Development of Echinocandin Resistance in Candida haemulonii: An Emergent, Widespread, and Opportunistic Fungal Pathogen
Abstract
:1. Introduction
2. Materials and Methods
2.1. Fungal Strain and Culture Conditions
2.2. Generation of the Echinocandin-Evolved C. haemulonii Strain
2.3. Antifungal Susceptibility Assay
2.4. Sequence Analysis of the FKS1 Gene
2.5. Growth Curves
2.6. Biofilm Formation
2.7. Chitin Content
2.8. Ultrastructural Architecture
2.9. Cell Wall Integrity and Stress Response
2.10. Macrophage Interaction
2.11. In Vivo Assays Using the Galleria mellonella Model
2.11.1. Larval Survival Assay
2.11.2. Hemocyte Density
2.11.3. Larvae Treatment with Antifungals
2.11.4. Fungal Burden
2.12. Statistical Analysis
3. Results
3.1. Generation and Altered Susceptibility in the Evolved C. haemulonii Strain
3.2. FKS1 Gene Analysis
3.3. Cell Wall Integrity and Stress Response
3.4. Acquisition of Resistance to CAS Is Associated with a Fitness Cost
3.5. Fungi–Macrophage Interplay
3.6. Acquisition of CAS Resistance Resulted in In Vivo Attenuated Virulence and Antifungal Resistance
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Healey, K.R.; Perlin, D.S. Fungal resistance to echinocandins and the MDR phenomenon in Candida glabrata. J. Fungi 2018, 4, 105. [Google Scholar] [CrossRef]
- Walker, L.A.; Gow, N.A.R.; Munro, C.A. Fungal echinocandin resistance. Fungal Genet. Biol. 2010, 47, 117–126. [Google Scholar] [CrossRef] [PubMed]
- Perlin, D.S. Echinocandin resistance in Candida. Clin. Infect. Dis. Off. Publ. Infect. Dis. Soc. Am. 2015, 61, 612–617. [Google Scholar] [CrossRef] [PubMed]
- Cowen, L.E.; Sanglard, D.; Howard, S.J.; Rogers, P.D.; Perlin, D.S. Mechanisms of antifungal drug resistance. Cold Spring Harb. Perspect. Med. 2014, 5, a019752. [Google Scholar] [CrossRef] [PubMed]
- Pham, C.D.; Iqbal, N.; Bolden, C.B.; Kuykendall, R.J.; Harrison, L.H.; Farley, M.M.; Schaffner, W.; Beldavs, Z.G.; Chiller, T.M.; Park, B.J.; et al. Role of FKS mutations in Candida glabrata: MIC values, echinocandin resistance, and multidrug resistance. Antimicrob. Agents Chemother. 2014, 58, 4690–4696. [Google Scholar] [CrossRef]
- Castanheira, M.; Woosley, L.N.; Diekema, D.J.; Messer, S.A.; Jones, R.N.; Pfaller, M.A. Low prevalence of fks1 hot spot 1 mutations in a worldwide collection of Candida strains. Antimicrob. Agents Chemother. 2010, 54, 2655–2659. [Google Scholar] [CrossRef] [PubMed]
- Alexander, B.D.; Johnson, M.D.; Pfeiffer, C.D.; Jiménez-Ortigosa, C.; Catania, J.; Booker, R.; Castanheira, M.; Messer, S.A.; Perlin, D.S.; Pfaller, M.A. Increasing echinocandin resistance in Candida glabrata: Clinical failure correlates with presence of FKS mutations and elevated minimum inhibitory concentrations. Clin. Infect. Dis. Off. Publ. Infect. Dis. Soc. Am. 2013, 56, 1724–1732. [Google Scholar] [CrossRef] [PubMed]
- Pfaller, M.A.; Castanheira, M.; Lockhart, S.R.; Ahlquist, A.M.; Messer, S.A.; Jones, R.N. Frequency of decreased susceptibility and resistance to echinocandins among fluconazole-resistant bloodstream isolates of Candida glabrata. J. Clin. Microbiol. 2012, 50, 1199–1203. [Google Scholar] [CrossRef]
