Photodynamic Therapy with Aminolevulinic Acid Enhances the Cellular Activity of Cells Cultured on Porcine Acellular Dermal Matrix Membranes Used in Periodontology
Abstract
:1. Introduction
2. Results and Discussion
2.1. Cell Attachment on the PADMM after ALAD-PDT
2.2. Gingival Fibroblasts and Oral Osteoblast Proliferation
2.3. Cell Interaction with the PADMM after ALAD-PDT
2.4. ALP Activity
2.5. Mineralization
2.6. Gene Expression of Gingival Fibroblasts and Oral Osteoblast Cultured on the PADMM and Exposed to Photodynamic Therapy
3. Conclusions
4. Materials and Methods
4.1. Study Design
- i.
- PDT: cells cultured on the membrane and exposed to 630 nm LED for 7 min;
- ii.
- ALAD-PDT: cells cultured on the membrane and treated with a gel containing 5% of 5-aminolevulinic acid (ALAD) for 45 min and irradiated with red light (LED) for 7 min;
- iii.
- And CTRL: cells cultured on the membrane PADM.
4.2. Cell Culture
4.3. Cell Proliferation Assay
4.4. Cell Attachment
4.5. Histological Analysis
4.6. ALP Assay
4.7. Mineralization
4.8. Gene Expression
4.9. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Rick, K.; Sroka, R.; Stepp, H.; Kriegmair, M.; Huber, R.M.; Jacob, K.; Baumgartner, R. Pharmacokinetics of 5-Aminolevulinic Acid-Induced Protoporphyrin IX in Skin and Blood. J. Photochem. Photobiol. B 1997, 40, 313–319. [Google Scholar] [CrossRef] [PubMed]
- Ablon, G. Phototherapy with Light Emitting Diodes: Treating a Broad Range of Medical and Aesthetic Conditions in Dermatology. J. Clin. Aesthet. Dermatol. 2018, 11, 21. [Google Scholar] [PubMed]
- Stájer, A.; Kajári, S.; Gajdács, M.; Musah-Eroje, A.; Baráth, Z. Utility of Photodynamic Therapy in Dentistry: Current Concepts. Dent. J. 2020, 8, 43. [Google Scholar] [CrossRef] [PubMed]
- Harris, F.; Pierpoint, L. Photodynamic Therapy Based on 5-Aminolevulinic Acid and Its Use as an Antimicrobial Agent. Med. Res. Rev. 2012, 32, 1292–1327. [Google Scholar] [CrossRef] [PubMed]
- Pesce, M.; Tatangelo, R.; La Fratta, I.; Rizzuto, A.; Campagna, G.; Turli, C.; Ferrone, A.; Franceschelli, S.; Speranza, L.; Patruno, A.; et al. Aging-Related Oxidative Stress: Positive Effect of Memory Training. Neuroscience 2018, 370, 246–255. [Google Scholar] [CrossRef]
- Serini, S.M.; Cannizzaro, M.V.; Dattola, A.; Garofalo, V.; Del Duca, E.; Ventura, A.; Milani, M.; Campione, E.; Bianchi, L. The Efficacy and Tolerability of 5-Aminolevulinic Acid 5% Thermosetting Gel Photodynamic Therapy (PDT) in the Treatment of Mild-to-Moderate Acne Vulgaris. A Two-Center, Prospective Assessor-Blinded, Proof-of-Concept Study. J. Cosmet. Dermatol. 2019, 18, 156–162. [Google Scholar] [CrossRef] [Green Version]
- Chen, Q.; Dan, H.; Tang, F.; Wang, J.; Li, X.; Cheng, J.; Zhao, H.; Zeng, X. Photodynamic Therapy Guidelines for the Management of Oral Leucoplakia. Int. J. Oral. Sci. 2019, 11, 14. [Google Scholar] [CrossRef]
- Zheng, Y.; Fan, W.; Jiang, L.; Lu, Y. Sonophoresis Enhances the Skin Penetration of 5-Aminolevulinic Acid: A Promising Pretreatment for Photodynamic Therapy. Exp. Dermatol. 2022, 31, 1939–1943. [Google Scholar] [CrossRef]
