Heterologous Expressed NbSWP12 from Microsporidia Nosema bombycis Can Bind with Phosphatidylinositol 3-Phosphate and Affect Vesicle Genesis
Abstract
:1. Introduction
2. Materials and Methods
2.1. Parasite, Cells, and Cell Culture
2.2. Multiple Sequence Alignment
2.3. Protein Expression and Purification
2.4. Non-Reducing SDS-PAGE
2.5. Yeast Two-Hybrid Analysis
2.6. Liposome Co-Sedimentation
2.7. Lipid Strip Assay
2.8. Targeting of NbSWP12 in Saccharomyces cerevisiae
2.9. Vacuole Staining
2.10. Complementation of Yeast gvp36Δ by NbSWP12
3. Results
3.1. SWP12 and S. cerevisiae BAR Protein Gvp36 Possess Two Representative Conserved Motifs
3.2. NbSWP12 Forms Homodimer
3.3. NbSWP12 Binds to Ptdlns(3)P
3.4. NbSWP12 Targets to Yeast Cell Membrane and Endocytic Vesicle
3.5. NbSWP12 Rescues the Vesicle Genesis Defect of Yeast gvp36Δ
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Weiss, L.M.; Becnel, J.J. Microsporidia: Pathogens of Opportunity, 1st ed.; John Wiley & Sons, Inc.: Ames, IA, USA, 2014. [Google Scholar]
- Stentiford, G.D.; Becnel, J.J.; Weiss, L.M.; Keeling, P.J.; Didier, E.S.; Williams, B.A.P.; Bjornson, S.; Kent, M.L.; Freeman, M.A.; Brown, M.J.F. Microsporidia-Emergent Pathogens in the Global Food Chain. Trends Parasitol. 2016, 32, 336–348. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nakjang, S.; Williams, T.A.; Heinz, E.; Watson, A.K.; Foster, P.G.; Sendra, K.M.; Heaps, S.E.; Hirt, R.P.; Martin Embley, T. Reduction and expansion in microsporidian genome evolution: New insights from comparative genomics. Genome Biol. Evol. 2013, 5, 2285–2303. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dean, P.; Hirt, R.P.; Embley, T.M. Microsporidia: Why Make Nucleotides if You Can Steal Them? PLoS Pathog. 2016, 12, e1005870. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pei, B.; Wang, C.; Yu, B.; Xia, D.; Li, T.; Zhou, Z. The First Report on the Transovarial Transmission of Microsporidian Nosema bombycis in Lepidopteran Crop Pests Spodoptera litura and Helicoverpa armigera. Microorganisms 2021, 9, 1442. [Google Scholar] [CrossRef]
- Tsai, S.; Lo, C.; Soichi, Y.; Wang, C. The characterization of microsporidian isolates (Nosematidae: Nosema) from five important lepidopteran pests in Taiwan. J. Invertebr. Pathol. 2003, 83, 51–59. [Google Scholar] [CrossRef]
- Pan, G.; Xu, J.; Li, T.; Xia, Q.; Liu, S.-L.; Zhang, G.; Li, S.; Li, C.; Liu, H.; Yang, L.; et al. Comparative genomics of parasitic silkworm microsporidia reveal an association between genome expansion and host adaptation. BMC Genom. 2013, 14, 186. [Google Scholar] [CrossRef] [Green Version]
- Simunovic, M.; Evergren, E.; Callan-Jones, A.; Bassereau, P. Curving Cells Inside and Out: Roles of BAR Domain Proteins in Membrane Shaping and Its Cellular Implications. Annu. Rev. Cell Dev. Biol. 2019, 35, 111–129. [Google Scholar] [CrossRef] [Green Version]
- Zhang, B.; Zelhof, A.C. Amphiphysins: Raising the BAR for Synaptic Vesicle Recycling and Membrane Dynamics. Traffic 2002, 3, 452–460. [Google Scholar] [CrossRef]
- Peter, B.J.; Kent, H.M.; Mills, I.G.; Vallis, Y.; Butler, P.J.G.; Evans, P.R.; McMahon, H.T. BAR domains as sensors of membrane curvature: The amphiphysin BAR structure. Science 2004, 303, 495–499. [Google Scholar] [CrossRef] [Green Version]
- Lee, M.C.S.; Schekman, R. Cell biology. BAR domains go on a bender. Science 2004, 303, 479–480. [Google Scholar] [CrossRef] [Green Version]