- Silva, L.N.; Mello, T.P.; Ramos, L.S.; Branquinha, M.H.; Santos, A.L.S. New and promising chemotherapeutics for emerging infections involving drug-resistant non-albicans Candida species. Curr. Top. Med. Chem. 2019, 19, 2527–2553. [Google Scholar] [CrossRef]
- Muñoz, J.F.; Gade, L.; Chow, N.A.; Loparev, V.N.; Juieng, P.; Berkow, E.L.; Farrer, R.A.; Litvintseva, A.P.; Cuomo, C.A. Genomic insights into multidrug-resistance, mating and virulence in Candida auris and related emerging species. Nat. Commun. 2018, 9, 5346. [Google Scholar] [CrossRef]
- Khan, Z.U.; Al-Sweih, N.A.; Ahmad, S.; Al-Kazemi, N.; Khan, S.; Joseph, L.; Chandy, R. Outbreak of fungemia among neonates caused by Candida haemulonii resistant to amphotericin B, itraconazole, and fluconazole. J. Clin. Microbiol. 2007, 45, 2025–2027. [Google Scholar] [CrossRef] [PubMed]
- Kim, M.N.; Shin, J.H.; Sung, H.; Lee, K.; Kim, E.C.; Ryoo, N.; Lee, J.S.; Jung, S.I.; Park, K.H.; Kee, S.J.; et al. Candida haemulonii and closely related species at 5 university hospitals in Korea: Identification, antifungal susceptibility, and clinical features. Clin. Infect. Dis. Off. Publ. Infect. Dis. Soc. Am. 2009, 48, e57–e61. [Google Scholar] [CrossRef] [PubMed]
- Ramos, L.S.; Figueiredo-Carvalho, M.H.G.; Silva, L.N.; Siqueira, N.L.M.; Lima, J.C.; Oliveira, S.S.; Almeida-Paes, R.; Zancopé-Oliveira, R.M.; Azevedo, F.S.; Ferreira, A.L.P.; et al. The threat called Candida haemulonii species complex in Rio de Janeiro State, Brazil: Focus on antifungal resistance and virulence attributes. J. Fungi 2022, 8, 574. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Niu, Y.; Tan, J.; Liu, W.; Sun, M.-A.; Yang, E.; Wang, Q.; Li, R.; Wang, Y.; Liu, W. Global screening of genomic and transcriptomic factors associated with phenotype differences between multidrug-resistant and -susceptible Candida haemulonii strains. mSystems 2019, 4, 1–17. [Google Scholar] [CrossRef]
- Silva, L.N.; Ramos, L.S.; Oliveira, S.S.C.; Magalhães, L.B.; Squizani, E.D.; Kmetzsch, L.; Vainstein, M.H.; Branquinha, M.H.; Santos, A. Insights into the multi-azole resistance profile in Candida haemulonii species complex. J. Fungi 2020, 6, 215. [Google Scholar] [CrossRef] [PubMed]
- Silva, L.N.; Oliveira, S.S.C.; Magalhães, L.B.; Andrade Neto, V.V.; Torres-Santos, E.C.; Carvalho, M.D.C.; Pereira, M.D.; Branquinha, M.H.; Santos, A.L.S. Unmasking the Amphotericin B resistance mechanisms in Candida haemulonii species complex. ACS Infect. Dis. 2020, 6, 1273–1282. [Google Scholar] [CrossRef]
- Ramos, L.S.; Figueiredo-Carvalho, M.H.; Barbedo, L.S.; Ziccardi, M.; Chaves, A.L.; Zancope-Oliveira, R.M.; Pinto, M.R.; Sgarbi, D.B.; Dornelas-Ribeiro, M.; Branquinha, M.H.; et al. Candida haemulonii complex: Species identification and antifungal susceptibility profiles of clinical isolates from Brazil. J. Antimicrob. Chemother. 2015, 70, 111–115. [Google Scholar] [CrossRef] [PubMed]
- Bordallo-Cardona, M.Á.; Escribano, P.; de la Pedrosa, E.G.G.; Marcos-Zambrano, L.J.; Cantón, R.; Bouza, E.; Guinea, J. In vitro exposure to increasing micafungin concentrations easily promotes echinocandin resistance in Candida glabrata isolates. Antimicrob. Agents Chemother. 2017, 61, 1–5. [Google Scholar] [CrossRef]
- CLSI Standard M27; Reference Method for Broth Dilution Antifungal Susceptibility Testing of Yeasts. CLSI: Wayne, PA, USA, 2017.
