Red Light and 5% Aminolaevulinic Acid (5%) Inhibit Proliferation and Migration of Dysplastic Oral Keratinocytes via ROS Production: An In Vitro Study
Abstract
:1. Introduction
2. Results and Discussion
2.1. ALAD-PDT Treatment Induced Cell Death in DOK
2.2. ALAD-PDT Treatment Inhibited Migration Capacity of DOK
2.3. ALAD-PDT Treatment Induced ROS Production in DOK
2.4. ALAD-PDT Treatment Mainly Induced Necrosis in DOK
2.5. ALAD-PDT Treatment Induced Changes in Apoptosis-Related Genes
3. Conclusions
4. Materials and Methods
4.1. Cell Culture
4.2. Aladent Treatment Protocol
4.3. MTT Assay
4.4. Wound Healing Assay
4.5. Reactive Oxygen Species (ROS) Detection
4.6. Annexin V/PI Staining
4.7. RNA Isolation and Reverse Transcription
4.8. Gene Expression Analysis of Apoptotic Markers
4.9. Statistical Analysis
5. Patents
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sarode, G.; Maniyar, N.; Sarode, S.C.; Jafer, M.; Patil, S.; Awan, K.H. Epidemiologic Aspects of Oral Cancer. Dis. Mon. 2020, 66, 100988. [Google Scholar] [CrossRef]
- Abati, S.; Bramati, C.; Bondi, S.; Lissoni, A.; Trimarchi, M. Oral Cancer and Precancer: A Narrative Review on the Relevance of Early Diagnosis. Int. J. Environ. Res. Public Health 2020, 17, 9160. [Google Scholar] [CrossRef]
- Zanoni, D.K.; Montero, P.H.; Migliacci, J.C.; Shah, J.P.; Wong, R.J.; Ganly, I.; Patel, S.G. Survival Outcomes after Treatment of Cancer of the Oral Cavity (1985–2015). Oral Oncol. 2019, 90, 115–121. [Google Scholar] [CrossRef]
- Grin, M.; Suvorov, N.; Ostroverkhov, P.; Pogorilyy, V.; Kirin, N.; Popov, A.; Sazonova, A.; Filonenko, E. Advantages of Combined Photodynamic Therapy in the Treatment of Oncological Diseases. Biophys. Rev. 2022, 14, 941–963. [Google Scholar] [CrossRef]
- Kwiatkowski, S.; Knap, B.; Przystupski, D.; Saczko, J.; Kędzierska, E.; Knap-Czop, K.; Kotlińska, J.; Michel, O.; Kotowski, K.; Kulbacka, J. Photodynamic Therapy—Mechanisms, Photosensitizers and Combinations. Biomed. Pharmacother. 2018, 106, 1098–1107. [Google Scholar] [CrossRef]
- Vrouenraets, M.B.; Visser, G.W.M.; Snow, G.B.; van Dongen, G.A.M.S. Basic Principles, Applications in Oncology and Improved Selectivity of Photodynamic Therapy. Anticancer Res. 2003, 23, 505–522. [Google Scholar]
- Correia, J.H.; Rodrigues, J.A.; Pimenta, S.; Dong, T.; Yang, Z. Photodynamic Therapy Review: Principles, Photosensitizers, Applications, and Future Directions. Pharmaceutics 2021, 13, 1332. [Google Scholar] [CrossRef]
- Castano, A.P.; Demidova, T.N.; Hamblin, M.R. Mechanisms in Photodynamic Therapy: Part Three—Photosensitizer Pharmacokinetics, Biodistribution, Tumor Localization and Modes of Tumor Destruction. Photodiagn. Photodyn. Ther. 2005, 2, 91–106. [Google Scholar] [CrossRef] [Green Version]
- Serini, S.M.; Cannizzaro, M.V.; Dattola, A.; Garofalo, V.; Del Duca, E.; Ventura, A.; Milani, M.; Campione, E.; Bianchi, L. The Efficacy and Tolerability of 5-aminolevulinic Acid 5% Thermosetting Gel Photodynamic Therapy (PDT) in the Treatment of Mild-to-moderate Acne Vulgaris. A Two-center, Prospective Assessor-blinded, Proof-of-concept Study. J. Cosmet. Dermatol. 2019, 18, 156–162. [Google Scholar] [CrossRef] [Green Version]
