Dark Pigments in Entomopathogenic Fungal Microsclerotia: Preliminary Evidence of a 1,8-Dihydroxynaphthalene-melanin-like Compound in Metarhizium robertsii
Abstract
:1. Introduction
2. Materials and Methods
2.1. Fungal Isolate
2.2. Melanin Biosynthesis Inhibition
2.3. Propagule Characterization
2.4. Flaviolin and Melanin Quantification
2.5. Thermotolerance and Oxidative Stress Tolerance Assays
2.6. Relative Gene Expression
2.7. Statistical Analysis
3. Results
3.1. Propagule Characterization
3.2. Flaviolin and Melanin Quantification
3.3. Desiccation, Thermotolerance, and Oxidative Stress Tolerance Assays
3.4. Relative Gene Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lacey, L.A.; Grzywacz, D.; Shapiro-Ilan, D.I.; Frutos, R.; Brownbridge, M.; Goettel, M.S. Insect Pathogens as Biological Control Agents: Back to the Future. J. Invertebr. Pathol. 2015, 132, 1–41. [Google Scholar] [CrossRef] [PubMed]
- Harel, A.; Gorovits, R.; Yarden, O. Changes in Protein Kinase A Activity Accompany Sclerotial Development in Sclerotinia Sclerotiorum. Phytopathology 2005, 95, 397–404. [Google Scholar] [CrossRef] [PubMed]
- Georgiou, C.D.; Patsoukis, N.; Papapostolou, I.; Zervoudakis, G. Sclerotial Metamorphosis in Filamentous Fungi Is Induced by Oxidative Stress. Integr. Comp. Biol. 2006, 46, 691–712. [Google Scholar] [CrossRef] [PubMed]
- Santos, M.; Cesanelli, I.; Diánez, F.; Sánchez-Montesinos, B.; Moreno-Gavíra, A. Advances in the Role of Dark Septate Endophytes in the Plant Resistance to Abiotic and Biotic Stresses. J. Fungi 2021, 7, 939. [Google Scholar] [CrossRef] [PubMed]
- Sun, X.; Liu, D.; Wang, Y.; Ma, A. Biogenesis of Macrofungal Sclerotia: Influencing Factors and Molecular Mechanisms. Appl. Microbiol. Biotechnol. 2020, 104, 4227–4234. [Google Scholar] [CrossRef] [PubMed]
- Jackson, M.A.; Schisler, D.A. Liquid Culture Production of Microsclerotia of Colletotrichum Truncatum for Use as Bioherbicidal Propagules. Mycol. Res. 1995, 99, 879–884. [Google Scholar] [CrossRef]
- Shearer, J.F.; Jackson, M.A. Liquid Culturing of Microsclerotia of Mycoleptodiscus Terrestris, a Potential Biological Control Agent for the Management of Hydrilla. Biol. Control 2006, 38, 298–306. [Google Scholar] [CrossRef]
- Jaronski, S.T.; Jackson, M.A. Efficacy of Metarhizium Anisopliae Microsclerotial Granules. Biocontrol Sci. Technol. 2008, 18, 849–863. [Google Scholar] [CrossRef]
- Kobori, N.N.; Mascarin, G.M.; Jackson, M.A.; Schisler, D.A. Liquid Culture Production of Microsclerotia and Submerged Conidia by Trichoderma Harzianum Active against Damping-off Disease Caused by Rhizoctonia Solani. Fungal Biol. 2015, 119, 179–190. [Google Scholar] [CrossRef]
- Jackson, M.A.; Jaronski, S.T. Production of Microsclerotia of the Fungal Entomopathogen Metarhizium Anisopliae and Their Potential for Use as a Biocontrol Agent for Soil-Inhabiting Insects. Mycol. Res. 2009, 113, 842–850. [Google Scholar] [CrossRef]
- Mascarin, G.M.; Kobori, N.N.; de Jesus Vital, R.C.; Jackson, M.A.; Quintela, E.D. Production of Microsclerotia by Brazilian Strains of Metarhizium Spp. Using Submerged Liquid Culture Fermentation. World J. Microbiol. Biotechnol. 2014, 30, 1583–1590. [Google Scholar] [CrossRef]