- Arnaud, M.B.; Costanzo, M.C.; Skrzypek, M.S.; Shah, P.; Binkley, G.; Lane, C.; Miyasato, S.R.; Sherlock, G. Sequence resources at the Candida Genome Database. Nucleic Acids Res. 2007, 35, 452–456. [Google Scholar] [CrossRef]
- Chow, N.A.; Gade, L.; Batra, D.; Rowe, L.A.; Juieng, P.; Ben-Ami, R.; Loparev, V.N.; Litvintseva, A.P. Genome sequence of a multidrug-resistant Candida haemulonii isolate from a patient with chronic leg ulcers in Israel. Genome Announc. 2018, 6, e00176-18. [Google Scholar] [CrossRef]
- Mello, T.P.; Aor, A.C.; Gonçalves, D.S.; Seabra, S.H.; Branquinha, M.H.; Santos, A.L.S. Assessment of biofilm formation by Scedosporium apiospermum, S. aurantiacum, S. minutisporum and Lomentospora prolificans. Biofouling 2016, 32, 737–749. [Google Scholar] [CrossRef]
- Abi-Chacra, E.A.; Souza, L.O.; Cruz, L.P.; Braga-Silva, L.A.; Goncalves, D.S.; Sodre, C.L.; Ribeiro, M.D.; Seabra, S.H.; Figueiredo-Carvalho, M.H.; Barbedo, L.S.; et al. Phenotypical properties associated with virulence from clinical isolates belonging to the Candida parapsilosis complex. FEMS Yeast Res. 2013, 13, 831–848. [Google Scholar] [CrossRef]
- Mesa-Arango, A.C.; Rueda, C.; Roman, E.; Quintin, J.; Terron, M.C.; Luque, D.; Netea, M.G.; Pla, J.; Zaragoza, O. Cell wall changes in amphotericin B-resistant strains from Candida tropicalis and relationship with the immune responses elicited by the host. Antimicrob. Agents Chemother. 2016, 60, 2326–2335. [Google Scholar] [CrossRef] [PubMed]
- Yang, F.; Kravets, A.; Bethlendy, G.; Welle, S.; Rustchenko, E. Chromosome 5 monosomy of Candida albicans controls susceptibility to various toxic agents, including major antifungals. Antimicrob. Agents Chemother. 2013, 57, 5026–5036. [Google Scholar] [CrossRef]
- Ramos, L.S.; Oliveira, S.S.C.; Silva, L.N.; Granato, M.Q.; Gonçalves, D.S.; Frases, S.; Seabra, S.H.; Macedo, A.J.; Kneipp, L.F.; Branquinha, M.H.; et al. Surface, adhesiveness and virulence aspects of Candida haemulonii species complex. Med. Mycol. 2020, 58, 973–986. [Google Scholar] [CrossRef] [PubMed]
- Silva, L.N.; Campos-Silva, R.; Ramos, L.S.; Trentin, D.S.; Macedo, A.J.; Branquinha, M.H.; Santos, A.L.S. Virulence of Candida haemulonii complex in Galleria mellonella and efficacy of classical antifungal drugs: A comparative study with other clinically relevant non-albicans Candida species. FEMS Yeast Res. 2018, 18, foy082. [Google Scholar] [CrossRef]
- Scorzoni, L.; de Lucas, M.P.; Mesa-Arango, A.C.; Fusco-Almeida, A.M.; Lozano, E.; Cuenca-Estrella, M.; Mendes-Giannini, M.J.; Zaragoza, O. Antifungal efficacy during Candida krusei infection in non-conventional models correlates with the yeast in vitro susceptibility profile. PLoS ONE 2013, 8, e060047. [Google Scholar] [CrossRef]
- Mesa-Arango, A.C.; Forastiero, A.; Bernal-Martínez, L.; Cuenca-Estrella, M.; Mellado, E.; Zaragoza, O. The non-mammalian host Galleria mellonella can be used to study the virulence of the fungal pathogen Candida tropicalis and the efficacy of antifungal drugs during infection by this pathogenic yeast. Med. Mycol. 2013, 51, 461–472. [Google Scholar] [CrossRef] [PubMed]