- Greco, G.; Di Piazza, S.; Chan, J.; Zotti, M.; Hanna, R.; Gheno, E.; Zekiy, A.O.; Pasquale, C.; De Angelis, N.; Amaroli, A. Newly Formulated 5% 5-Aminolevulinic Acid Photodynamic Therapy on Candida Albicans. Photodiagn. Photodyn. Ther. 2020, 29, 101575. [Google Scholar] [CrossRef]
- Lauritano, D.; Moreo, G.; Palmieri, A.; Della Vella, F.; Petruzzi, M.; Botticelli, D.; Carinci, F. Photodynamic Therapy Using 5-Aminolevulinic Acid (Ala) for the Treatment of Chronic Periodontitis: A Prospective Case Series. Appl. Sci. 2022, 12, 3102. [Google Scholar] [CrossRef]
- Radunović, M.; Petrini, M.; Vlajic, T.; Iezzi, G.; Di Lodovico, S.; Piattelli, A.; D’Ercole, S. Effects of a Novel Gel Containing 5-Aminolevulinic Acid and Red LED against Bacteria Involved in Peri-Implantitis and Other Oral Infections. J. Photochem. Photobiol. B 2020, 205, 111826. [Google Scholar] [CrossRef] [PubMed]
- Carlesi, T.; Petrini, M.; Plotino, G.; Piattelli, A.; D’Ercole, S. Photodynamic Therapy with 5-Aminolevulinic Acid and Red LED, 660 in Vitro and in Vivo Studies. J. Endod. 2021, 7, 1–32. [Google Scholar]
- Rossi, R.; Rispoli, L.; Lopez, M.A.; Netti, A.; Petrini, M.; Piattelli, A. Photodynamic Therapy by Mean of 5-Aminolevulinic Acid for the Management of Periodontitis and Peri-Implantitis: A Retrospective Analysis of 20 Patients. Antibiotics 2022, 11, 1267. [Google Scholar] [CrossRef] [PubMed]
- Yang, Z.; Hu, X.; Zhou, L.; He, Y.; Zhang, X.; Yang, J.; Ju, Z.; Liou, Y.C.; Shen, H.M.; Luo, G.; et al. Photodynamic Therapy Accelerates Skin Wound Healing through Promoting Re-Epithelialization. Burn. Trauma 2021, 9, tkab008. [Google Scholar] [CrossRef]
- Huang, J.; Wu, S.; Wu, M.; Zeng, Q.; Wang, X.; Wang, H. Efficacy of the Therapy of 5-Aminolevulinic Acid Photodynamic Therapy Combined with Human Umbilical Cord Mesenchymal Stem Cells on Methicillin-Resistant Staphylococcus Aureus-Infected Wound in a Diabetic Mouse Model. Photodiagn. Photodyn. Ther. 2021, 36, 102480. [Google Scholar] [CrossRef]
- Pallavi, P.; Girigoswami, A.; Girigoswami, K.; Hansda, S.; Ghosh, R. Photodynamic Therapy in Cancer. In Handbook of Oxidative Stress in Cancer: Therapeutic Aspects; Springer: Berlin/Heidelberg, Germany, 2022; pp. 1–24. [Google Scholar] [CrossRef]
- Pallavi, P.; Sharmiladevi, P.; Haribabu, V.; Girigoswami, K.; Girigoswami, A. A Nano Approach to Formulate Photosensitizers for Photodynamic Therapy. Curr. Nanosci. 2021, 18, 675–689. [Google Scholar] [CrossRef]
- Pierfelice, T.V.; D’Amico, E.; Iezzi, G.; Petrini, M.; Schiavone, V.; Santalucia, M.; Pandolfi, A.; D’Arcangelo, C.; Piattelli, A.; Di Pietro, N. Effect of a 5-Aminolevulinic Acid Gel and 660 Nm Red LED Light on Human Oral Osteoblasts: A Preliminary in Vitro Study. Lasers Med. Sci. 2022, 37, 3671–3679. [Google Scholar] [CrossRef]
