GelMA@ginsenoside Rb3 Targets Inflammatory Microenvironment in Periodontitis via MAPK Pathway
Abstract
1. Introduction
2. Results and Discussion
2.1. Culture and Identification of PDLSCs
2.2. Characterization of GelMA Hydrogel
2.3. Determination of Optimal Concentrations for GelMA@G-Rb3 and LPS Treatment
2.4. Anti-Inflammatory Effects of GelMA@G-Rb3 on LPS-Stimulated PDLSCs
2.5. Network Pharmacology Analysis and Mechanistic Investigation of GelMA@G-Rb3 in Periodontitis Treatment
2.6. Evaluation of GelMA@G-Rb3 Biocompatibility and Periodontal Regeneration Capacity
3. Conclusions
4. Materials and Methods
4.1. Isolation and Culture of PDLSCs
4.2. Characterization and Differentiation of PDLSCs
4.3. Synthesis and Characterization of GelMA Hydrogel
4.4. Biocompatibility and Cytotoxicity Evaluation of GelMA and LPS on PDLSCs
4.5. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR) Analysis
4.6. Enzyme-Linked Immunosorbent Assay (ELISA) Analysis
4.7. Network Pharmacology Analysis
4.8. Western Blot Analysis
4.9. Periodontitis Model Establishment and Treatment in Rats
4.10. Micro-CT Analysis
4.11. Histological and Immunofluorescence Analysis
4.12. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| AGE-RAGE | advanced glycation end products |
| ALP | alkaline phosphatase |
| BP | biological processes |
| ERK1 | extracellular signal-regulated kinase 1 |
| G-Rb3 | Ginsenoside Rb3 |
| H&E staining | hematoxylin and eosin staining |
| IL-6 | interleukin-6 |
| LPS | lipopolysaccharide |
| MA | methacrylic anhydride |
| MAPK | mitogen-activated protein kinase |
| Masson staining | Masson’s trichrome staining |
| Micro-CT | micro computed tomography |
| MMP2 | matrix metalloproteinase 2 |
| PBS | phosphate-buffered saline |
| PDLSCs | periodontal ligament stem cells |
| PI3K-Akt | phosphatidylinositol 3-kinase-protein kinase B |
| PPI | protein–protein interaction |
| PTGS2 | prostaglandin-endoperoxide synthase 2 |
| qPCR | quantitative real-time polymerase chain reaction |
| SD | Sprague-Dawley |
| SEM | scanning electron microscopy |
| SPF | specific pathogen free |
| TGFβ | transforming growth factor β |
References
- Hajishengallis, G. Interconnection of periodontal disease and comorbidities: Evidence, mechanisms, and implications. Periodontol. 2000 2022, 89, 9–18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- World Health Organization. Global Oral Health Status Report: Towards Universal Health Coverage for Oral Health by 2030 Executive Summary; World Health Organization: Geneva, Switzerland, 2022; Licence: CCBY-NC-SA30 IGO. [Google Scholar]
- World Health Organization. Global Strategy Action Plan on Oral Health 2023–2030; World Health Organization: Geneva, Switzerland, 2024; Licence: CCBY-NC-SA30 IGO. [Google Scholar]
- Di Stefano, M.; Polizzi, A.; Santonocito, S.; Romano, A.; Lombardi, T.; Isola, G. Impact of oral microbiome in periodontal health and periodontitis: A critical review on prevention and treatment. Int. J. Mol. Sci. 2022, 23, 5142. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Wong, Y.K.; Liao, F. What has traditional Chinese medicine delivered for modern medicine? Expert. Rev. Mol. Med. 2018, 20, e4. [Google Scholar] [CrossRef] [Scilit]