- Jackson, M.A.; Jaronski, S.T. Development of Pilot-Scale Fermentation and Stabilisation Processes for the Production of Microsclerotia of the Entomopathogenic Fungus Metarhizium Brunneum Strain F52. Biocontrol Sci. Technol. 2012, 22, 915–930. [Google Scholar] [CrossRef]
- Song, Z.; Yin, Y.; Jiang, S.; Liu, J.; Wang, Z. Optimization of Culture Medium for Microsclerotia Production by Nomuraea Rileyi and Analysis of Their Viability for Use as a Mycoinsecticide. BioControl 2014, 59, 597–605. [Google Scholar] [CrossRef]
- Wang, H.; Lei, Z.; Reitz, S.; Li, Y.; Xu, X. Production of Microsclerotia of the Fungal Entomopathogen Lecanicillium Lecanii (Hypocreales: Cordycipitaceae) as a Biological Control Agent against Soil-Dwelling Stages of Frankliniella Occidentalis (Thysanoptera: Thripidae). Biocontrol Sci. Technol. 2013, 23, 234–238. [Google Scholar] [CrossRef]
- Villamizar, L.F.; Nelson, T.L.; Jones, S.A.; Jackson, T.A.; Hurst, M.R.H.; Marshall, S.D.G. Formation of Microsclerotia in Three Species of Beauveria and Storage Stability of a Prototype Granular Formulation. Biocontrol Sci. Technol. 2018, 28, 1097–1113. [Google Scholar] [CrossRef]
- Huarte-Bonnet, C.; Paixão, F.R.S.; Mascarin, G.M.; Santana, M.; Fernandes, É.K.K.; Pedrini, N. The Entomopathogenic Fungus Beauveria Bassiana Produces Microsclerotia-like Pellets Mediated by Oxidative Stress and Peroxisome Biogenesis. Environ. Microbiol. Rep. 2019, 11, 518–524. [Google Scholar] [CrossRef] [PubMed]
- Jackson, M.A.; Jackson, M.A.; Payne, A.R. Microbial-Based Biopesticides; Springer: Berlin/Heidelberg, Germany, 2016; p. 1477. [Google Scholar] [CrossRef]
- Nitiu, D.S.; Mallo, A.C.; Saparrat, M.C.N. Fungal Melanins That Deteriorate Paper Cultural Heritage: An Overview. Mycologia 2020, 112, 859–870. [Google Scholar] [CrossRef]
- Toledo, A.V.; Franco, M.E.E.; Yanil Lopez, S.M.; Troncozo, M.I.; Saparrat, M.C.N.; Balatti, P.A. Melanins in Fungi: Types, Localization and Putative Biological Roles. Physiol. Mol. Plant Pathol. 2017, 99, 2–6. [Google Scholar] [CrossRef]
- Suthar, M.; Dufossé, L.; Singh, S.K. The Enigmatic World of Fungal Melanin: A Comprehensive Review. J. Fungi 2023, 9, 891. [Google Scholar] [CrossRef]
- Dadachova, E.; Bryan, R.A.; Huang, X.; Moadel, T.; Schweitzer, A.D.; Aisen, P.; Nosanchuk, J.D.; Casadevall, A. Ionizing Radiation Changes the Electronic Properties of Melanin and Enhances the Growth of Melanized Fungi. PLoS ONE 2007, 2, e457. [Google Scholar] [CrossRef]
- Nitiu, D.S.; Mallo, A.C.; Saparrat, M.C.N. Pigmentos Sintetizados Por Hongos Negros y Su Impacto En El Deterioro Del Patrimonio Documental En Papel. Boletín Soc. Argentina Botánica 2022, 57, 1–10. [Google Scholar] [CrossRef]
- Medina, R.; Lucentini, C.G.; Franco, M.E.E.; Petroselli, G.; Rosso, J.A.; Erra-Balsells, R.; Balatti, P.A.; Saparrat, M.C.N. Identification of an Intermediate for 1,8-Dihydroxynaphthalene-Melanin Synthesis in a Race-2 Isolate of Fulvia Fulva (Syn. Cladosporium Fulvum). Heliyon 2018, 4, 1–21. [Google Scholar] [CrossRef]