- Radunović, M.; Petrini, M.; Vlajic, T.; Iezzi, G.; Di Lodovico, S.; Piattelli, A.; D’Ercole, S. Effects of a Novel Gel Containing 5-Aminolevulinic Acid and Red LED against Bacteria Involved in Peri-Implantitis and Other Oral Infections. J. Photochem. Photobiol. B 2020, 205, 111826. [Google Scholar] [CrossRef]
- D’Ercole, S.; Carlesi, T.; Dotta, T.C.; Pierfelice, T.V.; D’Amico, E.; Tripodi, D.; Iezzi, G.; Piattelli, A.; Petrini, M. 5-Aminolevulinic Acid and Red Led in Endodontics: A Narrative Review and Case Report. Gels 2022, 8, 697. [Google Scholar] [CrossRef] [PubMed]
- Rossi, R.; Rispoli, L.; Lopez, M.A.; Netti, A.; Petrini, M.; Piattelli, A. Photodynamic Therapy by Mean of 5-Aminolevulinic Acid for the Management of Periodontitis and Peri-Implantitis: A Retrospective Analysis of 20 Patients. Antibiotics 2022, 11, 1267. [Google Scholar] [CrossRef] [PubMed]
- Carlesi, T.; Dotta, T.C.; Pierfelice, T.V.; D’Amico, E.; Lepore, S.; Tripodi, D.; Piattelli, A.; D’Ercole, S.; Petrini, M. Efficacy of 5% Aminolaevulinic Acid and Red Light on Enterococcus Faecalis in Infected Root Canals. Gels 2023, 9, 125. [Google Scholar] [CrossRef]
- Petrini, M.; Di Lodovico, S.; Iezzi, G.; Cellini, L.; Tripodi, D.; Piattelli, A.; D’Ercole, S. Photodynamic Antibiofilm and Antibacterial Activity of a New Gel with 5-Aminolevulinic Acid on Infected Titanium Surfaces. Biomedicines 2022, 10, 572. [Google Scholar] [CrossRef]
- Greco, G.; Di Piazza, S.; Chan, J.; Zotti, M.; Hanna, R.; Gheno, E.; Zekiy, A.O.; Pasquale, C.; De Angelis, N.; Amaroli, A. Newly Formulated 5% 5-Aminolevulinic Acid Photodynamic Therapy on Candida Albicans. Photodiagn. Photodyn. Ther. 2020, 29, 101575. [Google Scholar] [CrossRef]
- Wang, X.; Jin, J.; Li, W.; Wang, Q.; Han, Y.; Liu, H. Differential in Vitro Sensitivity of Oral Precancerous and Squamous Cell Carcinoma Cell Lines to 5-Aminolevulinic Acid-Mediated Photodynamic Therapy. Photodiagn. Photodyn. Ther. 2020, 29, 101554. [Google Scholar] [CrossRef]
- Pinto, M.A.F.; Ferreira, C.B.R.; de Lima, B.E.S.; Molon, Â.C.; Ibarra, A.M.C.; Cecatto, R.B.; dos Santos Franco, A.L.; Rodrigues, M.F.S.D. Effects of 5-ALA Mediated Photodynamic Therapy in Oral Cancer Stem Cells. J. Photochem. Photobiol. B 2022, 235, 112552. [Google Scholar] [CrossRef]
- Rosin, F.C.P.; Teixeira, M.G.; Pelissari, C.; Corrêa, L. Resistance of Oral Cancer Cells to 5-ALA-mediated Photodynamic Therapy. J. Cell. Biochem. 2018, 119, 3554–3562. [Google Scholar] [CrossRef]
- Collaud, S.; Peng, Q.; Gurny, R.; Lange, N. Thermosetting Gel for the Delivery of 5-Aminolevulinic Acid Esters to the Cervix. J. Pharm. Sci. 2008, 97, 2680–2690. [Google Scholar] [CrossRef]
- Jeong, B.; Kim, S.W.; Bae, Y.H. Thermosensitive Sol–Gel Reversible Hydrogels. Adv. Drug Deliv. Rev. 2012, 64, 154–162. [Google Scholar] [CrossRef]
