure is to prepare organic fertiliser for return to the field. In tests of organic manure, it was found that the levels of TC, OTC, and CTC were higher than those of doxycycline. Therefore, these three were selected for the study and added in the introduction accordingly. (line43-48 ” The results of a nationwide assessment of fecal antibiotics in animals in China revealed…….. Among the 42 antibiotics evaluated, oxytetracycline (OTC), tetracycline (TC), and chlortetracycline (CTC) ranked as the top three[5]. ….. commercial organic fertilizers.”) Your feedback will be valuable for our future research work. Doxycycline is also a hot spot in TCs research, and we will pay attention to it in our future studies.
Comments 5: Line 104: How the homogenity of the material after adding the TCs was checked?
Response 5: Thank you for pointing this out. I dissolved a weighed sample of the antibiotic in water and sprayed it evenly over the compost material, then repeatedly turned and stirred the mixture to ensure the antibiotic was evenly distributed in the compost. I added more details (line140-143 ” The weighed antibiotic samples were dissolved in water and evenly sprayed onto the composted material. The mixture was then turned and stirred repeatedly to ensure that the antibiotics were uniformly distributed throughout the compost.”)
Comments 6:Line 104: „ tetracycline was added…” only one tetracycline was added?
Response 6: Thank you for pointing this out. Modifications have been made, and all three antibiotics have been added. (line143-149 ”To enhance the experimental effect, TCs were added to deer manure. Expand tenfold according to the highest concentration of TC in deer manure, which is 4.12 mg/kg. Adjust the concentration of TC, CTC, and OTC in 500 g of deer manure were adjusted to approximately 40 mg/kg, and then mix evenly.”)
Comments 7: Line 105: Why concentration of tetracycline increased by 10 time?
Response 7: Thank you for pointing this out. Expanding by 10 times is to enhance the experimental effect while avoiding excessive addition of TCs
Comments 8: Line 104: In what concentrations TCs were given to the manure before experiment? Where did the analytical standards of TCs come from?
Response 8: Thank you for pointing this out. TC content in deer manure is 4.12 mg/kg.,CTC content in deer manure is 2.35mg/kg,OTC content in deer manure is 3.24 mg/kg(Table S1). The standard for the analysis of TCs is ‘General Administration of Quality Supervision, Inspection and Quarantine of the People's Republic of China, National Standardization Administration of the People's Republic of China. GB/T 32951-2016. Determination of oxytetracyline, tetracyline, chlortetracycline and doxyeyclinecontent for organic fertilizers-HPLC method [S]. Beijing: China Standard Publishing House, 2016,” has been labelled in the content of tetracycline antibiotics detection。
Comments 9: The paragraph „Chemicals and reagents” for analytical methods are lacking. Which equipment for UV detection was used?
Response 9: Thank you for pointing that out. The liquid chromatograph equipped with a UV detector has been supplemented with the necessary reagents. (line168-171 ” CH3OH (HP, Siyou, Tianjin, China), C2H3N (HP, Biaoshiqi, Tianjin, China), Na2HPO4-12H2O (AR Guangfu, Tianjin, China……High-performance liquid chromatography (HPLC) is employed to determine the concentrations of TC、CTC, and OTC. ……. Utilize a liquid chromatograph equipped with a UV detector for detection.”)
Comments 10: Line 129: The sample preparation is not clear and needs to be rewrite!„… Dry with nitrogen gas, purify with a solid-phase extraction column, pass through a 0.22 μm filter membranę…” Which SPE columns and columns were used? The evaporation of extract was before purification on SPE columns? What solvent to dry residue dissolve was used?
Response 10: Thank you for pointing this out. The measurement method has been redefined and relevant details have been added. (line172-192 ” High-performance liquid chromatography (HPLC) is employed to determine the concentrations of TC、CTC, and OTC. ……. Utilize a liquid chromatograph equipped with a UV detector for detection.”)
Comments 11: This part is described in detail, but many information concern data not exactly suggested by the title of this paper like changes in physical properties during four composting proces (Fig. 2), Changes in bacterial genus level and Shannon index during four composting processes (Fig. 3), Changes in relative abundance and Shannon index of genus level fungal populations dur-303 ing four composting processes (Fig 4) . Please, condiser rewrite the title to include additional elements providing in this paper.