- Pavan, M.E.; Venero, E.S.; Egoburo, D.E.; Pavan, E.E.; López, N.I.; Julia Pettinari, M. Glycerol Inhibition of Melanin Biosynthesis in the Environmental Aeromonas Salmonicida 34mel T. Appl. Microbiol. Biotechnol. 2019, 103, 1865–1876. [Google Scholar] [CrossRef]
- Pal, A.K.; Gajjar, D.U.; Vasavada, A.R. DOPA and DHN Pathway Orchestrate Melanin Synthesis in Aspergillus Species. J. Music Ther. 2015, 52, 10–18. [Google Scholar] [CrossRef]
- Wang, D.; Li, M.; Yuan, C.; Fang, Y.; Zhang, Z. Guaiacol as a Natural Melanin Biosynthesis Inhibitor to Control Northern Corn Leaf Blight. Pest Manag. Sci. 2022, 78, 4557–4568. [Google Scholar] [CrossRef] [PubMed]
- Lovett, B.; St. Leger, R.J. Stress Is the Rule Rather than the Exception for Metarhizium. Curr. Genet. 2014, 61, 253–261. [Google Scholar] [CrossRef]
- Roberts, D.W.; St. Leger, R.J. Metarhizium Spp., Cosmopolitan Insect-Pathogenic Fungi: Mycological Aspects. Adv. Appl. Microbiol. 2004, 54, 1–70. [Google Scholar] [CrossRef]
- Chen, Y.; Feng, P.; Shang, Y.; Xu, Y.J.; Wang, C. Biosynthesis of Non-Melanin Pigment by a Divergent Polyketide Synthase in Metarhizium Robertsii. Fungal Genet. Biol. 2015, 81, 142–149. [Google Scholar] [CrossRef]
- Paixão, F.R.; Huarte-Bonnet, C.; Ribeiro-Silva, C.D.S.; Mascarin, G.M.; Fernandes, É.K.; Pedrini, N. Tolerance to Abiotic Factors of Microsclerotia and Mycelial Pellets from Metarhizium Robertsii, and Molecular and Ultrastructural Changes during Microsclerotial Differentiation. Front. Fungal Biol. 2021, 2, 654737. [Google Scholar] [CrossRef]
- Incha, M.R.; Thompson, M.G.; Blake-Hedges, J.M.; Liu, Y.; Pearson, A.N.; Schmidt, M.; Gin, J.W.; Petzold, C.J.; Deutschbauer, A.M.; Keasling, J.D. Leveraging Host Metabolism for Bisdemethoxycurcumin Production in Pseudomonas Putida. Metab. Eng. Commun. 2020, 10, e00119. [Google Scholar] [CrossRef]
- Llorente, C.; Bárcena, A.; Vera Bahima, J.; Saparrat, M.C.N.; Arambarri, A.M.; Rozas, M.F.; Mirífico, M.V.; Balatti, P.A. Cladosporium Cladosporioides LPSC 1088 Produces the 1,8-Dihydroxynaphthalene-Melanin-Like Compound and Carries a Putative Pks Gene. Mycopathologia 2012, 174, 397–408. [Google Scholar] [CrossRef] [PubMed]
- Babitskaya, V.G.; Shcherba, V.V.; Filimonova, T.V.; Grigorchuk, E.A. Melanin Pigments from the Fungi Paecilomyces Variotii and Aspergillus Carbonarius. Appl. Biochem. Microbiol. 2000, 36, 128–133. [Google Scholar] [CrossRef]
- Huarte-Bonnet, C.; Kumar, S.; Saparrat, M.C.N.; Girotti, J.R.; Santana, M.; Hallsworth, J.E.; Pedrini, N. Insights into Hydrocarbon Assimilation by Eurotialean and Hypocrealean Fungi: Roles for CYP52 and CYP53 Clans of Cytochrome P450 Genes. Appl. Biochem. Biotechnol. 2017, 184, 1047–1060. [Google Scholar] [CrossRef]
- Bárcena, A.; Petroselli, G.; Velasquez, S.M.; Estévez, J.M.; Erra-Balsells, R.; Balatti, P.A.; Saparrat, M.C.N. Response of the Fungus Pseudocercospora Griseola f. Mesoamericana to Tricyclazole. Mycol. Prog. 2015, 14, 76. [Google Scholar] [CrossRef]
- Bell, A.A.; Wheeler, M.H. Biosynthesis and Functions of Fungal Melanins. Annu. Rev. Phytopathol. 1986, 24, 411–451. [Google Scholar] [CrossRef]