- Pierfelice, T.V.; D’Amico, E.; Petrini, M.; Pandolfi, A.; D’Arcangelo, C.; Di Pietro, N.; Piattelli, A.; Iezzi, G. The Effects of 5% 5-Aminolevulinic Acid Gel and Red Light (ALAD-PDT) on Human Fibroblasts and Osteoblasts. Gels 2022, 8, 491. [Google Scholar] [CrossRef]
- Pierfelice, T.V.; D’Amico, E.; Iezzi, G.; Petrini, M.; Schiavone, V.; Santalucia, M.; Pandolfi, A.; D’Arcangelo, C.; Piattelli, A.; Di Pietro, N. Effect of a 5-Aminolevulinic Acid Gel and 660 Nm Red LED Light on Human Oral Osteoblasts: A Preliminary in Vitro Study. Lasers Med. Sci. 2022, 37, 3671–3679. [Google Scholar] [CrossRef]
- Feuerstein, T.; Berkovitch-Luria, G.; Nudelman, A.; Rephaeli, A.; Malik, Z. Modulating ALA-PDT Efficacy of Mutlidrug Resistant MCF-7 Breast Cancer Cells Using ALA Prodrug. Photochem. Photobiol. Sci. 2011, 10, 1926–1933. [Google Scholar] [CrossRef]
- Otake, M.; Nishiwaki, M.; Kobayashi, Y.; Baba, S.; Kohno, E.; Kawasaki, T.; Fujise, Y.; Nakamura, H. Selective Accumulation of ALA-Induced PpIX and Photodynamic Effect in Chemically Induced Hepatocellular Carcinoma. Br. J. Cancer 2003, 89, 730–736. [Google Scholar] [CrossRef] [Green Version]
- Meng, C.; Xia, Q.; Wu, H.; Huang, H.; Liu, H.; Li, Y.; Zhang, F.; Song, W. Photobiomodulation with 630-Nm LED Radiation Inhibits the Proliferation of Human Synoviocyte MH7A Cells Possibly via TRPV4/PI3K/AKT/MTOR Signaling Pathway. Lasers Med. Sci. 2020, 35, 1927–1936. [Google Scholar] [CrossRef]
- Schalch, T.D.; Fernandes, M.H.; Destro Rodrigues, M.F.S.; Guimarães, D.M.; Nunes, F.D.; Rodrigues, J.C.; Garcia, M.P.; Mesquita Ferrari, R.A.; Bussadori, S.K.; Fernandes, K.P.S. Photobiomodulation Is Associated with a Decrease in Cell Viability and Migration in Oral Squamous Cell Carcinoma. Lasers Med. Sci. 2019, 34, 629–636. [Google Scholar] [CrossRef] [PubMed]
- Yang, K.L.; Khoo, B.Y.; Ong, M.T.; Yoong, I.C.K.; Sreeramanan, S. In vitro Anti-Breast Cancer Studies of LED Red Light Therapy through Autophagy. Breast Cancer 2021, 28, 60–66. [Google Scholar] [CrossRef] [PubMed]
- Ma, Y.; Qu, S.; Xu, L.; Lu, H.; Li, B. An in Vitro Study of the Effect of 5-ALA-Mediated Photodynamic Therapy on Oral Squamous Cell Carcinoma. BMC Oral Health 2020, 20, 258. [Google Scholar] [CrossRef]
- Donnelly, R.F.; McCarron, P.A.; Woolfson, A.D. Derivatives of 5-Aminolevulinic Acid for Photodynamic Therapy. Perspect. Med. Chem. 2007, 1, 49–63. [Google Scholar] [CrossRef]
- da Silva, J.L.; Silva-de-Oliveira, A.F.S.; Andraus, R.A.C.; Maia, L.P. Effects of Low Level Laser Therapy in Cancer Cells—A Systematic Review of the Literature. Lasers Med. Sci. 2020, 35, 523–529. [Google Scholar] [CrossRef]
- Gomes Henriques, Á.C.; Ginani, F.; Oliveira, R.M.; Keesen, T.S.L.; Galvão Barboza, C.A.; Oliveira Rocha, H.A.; de Castro, J.F.L.; Della Coletta, R.; de Almeida Freitas, R. Low-Level Laser Therapy Promotes Proliferation and Invasion of Oral Squamous Cell Carcinoma Cells. Lasers Med. Sci. 2014, 29, 1385–1395. [Google Scholar] [CrossRef]