Instead of a few above mention points, In discussion part, some general information about the stability of tetracyclines in the environment should be presented.
Response 11: Thank you for pointing this out. The detailed description of the four physical properties and microbial community changes during the composting process is to ensure the maturity of compost and whether the composting process is more stable and safe. Your opinions are also very beneficial for the analysis of the paper. Based on your opinions, the titles of Figures 2-4 have been modified to have a stronger correlation with the titles, and further analysis of TCs has been added in the analysis.( Modified name: Figure 2. Changes in physical properties of antibiotic stacks under different conditioning agents; Figure 3. Changes in bacterial genus level (A) and Shannon index(B) of antibiotic heap under dif-ferent conditioning agents; Figure 4. Changes in fungal genus level (A) and Shannon index (B) of antibiotic heap under dif-ferent conditioning agents)( Further analysis:line 285-290,296-300,303-309)
Comments 12: Suplementary material:Table S1: The work relates to tetracyclines, while in Table S1 chloramphenicol is presented.Table S4: Data for aureomycin??? are performed.
Response 12: Thank you for pointing this out. I apologize for our carelessness, it was a typographical error. I have corrected and changed to the correct name Chlortetracycline
We tried our best to improve the manuscript and made some changes in the manuscript. These changes will not influence the content and framework of the paper.
We appreciate for Editors/Reviewers’ warm work earnestly, and hope that the correction will meet with approval.
Once again, thank you very much for your comments and suggestions
Sincerely yours
Jianling Xu
Reviewer 2 Report
Comments and Suggestions for AuthorsThe manuscript "Study on the Effect of Conditioners on the Degradation of Tetracycline Antibiotics in Deer Manure Composting" has an actual subject of the specific research.
The manuscript investigates the removal mechanism of tetracycline antibiotics during composting process by adding different regulators (biochar, zeolite, biochar+zeolite).
The manuscript can be considered for publish.
However, some corrections would be welcome:
- Emphasis on the novelty elements of the research carried out compared to those reported in the specialized literature (a comparative table would be very useful).
- Some valuable references was lost.
- The characteristics of the two additive materials are insufficiently presented (Table S1 is summary and does not meet the requirements for the characterization of a material).
- It is economically viable to use such additive materials?
- Figures 4 and 7: do not have a legend and a specific indication in the figures.
Author Response
Dear editor and reviewer:
Thank you so much for your letter. We are so appreciating for the chance to revise, and also thank the reviewers for giving us many constructive suggestions, which would help us to improve the quality of the paper. The letter provides valuable suggestions not only for the current article but also for our further studies. The manuscript has been revised considering all the comments from editor and reviewers. We have addressed the comments point by point and all modified parts have been highlighted in red in the revised manuscript. The responses to the comments from editor/reviewers are listed as follows:
Responds to the reviewer’s comments:
Comments 1: Emphasis on the novelty elements of the research carried out compared to those reported in the specialized literature (a comparative table would be very useful). Some valuable references was lost.
Response 1: Thank you for pointing this out. I added content on the impact of composting on antibiotics, including tetracycline antibiotics, and highlighted the novelty of biochar and zeolite in degrading tetracycline antibiotics in compost. (line 63-70,88-95” Previous studies by Selvam et al. and Ho et al. have demonstrated that the degradation of TC in feces primarily occurs within the first two weeks of composting. ……as most researchers tend to focus on the degradation of sulfonamide drugs during the fecal composting process.”)
Comments 2:The characteristics of the two additive materials are insufficiently presented (Table S1 is summary and does not meet the requirements for the characterization of a material).
Response 2:Thank you for pointing this out. Table S1 is a description of the properties of composting materials used to calculate the proportions of various materials in the compost. Your feedback is very helpful for our research. The structural characterization of straw biochar was added (Figure S1), and the natural zeolites were not characterized further because the local deformation of the zeolite pore structure could not be observed by conventional structural characterization methods (Science, 2022, 376: 491), but their adsorption properties were combined with other literatures to analyze their adsorption properties in our analysis. (lines 251-262, 390-396). We will strengthen our focus on this aspect in future studies. Thanks again for your feedback .