- Rangel, D.E.N.; Butler, M.J.; Torabinejad, J.; Anderson, A.J.; Braga, G.U.L.; Day, A.W.; Roberts, D.W. Mutants and Isolates of Metarhizium Anisopliae Are Diverse in Their Relationships between Conidial Pigmentation and Stress Tolerance. J. Invertebr. Pathol. 2006, 93, 170–182. [Google Scholar] [CrossRef]
- Fang, W.; Fernandes, É.K.K.; Roberts, D.W.; Bidochka, M.J.; St. Leger, R.J. A Laccase Exclusively Expressed by Metarhizium Anisopliae during Isotropic Growth Is Involved in Pigmentation, Tolerance to Abiotic Stresses and Virulence. Fungal Genet. Biol. 2010, 47, 602–607. [Google Scholar] [CrossRef]
- Frandsen, R.J.N.; Schütt, C.; Lund, B.W.; Staerk, D.; Nielsen, J.; Olsson, S.; Giese, H. Two Novel Classes of Enzymes Are Required for the Biosynthesis of Aurofusarin in Fusarium Graminearum. J. Biol. Chem. 2011, 286, 10419–10428. [Google Scholar] [CrossRef]
- Frandsen, R.J.N.; Nielsen, N.J.; Maolanon, N.; Sørensen, J.C.; Olsson, S.; Nielsen, J.; Giese, H. The Biosynthetic Pathway for Aurofusarin in Fusarium Graminearum Reveals a Close Link between the Naphthoquinones and Naphthopyrones. Mol. Microbiol. 2006, 61, 1069–1080. [Google Scholar] [CrossRef]
- Almeida-Paes, R.; Frases, S.; Fialho Monteiro, P.C.; Gutierrez-Galhardo, M.C.; Zancopé-Oliveira, R.M.; Nosanchuk, J.D. Growth Conditions Influence Melanization of Brazilian Clinical Sporothrix Schenckii Isolates. Microbes Infect. 2009, 11, 554–562. [Google Scholar] [CrossRef]
- Almeida-Paes, R.; Frases, S.; de Sousa Araújo, G.; Evangelista de Oliveira, M.M.; Gerfen, G.J.; Nosanchuk, J.D.; Zancopé-Oliveira, R.M. Biosynthesis and Functions of a Melanoid Pigment Produced by Species of the Sporothrix Complex in the Presence of L-Tyrosine. Appl. Environ. Microbiol. 2012, 78, 8623–8630. [Google Scholar] [CrossRef]
- Almeida-Paes, R.; Figueiredo-Carvalho, M.H.G.; Brito-Santos, F.; Almeida-Silva, F.; Oliveira, M.M.E.; Zancopé-Oliveira, R.M. Melanins Protect Sporothrix Brasiliensis and Sporothrix Schenckii from the Antifungal Effects of Terbinafine. PLoS ONE 2016, 11, e0152796. [Google Scholar] [CrossRef] [PubMed]
- Hansberg, W.; Aguirre, J. Hyperoxidant States Cause Microbial Cell Differentiation by Cell Isolation from Dioxygen. J. Theor. Biol. 1990, 142, 201–221. [Google Scholar] [CrossRef] [PubMed]
- Zeun, R.; Buchenauer, H. Einfluß von Tricyclazol Auf Die Entwicklung Und Melaningehalte der Sklerotien von Botrytis Cinerea. J. Phytopathol. 1985, 112, 259–267. [Google Scholar] [CrossRef]
- Buchenauer, H.; Zeun, R.; Schinzer, U. Wirkung von Tricyclazol Auf Das Myzelwachstum Sowie Die Entwicklung Und Pigmentierung der Sklerotien von Sclerotinia Sclerotiorum/Effect of Tricyclazole on Mycelium Growth as Well as on Development and Pigmentation of Sclerotia of Sclerotinia Sclerotior. Zeitschrift Pflanzenkrankheiten Pflanzenschutz/J. Plant Dis. Prot. 1985, 92, 17–26. [Google Scholar]
- Sideri, M.; Georgiou, C.D. Differentiation and Hydrogen Peroxide Production in Sclerotium Rolfsii Are Induced by the Oxidizing Growth Factors, Light and Iron. Mycologia 2000, 92, 1033–1042. [Google Scholar] [CrossRef]