- Pesce, M.; Tatangelo, R.; La Fratta, I.; Rizzuto, A.; Campagna, G.; Turli, C.; Ferrone, A.; Franceschelli, S.; Speranza, L.; Patruno, A.; et al. Aging-Related Oxidative Stress: Positive Effect of Memory Training. Neuroscience 2018, 370, 246–255. [Google Scholar] [CrossRef]
- Smolyarova, D.D.; Podgorny, O.V.; Bilan, D.S.; Belousov, V.V. A Guide to Genetically Encoded Tools for the Study of H2O2. FEBS J. 2022, 289, 5382–5395. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.-S.; Lim, S.-T. LED Light-Induced ROS Differentially Regulates Focal Adhesion Kinase Activity in HaCaT Cell Viability. Curr. Issues Mol. Biol. 2022, 44, 1235–1246. [Google Scholar] [CrossRef] [PubMed]
- Buytaert, E.; Dewaele, M.; Agostinis, P. Molecular Effectors of Multiple Cell Death Pathways Initiated by Photodynamic Therapy. Biochim. Biophys. Acta BBA—Rev. Cancer 2007, 1776, 86–107. [Google Scholar] [CrossRef]
- Kessel, D. Relocalization of Cationic Porphyrins during Photodynamic Therapy. Photochem. Photobiol. Sci. 2002, 1, 837–840. [Google Scholar] [CrossRef] [PubMed]
- Fabris, C.; Valduga, G.; Miotto, G.; Borsetto, L.; Jori, G.; Garbisa, S.; Reddi, E. Photosensitization with Zinc (II) Phthalocyanine as a Switch in the Decision between Apoptosis and Necrosis. Cancer Res. 2001, 61, 7495–7500. [Google Scholar] [PubMed]
- Wang, H.; Xiong, L.; Xia, Y.; Wang, X. 5-Aminolaevulinic Acid-Based Photodynamic Therapy Induces Both Necrosis and Apoptosis of Keratinocytes in Plantar Warts. J. Cosmet. Laser Ther. 2020, 22, 165–170. [Google Scholar] [CrossRef]
- Coupienne, I.; Fettweis, G.; Rubio, N.; Agostinis, P.; Piette, J. 5-ALA-PDT Induces RIP3-Dependent Necrosis in Glioblastoma. Photochem. Photobiol. Sci. 2011, 10, 1868–1878. [Google Scholar] [CrossRef]
- Ying, Y.; Padanilam, B.J. Regulation of Necrotic Cell Death: P53, PARP1 and Cyclophilin D-Overlapping Pathways of Regulated Necrosis? Cell. Mol. Life Sci. 2016, 73, 2309–2324. [Google Scholar] [CrossRef]
- Niquet, J.; Allen, S.G.; Baldwin, R.A.; Wasterlain, C.G. Evidence of Caspase-3 Activation in Hyposmotic Stress-Induced Necrosis. Neurosci. Lett. 2004, 356, 225–227. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tischner, D.; Manzl, C.; Soratroi, C.; Villunger, A.; Krumschnabel, G. Necrosis-like Death Can Engage Multiple pro-Apoptotic Bcl-2 Protein Family Members. Apoptosis 2012, 17, 1197–1209. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Douglas, D.L.; Baines, C.P. PARP1-Mediated Necrosis Is Dependent on Parallel JNK and Ca2+/Calpain Pathways. J. Cell Sci. 2014, 127, 4134–4145. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vaseva, A.V.; Marchenko, N.D.; Ji, K.; Tsirka, S.E.; Holzmann, S.; Moll, U.M. P53 Opens the Mitochondrial Permeability Transition Pore to Trigger Necrosis. Cell 2012, 149, 1536–1548. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Robichaux, D.J.; Harata, M.; Murphy, E.; Karch, J. Mitochondrial Permeability Transition Pore-Dependent Necrosis. J. Mol. Cell. Cardiol. 2023, 174, 47–55. [Google Scholar] [CrossRef]