- Pappas, P.G.; Kauffman, C.A.; Andes, D.R.; Clancy, C.J.; Marr, K.A.; Ostrosky-Zeichner, L.; Reboli, A.C.; Schuster, M.G.; Vazquez, J.A.; Walsh, T.J.; et al. Clinical practice guideline for the management of candidiasis: 2016 update by the infectious diseases society of America. Clin. Infect. Dis. Off. Publ. Infect. Dis. Soc. Am. 2015, 62, e1–e50. [Google Scholar] [CrossRef]
- Park, S.; Kelly, R.; Kahn, J.N.; Robles, J.; Hsu, M.J.; Register, E.; Li, W.; Vyas, V.; Fan, H.; Abruzzo, G.; et al. Specific substitutions in the echinocandin target Fks1p account for reduced susceptibility of rare laboratory and clinical Candida sp. isolates. Antimicrob. Agents Chemother. 2005, 49, 3264–3273. [Google Scholar] [CrossRef]
- Lima, S.L.; Colombo, A.L.; de Almeida Junior, J.N. Fungal cell wall: Emerging antifungals and drug resistance. Front. Microbiol. 2019, 10, 2573. [Google Scholar] [CrossRef] [PubMed]
- Cendejas-Bueno, E.; Kolecka, A.; Alastruey-Izquierdo, A.; Theelen, B.; Groenewald, M.; Kostrzewa, M.; Cuenca-Estrella, M.; Gomez-Lopez, A.; Boekhout, T. Reclassification of the Candida haemulonii complex as Candida haemulonii (C. haemulonii group I), C. duobushaemulonii sp. nov. (C. haemulonii group II), and C. haemulonii var vulnera var. nov.: Three multiresistant human pathogenic yeasts. J. Clin. Microbiol. 2012, 50, 3641–3651. [Google Scholar] [CrossRef] [PubMed]
- Choi, H.W.; Shin, J.H.; Jung, S.I.; Park, K.H.; Cho, D.; Kee, S.J.; Shin, M.G.; Suh, S.P.; Ryang, D.W. Species-specific differences in the susceptibilities of biofilms formed by Candida bloodstream isolates to echinocandin antifungals. Antimicrob. Agents Chemother. 2007, 51, 1520–1523. [Google Scholar] [CrossRef] [PubMed]
- Muro, M.D.; Motta, F.d.A.; Burger, M.; Melo, A.S.d.A.; Dalla-Costa, L.M. Echinocandin resistance in two Candida haemulonii isolates from pediatric patients. J. Clin. Microbiol. 2012, 50, 3783–3785. [Google Scholar] [CrossRef]
- Ben-Ami, R.; Garcia-Effron, G.; Lewis, R.E.; Gamarra, S.; Leventakos, K.; Perlin, D.S.; Kontoyiannis, D.P. Fitness and virulence costs of Candida albicans FKS1 Hot Spot mutations associated with echinocandin resistance. J. Infect. Dis. 2011, 204, 626–635. [Google Scholar] [CrossRef]
- Slater, J.L.; Howard, S.J.; Sharp, A.; Goodwin, J.; Gregson, L.M.; Alastruey-Izquierdo, A.; Arendrup, M.C.; Warn, P.A.; Perlin, D.S.; Hope, W.W. Disseminated candidiasis caused by Candida albicans with amino acid substitutions in Fks1 at position Ser645 cannot be successfully treated with micafungin. Antimicrob. Agents Chemother. 2011, 55, 3075–3083. [Google Scholar] [CrossRef]
- Ben-Ami, R.; Kontoyiannis, D.P. Resistance to echinocandins comes at a cost: The impact of FKS1 hotspot mutations on Candida albicans fitness and virulence. Virulence 2012, 3, 95–97. [Google Scholar] [CrossRef]