- Papapostolou, I.; Georgiou, C.D. Hydrogen Peroxide Is Involved in the Sclerotial Differentiation of Filamentous Phytopathogenic Fungi. J. Appl. Microbiol. 2010, 109, 1929–1936. [Google Scholar] [CrossRef]
- Papapostolou, I.; Georgiou, C.D. Superoxide Radical Is Involved in the Sclerotial Differentiation of Filamentous Phytopathogenic Fungi: Identification of a Fungal Xanthine Oxidase. Fungal Biol. 2010, 114, 387–395. [Google Scholar] [CrossRef]
- Song, Z.; Yin, Y.; Jiang, S.; Liu, J.; Chen, H.; Wang, Z. Comparative Transcriptome Analysis of Microsclerotia Development in Nomuraea Rileyi. BMC Genom. 2013, 14, 411. [Google Scholar] [CrossRef]
- Liu, J.; Yin, Y.; Song, Z.; Li, Y.; Jiang, S.; Shao, C.; Wang, Z. NADH: Flavin Oxidoreductase/NADH Oxidase and ROS Regulate Microsclerotium Development in Nomuraea Rileyi. World J. Microbiol. Biotechnol. 2014, 30, 1927–1935. [Google Scholar] [CrossRef]
- Wong, K.H.; Cheung, P. Sclerotium of Culinary-Medicinal King Tuber Oyster Mushroom, Pleurotus Tuberregium (Fr.) Singer (Agaricomycetideae): Its Cultivation, Biochemical Composition, and Biopharmacological Effects (Review). Int. J. Med. Mushrooms 2008, 10, 303–313. [Google Scholar] [CrossRef]
- Abo Ellil, A.H.A. Oxidative Stress in Relation to Lipid Peroxidation, Sclerotial Development and Melanin Production by Sclerotium Rolfsii. J. Phytopathol. 1999, 147, 561–566. [Google Scholar] [CrossRef]
- Abo Ellil, A.H.A. Sclerotial Development, Melanin Production and Lipid Peroxidation by Sclerotium Rolfsii. Folia Microbiol. 1999, 44, 181–186. [Google Scholar] [CrossRef]
- Bhat, R.G.; Subbarao, K.V. Host Range Specificity in Verticillium Dahliae. Phytopathology 1999, 89, 1218–1225. [Google Scholar] [CrossRef] [PubMed]
- Fan, R.; Klosterman, S.J.; Wang, C.; Subbarao, K.V.; Xu, X.; Shang, W.; Hu, X. Vayg1 Is Required for Microsclerotium Formation and Melanin Production in Verticillium Dahliae. Fungal Genet. Biol. 2017, 98, 1–11. [Google Scholar] [CrossRef]
- Lai, M.; Cheng, Z.; Xiao, L.; Klosterman, S.J.; Wang, Y. The BZip Transcription Factor VdMRTF1 Is a Negative Regulator of Melanin Biosynthesis and Virulence in Verticillium Dahliae. Microbiol. Spectr. 2022, 10, e02581-21. [Google Scholar] [CrossRef]
- Tolmsoff, A.N.D.W.J.; Tolmsoff, W.J.; Tolmsoff, W.J. Ultrastructure of Melanin Formation in Verticillium Dahliae with (+)-Scytalone as a Biosynthetic Intermediate1 Kleb. Indicate That Its Melanin Occurs as Distinct. Can. J. Microbiol. 1976, 22, 702–711. [Google Scholar]
- Rosas, A.L.; Casadevall, A. Melanization Affects Susceptibility of Cryptococcus Neoformans to Heat and Cold. FEMS Microbiol. Lett. 1997, 153, 265–272. [Google Scholar] [CrossRef]
- Selbmann, L.; Isola, D.; Zucconi, L.; Onofri, S. Resistance to UV-B Induced DNA Damage in Extreme-Tolerant Cryptoendolithic Antarctic Fungi: Detection by PCR Assays. Fungal Biol. 2011, 115, 937–944. [Google Scholar] [CrossRef]
- Suryanarayanan, T.S.; Ravishankar, J.P.; Venkatesan, G.; Murali, T.S. Characterization of the Melanin Pigment of a Cosmopolitan Fungal Endophyte. Mycol. Res. 2004, 108, 974–978. [Google Scholar] [CrossRef]
Name | Forward Primer | Reverse Primer | Name/Function | Reference |
---|---|---|---|---|