- McMahon, H.T.; Gallop, J.L. Membrane curvature and mechanisms of dynamic cell membrane remodelling. Nature 2005, 438, 590–596. [Google Scholar] [CrossRef] [PubMed]
- Suetsugu, S.; Kurisu, S.; Takenawa, T. Dynamic shaping of cellular membranes by phospholipids and membrane-deforming proteins. Physiol. Rev. 2014, 94, 1219–1248. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gallop, J.L.; Walrant, A.; Cantley, L.C.; Kirschner, M.W. Phosphoinositides and membrane curvature switch the mode of actin polymerization via selective recruitment of toca-1 and Snx9. Proc. Natl. Acad. Sci. USA 2013, 110, 7193–7198. [Google Scholar] [CrossRef] [Green Version]
- Chen, J.; Geng, L.; Long, M.; Li, T.; Li, Z.; Yang, D.; Ma, C.; Wu, H.; Ma, Z.; Li, C.; et al. Identification of a novel chitin-binding spore wall protein (NbSWP12) with a BAR-2 domain from Nosema bombycis (microsporidia). Parasitology 2013, 140, 1394–1402. [Google Scholar] [CrossRef] [PubMed]
- Jaroenlak, P.; Boakye, D.W.; Vanichviriyakit, R.; Williams, B.A.P.; Sritunyalucksana, K.; Itsathitphaisarn, O. Identification, characterization and heparin binding capacity of a spore-wall, virulence protein from the shrimp microsporidian, Enterocytozoon hepatopenaei (EHP). Parasit Vectors 2018, 11, 177. [Google Scholar] [CrossRef]
- Wu, Z.; Li, Y.; Pan, G.; Tan, X.; Hu, J.; Zhou, Z.; Xiang, Z. Proteomic analysis of spore wall proteins and identification of two spore wall proteins from Nosema bombycis (Microsporidia). Proteomics 2008, 8, 2447–2461. [Google Scholar] [CrossRef]
- Huang, Y.; Chen, J.; Sun, B.; Zheng, R.; Li, B.; Li, Z.; Tan, Y.; Wei, J.; Pan, G.; Li, C.; et al. Engineered resistance to Nosema bombycis by in vitro expression of a single-chain antibody in Sf9-III cells. PLoS ONE 2018, 13, e0193065. [Google Scholar] [CrossRef] [Green Version]
- Chen, J.; Guo, W.; Dang, X.; Huang, Y.; Liu, F.; Meng, X.; An, Y.; Long, M.; Bao, J.; Zhou, Z.; et al. Easy labeling of proliferative phase and sporogonic phase of microsporidia Nosema bombycis in host cells. PLoS ONE 2017, 12, e0179618. [Google Scholar] [CrossRef]
- Lin, L.; Pan, G.; Li, T.; Dang, X.; Deng, Y.; Ma, C.; Chen, J.; Luo, J.; Zhou, Z. The protein import pore Tom40 in the microsporidian Nosema bombycis. J. Eukaryot. Microbiol. 2012, 59, 251–257. [Google Scholar] [CrossRef]
- Querin, L.; Sanvito, R.; Magni, F.; Busti, S.; Van Dorsselaer, A.; Alberghina, L.; Vanoni, M. Proteomic analysis of a nutritional shift-up in Saccharomyces cerevisiae identifies Gvp36 as a BAR-containing protein involved in vesicular traffic and nutritional adaptation. J. Biol. Chem. 2008, 283, 4730–4743. [Google Scholar] [CrossRef] [Green Version]
- Robert, X.; Gouet, P. Deciphering key features in protein structures with the new ENDscript server. Nucleic Acids Res. 2014, 42, W320–W324. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Santiana, M.; Takvorian, P.M.; Altan-Bonnet, N.; Cali, A. A Novel Fluorescent Labeling Method Enables Monitoring of Spatio-Temporal Dynamics of Developing Microsporidia. J. Eukaryot. Microbiol. 2016, 63, 318–325. [Google Scholar] [CrossRef]
- Hacker, C.; Howell, M.; Bhella, D.; Lucocq, J. Strategies for maximizing ATP supply in the microsporidian Encephalitozoon cuniculi: Direct binding of mitochondria to the parasitophorous vacuole and clustering of the mitochondrial porin VDAC. Cell. Microbiol. 2014, 16, 565–579. [Google Scholar] [CrossRef] [Green Version]