- Papp, C.; Kocsis, K.; Tóth, R.; Bodai, L.; Willis, J.R.; Ksiezopolska, E.; Lozoya-Pérez, N.E.; Vágvölgyi, C.; Mora Montes, H.; Gabaldón, T.; et al. Echinocandin-induced microevolution of Candida parapsilosis influences virulence and abiotic stress tolerance. mSphere 2018, 3, e00547-18. [Google Scholar] [CrossRef]
- Bain, J.M.; Louw, J.; Lewis, L.E.; Okai, B.; Walls, C.A.; Ballou, E.R.; Walker, L.A.; Reid, D.; Munro, C.A.; Brown, A.J.; et al. Candida albicans hypha formation and mannan masking of β-glucan inhibit macrophage phagosome maturation. mBio 2014, 5, e01874. [Google Scholar] [CrossRef]
- Gantner, B.N.; Simmons, R.M.; Underhill, D.M. Dectin-1 mediates macrophage recognition of Candida albicans yeast but not filaments. EMBO J. 2005, 24, 1277–1286. [Google Scholar] [CrossRef]
- Hasim, S.; Allison, D.P.; Retterer, S.T.; Hopke, A.; Wheeler, R.T.; Doktycz, M.J.; Reynolds, T.B. β-(1,3)-Glucan unmasking in some Candida albicans mutants correlates with increases in cell wall surface roughness and decreases in cell wall elasticity. Infect. Immun. 2017, 85, 00601-16. [Google Scholar] [CrossRef] [PubMed]
- Bruno, M.; Kersten, S.; Bain, J.M.; Jaeger, M.; Rosati, D.; Kruppa, M.D.; Lowman, D.W.; Rice, P.J.; Graves, B.; Ma, Z.; et al. Transcriptional and functional insights into the host immune response against the emerging fungal pathogen Candida auris. Nat. Microbiol. 2020, 5, 1516–1531. [Google Scholar] [CrossRef]
- Cavalheiro, M.; Teixeira, M.C. Candida biofilms: Threats, challenges, and promising strategies. Front. Med. 2018, 5, 28. [Google Scholar] [CrossRef] [PubMed]
- Ibe, C.; Munro, C.A. Fungal cell wall proteins and signaling pathways form a cytoprotective network to combat stresses. J. Fungi 2021, 7, 739. [Google Scholar] [CrossRef] [PubMed]
- Reinoso-Martín, C.; Schüller, C.; Schuetzer-Muehlbauer, M.; Kuchler, K. The yeast protein kinase C cell integrity pathway mediates tolerance to the antifungal drug caspofungin through activation of Slt2p mitogen-activated protein kinase signaling. Eukaryot. Cell 2003, 2, 1200–1210. [Google Scholar] [CrossRef] [PubMed]
- Iyer, K.R.; Robbins, N.; Cowen, L.E. The role of Candida albicans stress response pathways in antifungal tolerance and resistance. iScience 2022, 25, 103953. [Google Scholar] [CrossRef] [PubMed]
- Walker, L.A.; Gow, N.A.R.; Munro, C.A. Elevated chitin content reduces the susceptibility of Candida species to caspofungin. Antimicrob. Agents Chemother. 2013, 57, 146–154. [Google Scholar] [CrossRef]
- Walker, L.A.; Munro, C.A.; de Bruijn, I.; Lenardon, M.D.; McKinnon, A.; Gow, N.A. Stimulation of chitin synthesis rescues Candida albicans from echinocandins. PLoS Pathog. 2008, 4, e1000040. [Google Scholar] [CrossRef] [PubMed]
- Lee, K.K.; MacCallum, D.M.; Jacobsen, M.D.; Walker, L.A.; Odds, F.C.; Gow, N.A.R.; Munro, C.A. Elevated cell wall chitin in Candida albicans confers echinocandin resistance in vivo. Antimicrob. Agents Chemother. 2012, 56, 208–217. [Google Scholar] [CrossRef]
- Kovács, R.; Nagy, F.; Tóth, Z.; Bozó, A.; Balázs, B.; Majoros, L. Synergistic effect of nikkomycin Z with caspofungin and micafungin against Candida albicans and Candida parapsilosis biofilms. Lett. Appl. Microbiol. 2019, 69, 271–278. [Google Scholar] [CrossRef]