- Li, C.; Jia, W.W.; Yang, J.L.; Cheng, C.; Olaleye, O.E. Multi-compound and drug-combination pharmacokinetic research on Chinese herbal medicines. Acta Pharmacol. Sin. 2022, 43, 3080–3095. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, X.; Liu, J.; Zuo, T.-T.; Hu, Y.; Li, Z.; Wang, H.-D.; Xu, X.-Y.; Yang, W.-Z.; Guo, D.-A. Advances and challenges in ginseng research from 2011 to 2020: The phytochemistry, quality control, metabolism, and biosynthesis. Nat. Prod. Rep. 2022, 39, 875–909. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, C.; Qu, L.; Wang, R.; Wang, F.; Yang, Z.; Xiao, F. Multi-layered effects of Panax notoginseng on immune system. Pharmacol. Res. 2024, 204, 107203. [Google Scholar] [CrossRef] [Scilit]
- Kim, J.H.; Kim, D.H.; Jo, S.; Cho, M.J.; Cho, Y.R.; Lee, Y.J.; Byun, S. Immunomodulatory functional foods and their molecular mechanisms. Exp. Mol. Med. 2022, 54, 1–11. [Google Scholar] [CrossRef] [Scilit]
- Xu, X.; Wu, Q.; Pei, K.; Zhang, M.; Mao, C.; Zhong, X.; Huang, Y.; Dai, Y.; Yin, R.; Chen, Z.; et al. Ginsenoside Rg1 reduces cardiac inflammation against myocardial ischemia/reperfusion injury by inhibiting macrophage polarization. J. Ginseng Res. 2024, 48, 570–580. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Jiang, L.; Song, W.; Wang, C.; Yu, S.; Qiao, J.; Wang, X.; Jin, C.; Zhao, D.; Bai, X.; et al. Ginsenosides on stem cells fate specification-a novel perspective. Front. Cell Dev. Biol. 2023, 11, 1190266. [Google Scholar] [CrossRef] [Scilit]
- Li, J.; Li, F.; Jin, D. Ginsenosides are Promising Medicine for Tumor and Inflammation: A Review. Am. J. Chin. Med. 2023, 51, 883–908. [Google Scholar] [CrossRef] [Scilit]
- Yu, S.; Yin, Z.; Ling, M.; Chen, Z.; Zhang, Y.; Pan, Y.; Zhang, Y.; Cai, X.; Chen, Z.; Hao, H.; et al. Ginsenoside Rg1 enriches gut microbial indole-3-acetic acid to alleviate depression-like behavior in mice via oxytocin signaling. Phytomedicine 2024, 135, 156186. [Google Scholar] [CrossRef] [Scilit]
- Sun, M.; Ji, Y.; Zhou, S.; Chen, R.; Yao, H.; Du, M. Ginsenoside Rb3 inhibits osteoclastogenesis via ERK/NF-κB signaling pathway in vitro and in vivo. Oral. Dis. 2022, 29, 3460–3471. [Google Scholar] [CrossRef] [Scilit]
- Sun, M.; Ji, Y.; Li, Z.; Chen, R.; Zhou, S.; Liu, C.; Du, M. Ginsenoside Rb3 inhibits pro-inflammatory cytokines via MAPK/AKT/NF-κB pathways and attenuates rat alveolar bone resorption in response to porphyromonas gingivalis LPS. Molecules 2020, 25, 4815. [Google Scholar] [CrossRef] [Scilit]
- He, J.; Sun, Y.; Gao, Q.; He, C.; Yao, K.; Wang, T.; Xie, M.; Yu, K.; Nie, J.; Chen, Y.; et al. Gelatin Methacryloyl Hydrogel, from Standardization, Performance, to Biomedical Application. Adv. Heal. Healthc. Mater. 2023, 12, e2300395. [Google Scholar] [CrossRef] [Scilit]