- Pierfelice, T.V.; D’Amico, E.; Petrini, M.; Pandolfi, A.; D’Arcangelo, C.; Di Pietro, N.; Piattelli, A.; Iezzi, G. The Effects of 5% 5-Aminolevulinic Acid Gel and Red Light (ALAD-PDT) on Human Fibroblasts and Osteoblasts. Gels 2022, 8, 491. [Google Scholar] [CrossRef]
- Jamnezhad, S.; Asefnejad, A.; Motififard, M.; Yazdekhasti, H.; Kolooshani, A.; Saber-Samandari, S.; Khandan, A. Development and Investigation of Novel Alginate-Hyaluronic Acid Bone Fillers Using Freeze Drying Technique for Orthopedic Field. Nanomed. Res. J. 2020, 5, 306–315. [Google Scholar]
- Foroutan, S.; Hashemian, M.; Khosravi, M.; Nejad, M.G.; Asefnejad, A.; Saber-Samandari, S.; Khandan, A. A Porous Sodium Alginate-CaSiO3 Polymer Reinforced with Graphene Nanosheet: Fabrication and Optimality Analysis. Fibers Polym. 2021, 22, 540–549. [Google Scholar] [CrossRef]
- Felice, P.; D’Amico, E.; Pierfelice, T.V.; Petrini, M.; Barausse, C.; Karaban, M.; Barone, A.; Iezzi, G. Osteoblasts and Fibroblasts Interaction with a Porcine Acellular Dermal Matrix Membrane. Int. J. Mol. Sci. 2023, 24, 3649. [Google Scholar] [CrossRef]
- Topaloglu, N.; Özdemir, M.; Çevik, Z.B.Y. Comparative Analysis of the Light Parameters of Red and Near-Infrared Diode Lasers to Induce Photobiomodulation on Fibroblasts and Keratinocytes: An in Vitro Study. Photodermatol. Photoimmunol. Photomed. 2021, 37, 253–262. [Google Scholar] [CrossRef] [PubMed]
- Rossi, F.; Magni, G.; Tatini, F.; Banchelli, M.; Cherchi, F.; Rossi, M.; Coppi, E.; Pugliese, A.M.; Rossi Degl’Innocenti, D.; Alfieri, D.; et al. Photobiomodulation of Human Fibroblasts and Keratinocytes with Blue Light: Implications in Wound Healing. Biomedicines 2021, 9, 41. [Google Scholar] [CrossRef] [PubMed]
- Jang, Y.H.; Koo, G.B.; Kim, J.Y.; Kim, Y.S.; Kim, Y.C. Prolonged Activation of ERK Contributes to the Photorejuvenation Effect in Photodynamic Therapy in Human Dermal Fibroblasts. J. Investig. Dermatol. 2013, 133, 2265–2275. [Google Scholar] [CrossRef] [Green Version]
- Kushibiki, T.; Tu, Y.; Abu-Yousif, A.O.; Hasan, T. Photodynamic Activation as a Molecular Switch to Promote Osteoblast Cell Differentiation via AP-1 Activation. Sci. Rep. 2015, 5, 13114. [Google Scholar] [CrossRef] [Green Version]
- Egli, R.J.; Schober, M.; Hempfing, A.; Ganz, R.; Hofstetter, W.; Leunig, M. Sensitivity of Osteoblasts, Fibroblasts, Bone Marrow Cells, and Dendritic Cells to 5-Aminolevulinic Acid Based Photodynamic Therapy. J. Photochem. Photobiol. B 2007, 89, 70–77. [Google Scholar] [CrossRef]
- WD, G. Therapeutic Window of Photodynamic Treatment (PDT) in Conservative Periodontal Therapy-Analysis of Cell Migration within A Three Dimensional Collagen Matrix-. Online J. Dent. Oral Health 2021, 4. [Google Scholar] [CrossRef]
- Yang, R.; Guo, S.; Xiao, S.; Ding, Y. Enhanced Wound Healing and Osteogenic Potential of Photodynamic Therapy on Human Gingival Fibroblasts. Photodiagn. Photodyn. Ther. 2020, 32. [Google Scholar] [CrossRef] [PubMed]
- Pierfelice, T.V.; D’Amico, E.; D’Ercole, S.; Lepore, S.; Piattelli, A.; Barone, A.; Iezzi, G.; Petrini, M. Functionalization of A Cortical Membrane with a Photodynamic Protocol. J. Funct. Biomater. 2023, 14, 133. [Google Scholar] [CrossRef]