- Pérez-García, L.A.; Csonka, K.; Flores-Carreón, A.; Estrada-Mata, E.; Mellado-Mojica, E.; Németh, T.; López-Ramírez, L.A.; Toth, R.; López, M.G.; Vizler, C.; et al. Role of protein glycosylation in Candida parapsilosis cell wall integrity and host interaction. Front. Microbiol. 2016, 7, 306. [Google Scholar] [CrossRef] [PubMed]
- Lamaris, G.A.; Lewis, R.E.; Chamilos, G.; May, G.S.; Safdar, A.; Walsh, T.J.; Raad, I.I.; Kontoyiannis, D.P. Caspofungin-mediated beta-glucan unmasking and enhancement of human polymorphonuclear neutrophil activity against Aspergillus and non-Aspergillus hyphae. J. Infect. Dis. 2008, 198, 186–192. [Google Scholar] [CrossRef]
- Steger, M.; Bermejo-Jambrina, M.; Yordanov, T.; Wagener, J.; Brakhage, A.A.; Pittl, V.; Huber, L.A.; Haas, H.; Lass-Flörl, C.; Posch, W.; et al. β-1,3-glucan-lacking Aspergillus fumigatus mediates an efficient antifungal immune response by activating complement and dendritic cells. Virulence 2019, 10, 957–969. [Google Scholar] [CrossRef] [PubMed]
- Zamith-Miranda, D.; Amatuzzi, R.F.; Munhoz da Rocha, I.F.; Martins, S.T.; Lucena, A.C.R.; Vieira, A.Z.; Trentin, G.; Almeida, F.; Rodrigues, M.L.; Nakayasu, E.S.; et al. Transcriptional and translational landscape of Candida auris in response to caspofungin. Comput. Struct. Biotechnol. J. 2021, 19, 5264–5277. [Google Scholar] [CrossRef]
- Garcia-Effron, G.; Lee, S.; Park, S.; Cleary, J.D.; Perlin, D.S. Effect of Candida glabrata FKS1 and FKS2 mutations on echinocandin sensitivity and kinetics of 1,3-beta-D-glucan synthase: Implication for the existing susceptibility breakpoint. Antimicrob. Agents Chemother. 2009, 53, 3690–3699. [Google Scholar] [CrossRef]
- Garcia-Effron, G.; Park, S.; Perlin, D.S. Correlating echinocandin MIC and kinetic inhibition of fks1 mutant glucan synthases for Candida albicans: Implications for interpretive breakpoints. Antimicrob. Agents Chemother. 2009, 53, 112–122. [Google Scholar] [CrossRef] [PubMed]
- Kordalewska, M.; Cancino-Prado, G.; Júnior, J.N.d.A.; Brandão, I.B.; Peral, R.T.d.S.; Colombo, A.L.; Perlin, D.S. Novel non-hot spot modification in Fks1 of Candida auris confers echinocandin resistance. Antimicrob. Agents Chemother. 2023, 67, e00423. [Google Scholar] [CrossRef]
- Lackner, M.; Tscherner, M.; Schaller, M.; Kuchler, K.; Mair, C.; Sartori, B.; Istel, F.; Arendrup, M.C.; Lass-Flörl, C. Positions and numbers of FKS mutations in Candida albicans selectively influence in vitro and in vivo susceptibilities to echinocandin treatment. Antimicrob. Agents Chemother. 2014, 58, 3626–3635. [Google Scholar] [CrossRef]
- Shields, R.K.; Nguyen, M.H.; Press, E.G.; Kwa, A.L.; Cheng, S.; Du, C.; Clancy, C.J. The presence of an FKS mutation rather than MIC is an independent risk factor for failure of echinocandin therapy among patients with invasive candidiasis due to Candida glabrata. Antimicrob. Agents Chemother. 2012, 56, 4862–4869. [Google Scholar] [CrossRef]