- Lv, B.; Lu, L.; Hu, L.; Cheng, P.; Hu, Y.; Xie, X.; Dai, G.; Mi, B.; Liu, X.; Liu, G. Recent advances in GelMA hydrogel transplantation for musculoskeletal disorders and related disease treatment. Theranostics 2023, 13, 2015–2039. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jeon, O.; Wolfson, D.W.; Alsberg, E. In-situ formation of growth-factor-loaded coacervate microparticle-embedded hydrogels for directing encapsulated stem cell fate. Adv. Mater. 2015, 27, 2216–2223. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sakr, M.A.; Sakthivel, K.; Hossain, T.; Shin, S.R.; Siddiqua, S.; Kim, J.; Kim, K. Recent trends in gelatin methacryloyl nanocomposite hydrogels for tissue engineering. J. Biomed. Mater. Res. A 2022, 110, 708–724. [Google Scholar] [CrossRef] [Scilit]
- Zhu, Y.; Yu, X.; Liu, H.; Li, J.; Gholipourmalekabadi, M.; Lin, K.; Yuan, C.; Wang, P. Strategies of functionalized GelMA-based bioinks for bone regeneration: Recent advances and future perspectives. Bioact. Mater. 2024, 38, 346–373. [Google Scholar] [CrossRef] [Scilit]
- Zhou, B.; Jiang, X.; Zhou, X.; Tan, W.; Luo, H.; Lei, S.; Yang, Y. GelMA-based bioactive hydrogel scaffolds with multiple bone defect repair functions: Therapeutic strategies and recent advances. Biomater. Res. 2023, 27, 86. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liao, J.; Hou, B.; Huang, H. Preparation, properties and drug controlled release of chitin-based hydrogels: An updated review. Carbohydr. Polym. 2022, 283, 119177. [Google Scholar] [CrossRef] [Scilit]
- Nazir, F.; Ashraf, I.; Iqbal, M.; Ahmad, T.; Anjum, S. 6-deoxy-aminocellulose derivatives embedded soft gelatin methacryloyl (GelMA) hydrogels for improved wound healing applications: In vitro and in vivo studies. Int. J. Biol. Macromol. 2021, 185, 419–433. [Google Scholar] [CrossRef] [Scilit]
- Tang, B.; Yan, C.; Shen, X.; Li, Y. The bidirectional biological interplay between microbiome and viruses in periodontitis and type-2 diabetes mellitus. Front. Immunol. 2022, 13, 885029. [Google Scholar] [CrossRef] [Scilit]
- Hoare, A.; Soto, C.; Rojas-Celis, V.; Bravo, D. Chronic Inflammation as a Link between Periodontitis and Carcinogenesis. Mediat. Inflamm. 2019, 2019, 1029857. [Google Scholar] [CrossRef] [Scilit]
- Slots, J. Primer on etiology and treatment of progressive/severe periodontitis: A systemic health perspective. Periodontol. 2000 2020, 83, 272–276. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jepsen, K.; Jepsen, S. Antibiotics/antimicrobials: Systemic and local administration in the therapy of mild to moderately advanced periodontitis. Periodontol. 2000 2016, 71, 82–112. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Łasica, A.; Golec, P.; Laskus, A.; Zalewska, M.; Gędaj, M.; Popowska, M. Periodontitis: Etiology, conventional treatments, and emerging bacteriophage and predatory bacteria therapies. Front. Microbiol. 2024, 15, 1469414. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, H.; Liu, M.; Chen, G.; Wu, Y.; Xie, L.; Han, X.; Zhang, G.; Tan, Z.; Ding, W.; Fan, H.; et al. Anti-inflammatory effects of Ginsenoside Rb3 in LPS-induced macrophages through direct inhibition of TLR4 signaling pathway. Front. Pharmacol. 2022, 13, 714554. [Google Scholar] [CrossRef] [Scilit]