- Zerp, S.F.; Stoter, T.R.; Hoebers, F.J.P.; van den Brekel, M.W.M.; Dubbelman, R.; Kuipers, G.K.; Lafleur, M.V.M.; Slotman, B.J.; Verheij, M. Targeting Anti-Apoptotic Bcl-2 by AT-101 to Increase Radiation Efficacy: Data from in Vitro and Clinical Pharmacokinetic Studies in Head and Neck Cancer. Radiat. Oncol. Lond. Engl. 2015, 10, 158. [Google Scholar] [CrossRef] [Green Version]
- dos Santos, L.V.; Carvalho, A.L. Bcl-2 Targeted-Therapy for the Treatment of Head and Neck Squamous Cell Carcinoma. Recent Pat. Anticancer Drug Discov. 2011, 6, 45–57. [Google Scholar] [CrossRef]
- Chen, B.; Xu, M.; Zhang, H.; Wang, J.; Zheng, P.; Gong, L.; Wu, G.; Dai, T. Cisplatin-Induced Non-Apoptotic Death of Pancreatic Cancer Cells Requires Mitochondrial Cyclophilin-D-P53 Signaling. Biochem. Biophys. Res. Commun. 2013, 437, 526–531. [Google Scholar] [CrossRef]
- Zhen, Y.-F.; Wang, G.-D.; Zhu, L.-Q.; Tan, S.-P.; Zhang, F.-Y.; Zhou, X.-Z.; Wang, X.-D. P53 Dependent Mitochondrial Permeability Transition Pore Opening Is Required for Dexamethasone-Induced Death of Osteoblasts. J. Cell. Physiol. 2014, 229, 1475–1483. [Google Scholar] [CrossRef]
- Dwivedi, R.; Pandey, R.; Chandra, S.; Mehrotra, D. Apoptosis and Genes Involved in Oral Cancer—A Comprehensive Review. Oncol. Rev. 2020, 14, 472. [Google Scholar] [CrossRef]
- Shojaei, F.; Yazdani-Nafchi, F.; Banitalebi-Dehkordi, M.; Chehelgerdi, M.; Khorramian-Ghahfarokhi, M. Trace of Survivin in Cancer. Eur. J. Cancer Prev. Off. J. Eur. Cancer Prev. Organ. ECP 2019, 28, 365–372. [Google Scholar] [CrossRef]
- Marchal, S.; Fadloun, A.; Maugain, E.; D’Hallewin, M.-A.; Guillemin, F.; Bezdetnaya, L. Necrotic and Apoptotic Features of Cell Death in Response to Foscan Photosensitization of HT29 Monolayer and Multicell Spheroids. Biochem. Pharmacol. 2005, 69, 1167–1176. [Google Scholar] [CrossRef]
- Meng, P.; Sun, Y.; Li, E.; Liu, Y.; Wang, C.; Song, L. Hematoporphyrin Monomethyl Ether Mediated Photodynamic Therapy Inhibits Oral Squamous Cell Carcinoma by Regulating the P53-MiR-21-PDCD4 Axis via Singlet Oxygen. Lasers Med. Sci. 2022, 37, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Villalpando-Rodriguez, G.E.; Gibson, S.B. Reactive Oxygen Species (ROS) Regulates Different Types of Cell Death by Acting as a Rheostat. Oxid. Med. Cell. Longev. 2021, 2021, 9912436. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.Y.; Chen, Y.K.; Hu, C.S.; Xiao, L.Y.; Huang, W.L.; Chi, T.C.; Cheng, K.H.; Wang, Y.M.; Yuan, S.S.F. MAL-PDT Inhibits Oral Precancerous Cells and Lesions via Autophagic Cell Death. Oral Dis. 2019, 25, 758–771. [Google Scholar] [CrossRef] [PubMed]
- Grove, G.L.; Houghton, B.A.; Cochran, J.W.; Kress, E.D.; Cristofalo, V.J. Hydrocortisone Effects on Cell Proliferation: Specificity of Response among Various Cell Types. Cell Biol. Int. Rep. 1977, 1, 147–155. [Google Scholar] [CrossRef]
- Vaughan, F.L.; Kass, L.L.; Uzman, J.A. Requirement of Hydrocortisone and Insulin for Extended Proliferation and Passage of Rat Keratinocytes. In Vitro 1981, 17, 941–946. [Google Scholar] [CrossRef] [PubMed]