Mrtub | TCGAGGGCTTCATGATGCTGC | CACGACCGAATCCGCATTCTG | Gamma-tubulin | This study |
Mrpks1 | CATTCCGCCTCTCTCATTGCC | TGTGCGGCGCATGATATGG | Polyketide synthase 1 | Paixao et al. (2021) [30] |
Mrpks2 | CATCAGCGCCATCGGTTTAGAC | CGGGATAGGGATTGGTTTGTGG | Polyketide synthase 2 | Paixao et al. (2021) [30] |
Mrthnr | ATCAAGGCCGACATCACCAAGG | AATGTCCAGGTGGCCAAAGTGC | Putative 1,3,6,8-tetrahydroxynaphthalene reductase | This study |
Inhibitor | Growth | pH | Dry Biomass (mg/mL) | Propagule Production (Units/mL) ×104 | Propagule Diameter (µm) | ||
---|---|---|---|---|---|---|---|
Inhibitor Name | Pathway Inhibited | Concentration (ppm) | |||||
Control | - | 0 | + | 5.1 ± 0.1 | 61 ± 4 | 1.6 ± 0.2 | 317 ± 14 |
Bicyclopyrone | pyomelanin | 100 | + | 5.1 ± 0.1 | 55 ± 5 | 1.7 ± 0.3 | 339 ± 13 |
350 | + | 5.0 ± 0.01 | 59 ± 7 | 1.8 ± 0.3 | 297 ± 9 | ||
600 | + | 5.1 ± 0.1 | 59 ± 9 | 1.6 ± 0.3 | 308 ± 4 | ||
1200 | + | 5.2 ± 0.2 | 57 ± 8 | 1.7 ± 0.2 | 337 ± 22 | ||
Kojic Acid | DOPA | 100 | + | 5.4 ± 0.1 | 63 ± 7 | 1.6 ± 0.2 | 308 ± 7 |
350 | + | 5.3 ± 0.1 | 66 ± 8 | 1.7 ± 0.3 | 306 ± 11 | ||
600 | + | 5.5 ± 0.1 | 63 ± 6 | 1.5 ± 0.3 | 293 ± 13 | ||
1200 | + | 5.5 ± 0.1 | 58 ± 7 | 2.0 ± 0.4 | 303 ± 8 | ||
Tricyclazole | DHN | 100 | + | 3.4 ± 0.4 *** | 66 ± 1 | 1.9 ± 0.5 | 256 ± 23 |
350 | + | 3.8 ± 0.1 *** | 60 ± 12 | 2.0 ± 0.2 | 100 ± 10 *** | ||
600 | - | 5.4 ± 0.2 | 7 ± 3 *** | - | - | ||
Guaiacol | DHN | 10 | + | 4.8 ± 0.1 | 63 ± 3 | 1.3 ± 0.2 | 291 ± 4 |
35 | + | 4.9 ± 0.1 | 68 ± 2 | 4.9 ± 0.9 **** | 203 ± 9 *** | ||
50 | + | 4.7 ± 0.1 | 78 ± 3 | 3.6 ± 0.3 *** | 181 ± 8 *** | ||
75 | + | 4.9 ± 0.1 | 82 ± 5 | 3.4 ± 0.2 ** | 166 ± 9 *** | ||
100 | - | 5.2 ± 0.2 | 2 ± 1 *** | - | - |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Espín-Sánchez, D.; Preisegger, L.; Mazzolenis, R.; Santana, M.; Saparrat, M.C.N.; Pedrini, N.; Huarte-Bonnet, C. Dark Pigments in Entomopathogenic Fungal Microsclerotia: Preliminary Evidence of a 1,8-Dihydroxynaphthalene-melanin-like Compound in Metarhizium robertsii. J. Fungi 2023, 9, 1162. https://doi.org/10.3390/jof9121162
Espín-Sánchez D, Preisegger L, Mazzolenis R, Santana M, Saparrat MCN, Pedrini N, Huarte-Bonnet C. Dark Pigments in Entomopathogenic Fungal Microsclerotia: Preliminary Evidence of a 1,8-Dihydroxynaphthalene-melanin-like Compound in Metarhizium robertsii. Journal of Fungi. 2023; 9(12):1162. https://doi.org/10.3390/jof9121162
Chicago/Turabian StyleEspín-Sánchez, Daysi, Lautaro Preisegger, Romina Mazzolenis, Marianela Santana, Mario C. N. Saparrat, Nicolás Pedrini, and Carla Huarte-Bonnet. 2023. "Dark Pigments in Entomopathogenic Fungal Microsclerotia: Preliminary Evidence of a 1,8-Dihydroxynaphthalene-melanin-like Compound in Metarhizium robertsii" Journal of Fungi 9, no. 12: 1162. https://doi.org/10.3390/jof9121162
APA StyleEspín-Sánchez, D., Preisegger, L., Mazzolenis, R., Santana, M., Saparrat, M. C. N., Pedrini, N., & Huarte-Bonnet, C. (2023). Dark Pigments in Entomopathogenic Fungal Microsclerotia: Preliminary Evidence of a 1,8-Dihydroxynaphthalene-melanin-like Compound in Metarhizium robertsii. Journal of Fungi, 9(12), 1162. https://doi.org/10.3390/jof9121162