- Wang, M.; Chen, X.; Jin, W.; Xu, X.; Li, X.; Sun, L. Ginsenoside Rb3 exerts protective properties against cigarette smoke extract-induced cell injury by inhibiting the p38 MAPK/NF-κB and TGF-β1/VEGF pathways in fibroblasts and epithelial cells. Biomed. Pharmacother. 2018, 108, 1751–1758. [Google Scholar] [CrossRef] [Scilit]
- Oh, H.; Cho, W.; Park, S.Y.; Abd El-Aty, A.M.; Jeong, J.H.; Jung, T.W. Ginsenoside Rb3 ameliorates podocyte injury under hyperlipidemic conditions via PPARδ- or SIRT6-mediated suppression of inflammation and oxidative stress. J. Ginseng Res. 2023, 47, 400–407. [Google Scholar] [CrossRef] [Scilit]
- Rajeshwari, H.R.; Dhamecha, D.; Jagwani, S.; Rao, M.; Jadhav, K.; Shaikh, S.; Puzhankara, L.; Jalalpure, S. Local drug delivery systems in the management of periodontitis: A scientific review. J. Control. Release 2019, 307, 393–409. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Li, J.; Tang, M.; Peng, C.; Wang, G.; Wang, J.; Wang, X.; Chang, X.; Guo, J.; Gui, S. Smart stimuli-responsive hydrogels for drug delivery in periodontitis treatment. Biomed. Pharmacother. 2023, 162, 114688. [Google Scholar] [CrossRef] [Scilit]
- Deng, D.; Li, X.; Zhang, J.J.; Yin, Y.; Tian, Y.; Gan, D.; Wu, R.; Wang, J.; Tian, B.-M.; Chen, F.-M.; et al. Biotin-Avidin System-Based Delivery Enhances the Therapeutic Performance of MSC-Derived Exosomes. ACS Nano 2023, 17, 8530–8550. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.; Hasani-Sadrabadi, M.M.; Zarubova, J.; Dashtimighadam, E.; Haghniaz, R.; Khademhosseini, A.; Buttle, M.J.; Moshaverinia, A.; Aghaloo, T.; Li, S. Immunomodulatory Microneedle Patch for Periodontal Tissue Regeneration. Matter 2023, 5, 666–682. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khalaf, H.; Lönn, J.; Bengtsson, T. Cytokines and chemokines are differentially expressed in patients with periodontitis: Possible role for TGF-β1 as a marker for disease progression. Cytokine 2014, 67, 29–35. [Google Scholar] [CrossRef] [Scilit]
- Teles, F.R.F.; Chandrasekaran, G.; Martin, L.; Patel, M.; Kallan, M.J.; Furquim, C.; Hamza, T.; Cucchiara, A.J.; Kantarci, A.; Urquhart, O.; et al. Salivary and serum inflammatory biomarkers during periodontitis progression and after treatment. J. Clin. Periodontol. 2024, 51, 1619–1631. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sevari, S.P.; Kim, J.K.; Chen, C.; Nasajpour, A.; Wang, C.-Y.; Krebsbach, P.H.; Khademhosseini, A.; Ansari, S.; Weiss, P.S.; Moshaverinia, A. Whitlockite-enabled hydrogel for craniofacial bone regeneration. ACS Appl. Mater. Interfaces 2021, 13, 35342–35355. [Google Scholar] [CrossRef] [Scilit]
- He, Y.; Wu, Z.; Chen, S.; Wang, J.; Zhu, L.; Xie, J.; Zhou, C.; Zou, S. Activation of the pattern recognition receptor NOD1 in periodontitis impairs the osteogenic capacity of human periodontal ligament stem cells via p38/MAPK signalling. Cell Prolif. 2022, 55, e13330. [Google Scholar] [CrossRef] [Scilit]