- Fonseca, M.O.; Godoi, B.H.; Da Silva, N.S.; Pacheco-Soares, C. Evaluation of the Effect of Hydrocortisone in 2D and 3D HEp-2 Cell Culture. IFMBE Proc. 2022, 83, 113–117. [Google Scholar]
- de Oliveira Moraes, C.D.G.; Godoi, B.H.; da Silva, N.S.; Pacheco-Soares, C. Influence of Hydrocortisone in Chemotherapy And Photodynamic Therapy in HEp-2 Cells. Clin. Oncol. 2022, 7. [Google Scholar]
- Cogno, I.S.; Vittar, N.B.R.; Lamberti, M.J.; Rivarola, V.A. Optimization of Photodynamic Therapy Response by Survivin Gene Knockdown in Human Metastatic Breast Cancer T47D Cells. J. Photochem. Photobiol. B 2011, 104, 434–443. [Google Scholar] [CrossRef]
- Suarez-Arnedo, A.; Torres Figueroa, F.; Clavijo, C.; Arbeláez, P.; Cruz, J.C.; Muñoz-Camargo, C. An Image J Plugin for the High Throughput Image Analysis of in Vitro Scratch Wound Healing Assays. PLoS ONE 2020, 15, e0232565. [Google Scholar] [CrossRef] [PubMed]
- Simonovic, J.; Toljic, B.; Lazarevic, M.; Markovic, M.M.; Peric, M.; Vujin, J.; Panajotovic, R.; Milasin, J. The Effect of Liquid-Phase Exfoliated Graphene Film on Neurodifferentiation of Stem Cells from Apical Papilla. Nanomaterials 2022, 12, 3116. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
Primer Name | Sequence (F) * | Sequence (R) * |
---|---|---|
TP53 | ATGTTTTGCCAACTGGCCAAG | TGAGCAGCGCTCATGGTG |
Bcl-2 | ATGTGTGTGGAGAGCGTCAACC | TGAGCAGAGTCTTCAGAGACAGCC |
Caspase-3 | TGTTTGTGTGCTTCTGAGCC | CACGCCATGTCATCATCAAC |
Caspase-9 | CATTTCATGGTGGAGGTGAAG | GGGAACTGCAGGTGGCTG |
Survivin | TCTGGCGTAAGATGATGG | GAAATAAGTGGGTCTGAAGTG |
GAPDH | ATGGGGAAGGTGAAGGTCG | GGGGTCATTGATGGCAACAATA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pierfelice, T.V.; Lazarevic, M.; Mitic, D.; Nikolic, N.; Radunovic, M.; Iezzi, G.; Piattelli, A.; Milasin, J. Red Light and 5% Aminolaevulinic Acid (5%) Inhibit Proliferation and Migration of Dysplastic Oral Keratinocytes via ROS Production: An In Vitro Study. Gels 2023, 9, 604. https://doi.org/10.3390/gels9080604
Pierfelice TV, Lazarevic M, Mitic D, Nikolic N, Radunovic M, Iezzi G, Piattelli A, Milasin J. Red Light and 5% Aminolaevulinic Acid (5%) Inhibit Proliferation and Migration of Dysplastic Oral Keratinocytes via ROS Production: An In Vitro Study. Gels. 2023; 9(8):604. https://doi.org/10.3390/gels9080604
Chicago/Turabian StylePierfelice, Tania Vanessa, Milos Lazarevic, Dijana Mitic, Nadja Nikolic, Milena Radunovic, Giovanna Iezzi, Adriano Piattelli, and Jelena Milasin. 2023. "Red Light and 5% Aminolaevulinic Acid (5%) Inhibit Proliferation and Migration of Dysplastic Oral Keratinocytes via ROS Production: An In Vitro Study" Gels 9, no. 8: 604. https://doi.org/10.3390/gels9080604
APA StylePierfelice, T. V., Lazarevic, M., Mitic, D., Nikolic, N., Radunovic, M., Iezzi, G., Piattelli, A., & Milasin, J. (2023). Red Light and 5% Aminolaevulinic Acid (5%) Inhibit Proliferation and Migration of Dysplastic Oral Keratinocytes via ROS Production: An In Vitro Study. Gels, 9(8), 604. https://doi.org/10.3390/gels9080604