Comments 3:It is economically viable to use such additive materials?
Response 3: Thank you for pointing this out. Natural zeolite has strong adsorption performance, and compared to some high cost synthetic additives, the cost of zeolite is usually lower. Biochar is prepared from agricultural waste straw, with a wide range of raw material sources and low cost.
Comments 4: Figures 4 and 7: do not have a legend and a specific indication in the figures.
Response 4: Thank you for pointing this out. Modifications have been made
We tried our best to improve the manuscript and made some changes in the manuscript. These changes will not influence the content and framework of the paper.
We appreciate for Editors/Reviewers’ warm work earnestly, and hope that the correction will meet with approval.
Once again, thank you very much for your comments and suggestions
Sincerely yours
Jianling Xu
Reviewer 3 Report
Comments and Suggestions for AuthorsThe review is related to the Study on the Effect of Conditioners on the Degradation of Tetracycline Antibiotics in Deer Manure Composting and belongs to Fermentation Journal.
The topic of this review is interesting, and the novelty is moderate. However, I cannot recommend it for publication at this stage. My decision is for a major revision.
Specific Points:
- The authors should better characterize the material they used as an absorbent. Using data from the physicochemical characterization, they could more thoroughly explain how this material enhances the removal of the examined antibiotics through adsorption.
- The authors demonstrate that the composting process can degrade antibiotics and that the presence of the absorbent enhances antibiotic removal. It would be beneficial for the authors to calculate the synergy of compost with a regulator, using as a control the compost processed without added regulators, along with conducting adsorption experiments at the same antibiotic and absorbent concentrations.
Author Response
Dear editor and reviewer:
Thank you so much for your letter. We are so appreciating for the chance to revise, and also thank the reviewers for giving us many constructive suggestions, which would help us to improve the quality of the paper. The letter provides valuable suggestions not only for the current article but also for our further studies. The manuscript has been revised considering all the comments from editor and reviewers. We have addressed the comments point by point and all modified parts have been highlighted in red in the revised manuscript. The responses to the comments from editor/reviewers are listed as follows:
Responds to the reviewer’s comments:
Comments 1: The authors should better characterize the material they used as an absorbent. Using data from the physicochemical characterization, they could more thoroughly explain how this material enhances the removal of the examined antibiotics through adsorption.The authors demonstrate that the composting process can degrade antibiotics and that the presence of the absorbent enhances antibiotic removal. It would be beneficial for the authors to calculate the synergy of compost with a regulator, using as a control the compost processed without added regulators, along with conducting adsorption experiments at the same antibiotic and absorbent concentrations.
Response 1:Thank you for pointing this out. Your suggestion is much appreciated and will be very helpful for our future research. We added a structural characterization diagram of the biochar (Figure S1). Because the adsorption of iodine and methylene blue by biochar is an important indicator to characterize its adsorption capacity, the adsorption values of iodine and methylene blue by straw biochar were added. The natural zeolites were not characterized further because the local deformation of zeolite pore structure could not be observed by conventional structural characterization methods (Science, 2022, 376: 491), but their adsorption properties were combined with other literatures to analyze their adsorption properties in our analyses, (lines 251-262, 390-396). Thanks again for your feedback. We will pay more attention to this aspect in our future studies.
We tried our best to improve the manuscript and made some changes in the manuscript. These changes will not influence the content and framework of the paper.
We appreciate for Editors/Reviewers’ warm work earnestly, and hope that the correction will meet with approval.
Once again, thank you very much for your comments and suggestions
Sincerely yours
Jianling Xu
Reviewer 4 Report
Comments and Suggestions for AuthorsGeneral Comments#
In the article entitled "Study on the Effect of Conditioners on the Degradation of Tetracycline Antibiotics in Deer Manure Composting," Wang et al. investigated the solid waste disposal- removal of tetracyclin (TC) antibiotics by adding different types of conditioning agents (biochar, zeolite, biochar+zeolite). Their results show the higher TC removal efficiency with the addition of zeolite. In contrast, the biochar+zeolite combination reduced TC migration into the soil. Conditioners affected TC removal by influencing compost's physicochemical properties and microbial structure, with microbes like Acinetobacter pittii and Pseudomonas putida aiding degradation. The study employed Artificial Neural Network (ANN) analyses to detect the sensitivity of the biochar+zeolite combination in degrading the compost.