- Franchet, A.; Niehus, S.; Caravello, G.; Ferrandon, D. Phosphatidic acid as a limiting host metabolite for the proliferation of the microsporidium Tubulinosema ratisbonensis in Drosophila flies. Nat. Microbiol. 2019, 4, 645–655. [Google Scholar] [CrossRef]
- Huang, Y.; Zheng, S.; Mei, X.; Yu, B.; Sun, B.; Li, B.; Wei, J.; Chen, J.; Li, T.; Pan, G.; et al. A secretory hexokinase plays an active role in the proliferation of. PeerJ 2018, 6, e5658. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Williams, B.A.P.; Hirt, R.P.; Lucocq, J.M.; Embley, T.M. A mitochondrial remnant in the microsporidian Trachipleistophora hominis. Nature 2002, 418, 865–869. [Google Scholar] [CrossRef]
- Wiredu Boakye, D.; Jaroenlak, P.; Prachumwat, A.; Williams, T.A.; Bateman, K.S.; Itsathitphaisarn, O.; Sritunyalucksana, K.; Paszkiewicz, K.H.; Moore, K.A.; Stentiford, G.D.; et al. Decay of the glycolytic pathway and adaptation to intranuclear parasitism within Enterocytozoonidae microsporidia. Environ. Microbiol. 2017, 19, 2077–2089. [Google Scholar] [CrossRef]
- Williams, B.A.P.; Williams, T.A.; Trew, J. Comparative Genomics of Microsporidia. Exp. Suppl. 2022, 114, 43–69. [Google Scholar] [CrossRef]
- Heinz, E.; Hacker, C.; Dean, P.; Mifsud, J.; Goldberg, A.V.; Williams, T.A.; Nakjang, S.; Gregory, A.; Hirt, R.P.; Lucocq, J.M.; et al. Plasma membrane-located purine nucleotide transport proteins are key components for host exploitation by microsporidian intracellular parasites. PLoS Pathog. 2014, 10, e1004547. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dolgikh, V.V.; Tsarev, A.A.; Timofeev, S.A.; Zhuravlyov, V.S. Heterologous overexpression of active hexokinases from microsporidia Nosema bombycis and Nosema ceranae confirms their ability to phosphorylate host glucose. Parasitol. Res. 2019, 118, 1511–1518. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.; Luo, J.; Chen, J.; Vossbrinck, C.R.; Li, T.; Zhou, Z. Characterization of the Largest Secretory Protein Family, Ricin B Lectin-like Protein, in Nosema bombycis: Insights into Microsporidian Adaptation to Host. J. Fungi 2022, 8, 551. [Google Scholar] [CrossRef]
- Mikhailov, K.V.; Simdyanov, T.G.; Aleoshin, V.V. Genomic Survey of a Hyperparasitic Microsporidian Amphiamblys sp. (Metchnikovellidae). Genome Biol. Evol. 2017, 9, 454–467. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Barlow, L.D.; Dacks, J.B.; Wideman, J.G. From all to (nearly) none: Tracing adaptin evolution in Fungi. Cell. Logist. 2014, 4, e28114. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pelin, A.; Selman, M.; Aris-Brosou, S.; Farinelli, L.; Corradi, N. Genome analyses suggest the presence of polyploidy and recent human-driven expansions in eight global populations of the honeybee pathogen Nosema ceranae. Environ. Microbiol. 2015, 17, 4443–4458. [Google Scholar] [CrossRef]
- Pombert, J.-F.; Selman, M.; Burki, F.; Bardell, F.T.; Farinelli, L.; Solter, L.F.; Whitman, D.W.; Weiss, L.M.; Corradi, N.; Keeling, P.J. Gain and loss of multiple functionally related, horizontally transferred genes in the reduced genomes of two microsporidian parasites. Proc. Natl. Acad. Sci. USA 2012, 109, 12638–12643. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Katinka, M.D.; Duprat, S.; Cornillot, E.; Méténier, G.; Thomarat, F.; Prensier, G.; Barbe, V.; Peyretaillade, E.; Brottier, P.; Wincker, P.; et al. Genome sequence and gene compaction of the eukaryote parasite Encephalitozoon cuniculi. Nature 2001, 414, 450–453. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Roth, M.G. Phosphoinositides in constitutive membrane traffic. Physiol. Rev. 2004, 84, 699–730. [Google Scholar] [CrossRef] [Green Version]