- Wang, Z.; Zeng, H.; Wang, C.; Wang, J.; Zhang, J.; Qu, S.; Han, Y.; Yang, L.; Ni, Y.; Peng, W.; et al. Tim4 deficiency reduces CD301b(+) macrophage and aggravates periodontitis bone loss. Int. J. Oral. Sci. 2024, 16, 20. [Google Scholar] [CrossRef] [Scilit]
- Yang, Y.; Liu, Q.; Lu, X.; Ma, J.; Mei, D.; Chen, Q.; Zhao, T.; Chen, J. Sanhuang decoction inhibits autophagy of periodontal ligament fibroblasts during orthodontic tooth movement by activating PI3K-Akt-mTOR pathway. Biomed. Pharmacother. 2023, 166, 115391. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Y.; Xu, C.; Mao, J.; Mao, L.; Li, W.; Liu, Z.; Shin, A.; Wu, J.; Hou, L.; Li, D.; et al. ZIF-8-based Nanoparticles for Inflammation Treatment and Oxidative Stress Reduction in Periodontitis. ACS Appl. Mater. Interfaces 2024, 16, 36077–36094. [Google Scholar] [CrossRef] [Scilit]
- Gou, H.; Chen, X.; Zhu, X.; Li, L.; Hou, L.; Zhou, Y.; Xu, Y. Sequestered SQSTM1/p62 crosstalk with Keap1/NRF2 axis in hPDLCs promotes oxidative stress injury induced by periodontitis. Free Radic. Biol. Med. 2022, 190, 62–74. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fu, H.; Sen, L.; Zhang, F.; Liu, S.; Wang, M.; Mi, H.; Liu, M.; Li, B.; Peng, S.; Hu, Z.; et al. Mesenchymal stem cells-derived extracellular vesicles protect against oxidative stress-induced xenogeneic biological root injury via adaptive regulation of the PI3K/Akt/NRF2 pathway. J. Nanobiotechnol. 2023, 21, 466. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Renesme, L.; Cobey, K.D.; Lalu, M.M.; Bubela, T.; Chinnadurai, R.; De Vos, J.; Dunbar, R.; Fergusson, D.; Freund, D.; Galipeau, J.; et al. Delphi-driven consensus definition for mesenchymal stromal cells and clinical reporting guidelines for mesenchymal stromal cell-based therapeutics. Cytotherapy 2025, 27, 146–168. [Google Scholar] [CrossRef] [Scilit] [PubMed]









| Genes | Forward Sequence | Reverse Sequence |
|---|---|---|
| IL-6 | CAATGAGGAGACTTGCCTGGT | GCAGGAACTGGATCAGGACT |
| IL-8 | CTCTGTGTGAAGGTGCAGTTTT | GTTTTCCTTGGGGTCCAGACA |
| PTGS 2 | ACGCCCTCAGACAGCAAAGC | TGACATGGGTGGGAACAGCAAG |
| TGF-β | GCAACAATTCCTGGCGATACC | ATTTCCCCTCCACGGCTCAA |
| GAPDH | CAGGAGGCATTGCTGATGAT | GAAGGCTGGGGCTCATTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sun, J.; Sun, M.; Li, Z.; Liu, L.; Liu, X.; Sun, Y.; Ding, G. GelMA@ginsenoside Rb3 Targets Inflammatory Microenvironment in Periodontitis via MAPK Pathway. Gels 2025, 11, 648. https://doi.org/10.3390/gels11080648
Sun J, Sun M, Li Z, Liu L, Liu X, Sun Y, Ding G. GelMA@ginsenoside Rb3 Targets Inflammatory Microenvironment in Periodontitis via MAPK Pathway. Gels. 2025; 11(8):648. https://doi.org/10.3390/gels11080648
Chicago/Turabian StyleSun, Jinmeng, Minmin Sun, Zekun Li, Luyun Liu, Xinjuan Liu, Yuhui Sun, and Gang Ding. 2025. "GelMA@ginsenoside Rb3 Targets Inflammatory Microenvironment in Periodontitis via MAPK Pathway" Gels 11, no. 8: 648. https://doi.org/10.3390/gels11080648
APA StyleSun, J., Sun, M., Li, Z., Liu, L., Liu, X., Sun, Y., & Ding, G. (2025). GelMA@ginsenoside Rb3 Targets Inflammatory Microenvironment in Periodontitis via MAPK Pathway. Gels, 11(8), 648. https://doi.org/10.3390/gels11080648