Current research is of immense importance as unscientific disposal of agricultural waste introduces antibiotics and pollutants into the environment. The study is well-designed, and the article is well-articulated and easy to read.
Minor Comments#
Line 133-138 – The addition of next-generation sequencing read processing would benefit the readers either in the main text or as a supplementary.
Line 134 – Change 'Amplify the V3-V4 hypervariable region of bacterial 16S rRNA gene using primers F (ACTCCTAGGGGGGGGGAGGGAGC) and R (GGACTAHVGGGTWTCTAAT), and amplify fungal ITS_V1 region using primers F (GGAAGTAAAGTCGTAACAGG) and R (GCTGCGTTCTTCATCGATGC). to 'Amplification of the V3-V4 hypervariable region of bacterial 16S rRNA gene was performed using primers F (ACTCCTAGGGGGGGGGAGGGAGC) and R (GGACTAHVGGGTWTCTAAT) and fungal ITS_V1 region using primers F (GGAAGTAAAGTCGTAACAGG) and R (GCTGCGTTCTTCATCGATGC).'
Line 141 – Remove 'use' in front of Neuro Solutions.
Author Response
Dear editor and reviewer:
Thank you so much for your letter. We are so appreciating for the chance to revise, and also thank the reviewers for giving us many constructive suggestions, which would help us to improve the quality of the paper. The letter provides valuable suggestions not only for the current article but also for our further studies. The manuscript has been revised considering all the comments from editor and reviewers. We have addressed the comments point by point and all modified parts have been highlighted in green in the revised manuscript. The responses to the comments from editor/reviewers are listed as follows:
Responds to the reviewer’s comments:
Comments 1: Line 133-138 – The addition of next-generation sequencing read processing would benefit the readers either in the main text or as a supplementary. Line 134 – Change 'Amplify the V3-V4 hypervariable region of bacterial 16S rRNA gene using primers F (ACTCCTAGGGGGGGGGAGGGAGC) and R (GGACTAHVGGGTWTCTAAT), and amplify fungal ITS_V1 region using primers F (GGAAGTAAAGTCGTAACAGG) and R (GCTGCGTTCTTCATCGATGC). to 'Amplification of the V3-V4 hypervariable region of bacterial 16S rRNA gene was performed using primers F (ACTCCTAGGGGGGGGGAGGGAGC) and R (GGACTAHVGGGTWTCTAAT) and fungal ITS_V1 region using primers F (GGAAGTAAAGTCGTAACAGG) and R (GCTGCGTTCTTCATCGATGC).'
Response 1:Thank you for pointing this out. Modifications have been made, And added sample processing and measurement content.(line 194-208 After fully flipping the pile, take a sample. Total genomic DNA samples were extracted using the OMEGA Soil DNA Kit (M5635-02) (Omega Bio-Tek,Norcross, GA, USA). …..Sequences were then quality filtered, denoised, merged and chimera removed using the DADA2 plugin.)
Comments 2: Line 141 – Remove 'use' in front of Neuro Solutions.
Response 2: Thank you for pointing this out. Modifications have been made
We tried our best to improve the manuscript and made some changes in the manuscript. These changes will not influence the content and framework of the paper.
We appreciate for Editors/Reviewers’ warm work earnestly, and hope that the correction will meet with approval.
Once again, thank you very much for your comments and suggestions
Sincerely yours
Jianling Xu
Round 2
Reviewer 1 Report
Comments and Suggestions for AuthorsAfter incorporating most of the comments and clarifying a few points of inaccuracy, recommends that the paper be published
Reviewer 3 Report
Comments and Suggestions for AuthorsThe authors have revised the manuscript well therefore, i recommend it for publication