- Zhu, L.; Yao, Y.; Liu, J.; Wang, J.; Xie, H. Expression of Β-catenin and MMP-8 in Gingival Crevicular Fluid and Gingival Tissue Indicates the Disease severity of Patients with Chronic Periodontitis. Exp. Ther. Med. 2019, 18, 2131–2139. [Google Scholar] [CrossRef]
- Karrer, S.; Bosserhoff, A.K.; Weiderer, P.; Landthaler, M.; Szeimies, R.M. Influence of 5-Aminolevulinic Acid and Red Light on Collagen Metabolism of Human Dermal Fibroblasts. J. Investig. Dermatol. 2003, 120, 325–331. [Google Scholar] [CrossRef] [PubMed]
- Pierfelice, T.V.; D’amico, E.; Iezzi, G.; Piattelli, A.; Di Pietro, N.; D’arcangelo, C.; Comuzzi, L.; Petrini, M. Nanoporous Titanium Enriched with Calcium and Phosphorus Promotes Human Oral Osteoblast Bioactivity. Int. J. Environ. Res. Public. Health 2022, 19, 6212. [Google Scholar] [CrossRef] [PubMed]
- Rodrigues, A.Z.; de Oliveira, P.T.; Novaes, A.B.; Maia, L.P.; de Souza, S.L.S.; Palioto, D.B. Evaluation of in Vitro Human Gingival Fibroblast Seeding on Acellular Dermal Matrix. Braz. Dent. J. 2010, 21, 179–189. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jubeli, E.; Khzam, A.; Yagoubi, N. Cells Integration onto Scaffolds Prepared from Polyester Based Polymers—Importance of Polymer Thermal Properties in Addition to Hydrophilicity. Int. J. Polym. Mater. Polym. Biomater. 2019, 68, 1068–1077. [Google Scholar] [CrossRef]
Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
OCN | TCAGCCAACTCGTCACAGTC | GGCGCTACCTGTATCAATGG |
ALP | AATGAGTGAGTGACCATCCTGG | GCACCCCAAGACCTGCTTTAT |
COL1 | AGTCAGAGTGAGGACAGTGAATTG | CACATCACACCAGGAAGTGC |
FN1 | GGAAAGTGTCCCTATCTCTGATACC | AATGTTGGTGAATCGCAGGT |
MMP8 | ATGTTCTCCCTGAAGACGCT | AGACTGATACTGGTTGCTTGGT |
Β-ACT | CCAGAGGCGTACAGGGATAG | GAGAAGATGACCCAGGACTCTC |
GAPDH | ACGGGAAGCTTGTCATCAAT | GGAGGGATCTCGCATTTCTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Petrini, M.; D’Amico, E.; Pierfelice, T.V.; Aceto, G.M.; Karaban, M.; Felice, P.; Piattelli, A.; Barone, A.; Iezzi, G. Photodynamic Therapy with Aminolevulinic Acid Enhances the Cellular Activity of Cells Cultured on Porcine Acellular Dermal Matrix Membranes Used in Periodontology. Gels 2023, 9, 584. https://doi.org/10.3390/gels9070584
Petrini M, D’Amico E, Pierfelice TV, Aceto GM, Karaban M, Felice P, Piattelli A, Barone A, Iezzi G. Photodynamic Therapy with Aminolevulinic Acid Enhances the Cellular Activity of Cells Cultured on Porcine Acellular Dermal Matrix Membranes Used in Periodontology. Gels. 2023; 9(7):584. https://doi.org/10.3390/gels9070584
Chicago/Turabian StylePetrini, Morena, Emira D’Amico, Tania Vanessa Pierfelice, Gitana Maria Aceto, Maryia Karaban, Pietro Felice, Adriano Piattelli, Antonio Barone, and Giovanna Iezzi. 2023. "Photodynamic Therapy with Aminolevulinic Acid Enhances the Cellular Activity of Cells Cultured on Porcine Acellular Dermal Matrix Membranes Used in Periodontology" Gels 9, no. 7: 584. https://doi.org/10.3390/gels9070584