- Schu, P.V.; Takegawa, K.; Fry, M.J.; Stack, J.H.; Waterfield, M.D.; Emr, S.D. Phosphatidylinositol 3-kinase encoded by yeast VPS34 gene essential for protein sorting. Science 1993, 260, 88–91. [Google Scholar] [CrossRef]
- Subramanian, D.; Laketa, V.; Müller, R.; Tischer, C.; Zarbakhsh, S.; Pepperkok, R.; Schultz, C. Activation of membrane-permeant caged PtdIns(3)P induces endosomal fusion in cells. Nat. Chem. Biol. 2010, 6, 324–326. [Google Scholar] [CrossRef]
- Xie, Z.; Klionsky, D.J. Autophagosome formation: Core machinery and adaptations. Nat. Cell Biol. 2007, 9, 1102–1109. [Google Scholar] [CrossRef]
- Hammond, G.R.V.; Burke, J.E. Novel roles of phosphoinositides in signaling, lipid transport, and disease. Curr. Opin. Cell Biol. 2020, 63, 57–67. [Google Scholar] [CrossRef] [PubMed]
- Watson, A.K.; Williams, T.A.; Williams, B.A.P.; Moore, K.A.; Hirt, R.P.; Embley, T.M. Transcriptomic profiling of host-parasite interactions in the microsporidian Trachipleistophora hominis. BMC Genom. 2015, 16, 983. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Alexander, W.G.; Wisecaver, J.H.; Rokas, A.; Hittinger, C.T. Horizontally acquired genes in early-diverging pathogenic fungi enable the use of host nucleosides and nucleotides. Proc. Natl. Acad. Sci. USA 2016, 113, 4116–4121. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Plasmid | Primer | Sequence |
---|---|---|
pCold I-Nbswp12 | swp12-F | CGGGATCCATGAAAGATTTTAAAAAGAA |
pUG35-Nbswp12 | swp12-R | GCGTCGACCTTAGTCCTCTCTAATGCTT |
pGADT7-Nbswp12 | 12AD-F | GGAATTCCATATGATGAAAGATTTTAAAAAGAAAATT |
12AD-R | CGCGGATCCTTACTTAGTCCTCTCTAATGCTTT | |
pGBKT7-Nbswp12 | 12BD-F | CGCGGATCC ATGAAAGATTTTAAAAAGAAAATT |
12BD-R | AAAACTGCAGTTACTTAGTCCTCTCTAATGCTTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, J.; Li, Z.; Sheng, X.; Huang, J.; Sun, Q.; Huang, Y.; Wang, R.; Wu, Y.; Long, M.; Bao, J.; et al. Heterologous Expressed NbSWP12 from Microsporidia Nosema bombycis Can Bind with Phosphatidylinositol 3-Phosphate and Affect Vesicle Genesis. J. Fungi 2022, 8, 764. https://doi.org/10.3390/jof8080764
Chen J, Li Z, Sheng X, Huang J, Sun Q, Huang Y, Wang R, Wu Y, Long M, Bao J, et al. Heterologous Expressed NbSWP12 from Microsporidia Nosema bombycis Can Bind with Phosphatidylinositol 3-Phosphate and Affect Vesicle Genesis. Journal of Fungi. 2022; 8(8):764. https://doi.org/10.3390/jof8080764
Chicago/Turabian StyleChen, Jie, Zhi Li, Xiaotian Sheng, Jun Huang, Quan Sun, Yukang Huang, Rong Wang, Yujiao Wu, Mengxian Long, Jialing Bao, and et al. 2022. "Heterologous Expressed NbSWP12 from Microsporidia Nosema bombycis Can Bind with Phosphatidylinositol 3-Phosphate and Affect Vesicle Genesis" Journal of Fungi 8, no. 8: 764. https://doi.org/10.3390/jof8080764
APA StyleChen, J., Li, Z., Sheng, X., Huang, J., Sun, Q., Huang, Y., Wang, R., Wu, Y., Long, M., Bao, J., Zhou, Z., & Pan, G. (2022). Heterologous Expressed NbSWP12 from Microsporidia Nosema bombycis Can Bind with Phosphatidylinositol 3-Phosphate and Affect Vesicle Genesis. Journal of Fungi, 8(8), 764. https://doi.org/10.3390/jof8080764