- Asadzadeh, M.; Mokaddas, E.; Ahmad, S.; Abdullah, A.A.; de Groot, T.; Meis, J.F.; Shetty, S.A. Molecular characterisation of Candida auris isolates from immunocompromised patients in a tertiary-care hospital in Kuwait reveals a novel mutation in FKS1 conferring reduced susceptibility to echinocandins. Mycoses 2022, 65, 331–343. [Google Scholar] [CrossRef]
- Kiyohara, M.; Miyazaki, T.; Okamoto, M.; Hirayama, T.; Makimura, K.; Chibana, H.; Nakada, N.; Ito, Y.; Sumiyoshi, M.; Ashizawa, N.; et al. Evaluation of a novel FKS1 R1354H mutation associated with caspofungin resistance in Candida auris using the CRISPR-Cas9 system. J. Fungi 2023, 9, 529. [Google Scholar] [CrossRef] [PubMed]
Antifungals | MIC Values (mg/L) | |||||
---|---|---|---|---|---|---|
Parental Strain | Evolved Strains Obtained under Different CAS Concentrations a | |||||
Ch4 | Ch4 0.25 mg/L | Ch4 0.5 mg/L | Ch4′r 1.0 mg/L | Ch4′r 2.0 mg/L | Ch4′r 4.0 mg/L | |
CAS | 0.5 | 0.5 | 0.5 | >16 | >16 | >16 |
MICA | 0.25 | 0.25 | 0.5 | >16 | >16 | >16 |
AND | 0.125 | 0.125 | 0.25 | >16 | >16 | >16 |
Genes | Nucleotide Sequence (Position/Mutation) | Amino Acid Sequence (Position/Mutation) | Fungal Strains |
---|---|---|---|
FKS1 HS1 | |||
1924—TTCTTGACTTTGTCCTTGAGAGATCCT | 635—FLTLSLRD | B11899 a | |
1924—TTCTTGACTTTGTCCTTGAGAGATCCT | 635—FLTLSLRD | Ch4 | |
1924—TTCTTGACTTTGTCCTTGAGAGATCCT | 635—FLTLSLRD | Ch4′r | |
FKS1 HS2 | |||
4048—GACTGGATTAGACGTTATACCTTG | 1350—DWIRRYT | B11899 a | |
4048—GACTGGATTAGACGTTATACCTTG | 1350—DWIRRYT | Ch4 | |
4048—GACTGGATTAGACATTATACCTTG | 1350—DWIRHYT | Ch4′r |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Silva, L.N.; Ramos, L.S.; Oliveira, S.S.C.; Magalhães, L.B.; Cypriano, J.; Abreu, F.; Macedo, A.J.; Branquinha, M.H.; Santos, A.L.S. Development of Echinocandin Resistance in Candida haemulonii: An Emergent, Widespread, and Opportunistic Fungal Pathogen. J. Fungi 2023, 9, 859. https://doi.org/10.3390/jof9080859
Silva LN, Ramos LS, Oliveira SSC, Magalhães LB, Cypriano J, Abreu F, Macedo AJ, Branquinha MH, Santos ALS. Development of Echinocandin Resistance in Candida haemulonii: An Emergent, Widespread, and Opportunistic Fungal Pathogen. Journal of Fungi. 2023; 9(8):859. https://doi.org/10.3390/jof9080859
Chicago/Turabian StyleSilva, Laura N., Lívia S. Ramos, Simone S. C. Oliveira, Lucas B. Magalhães, Jefferson Cypriano, Fernanda Abreu, Alexandre J. Macedo, Marta H. Branquinha, and André L. S. Santos. 2023. "Development of Echinocandin Resistance in Candida haemulonii: An Emergent, Widespread, and Opportunistic Fungal Pathogen" Journal of Fungi 9, no. 8: 859. https://doi.org/10.3390/jof9080859
APA StyleSilva, L. N., Ramos, L. S., Oliveira, S. S. C., Magalhães, L. B., Cypriano, J., Abreu, F., Macedo, A. J., Branquinha, M. H., & Santos, A. L. S. (2023). Development of Echinocandin Resistance in Candida haemulonii: An Emergent, Widespread, and Opportunistic Fungal Pathogen. Journal of Fungi, 9(8), 859. https://doi.org/10.3390/jof9080859