Diagnosing Fungal Keratitis and Simultaneously Identifying Fusarium and Aspergillus Keratitis with a Dot Hybridization Array
Abstract
:1. Introduction
2. Materials and Methods
2.1. Reference Strains and Clinical Isolates
2.2. Participants
2.3. Collection of Clinical Samples
2.4. Oligonucleotide Probe Development and Fabrication of the DHA
2.5. DNA Extraction, PCR Amplification, and Hybridization with DNA Array
2.6. Fungal DNA Sequencing for Discrepant Analysis
2.7. Statistical Analysis
3. Results
3.1. Demographic Data of Participants
3.2. Detection of Fungi in Corneal Scraping Samples
3.3. Identification of Fusarium sp. in Scrapes
3.4. Identification of Aspergillus sp. in Scrapes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Xie, L.; Zhong, W.; Shi, W.; Sun, S. Spectrum of Fungal Keratitis in North China. Ophthalmology 2006, 113, 1943–1948. [Google Scholar] [CrossRef]
- Khor, W.B.; Prajna, V.N.; Garg, P.; Mehta, J.S.; Xie, L.; Liu, Z.; Padilla, M.D.B.; Joo, C.K.; Inoue, Y.; Goseyarakwong, P.; et al. The Asia Cornea Society Infectious Keratitis Study: A Prospective Multicenter Study of Infectious Keratitis in Asia. Am. J. Ophthalmol. 2018, 195, 161–170. [Google Scholar] [CrossRef]
- Thomas, P.A.; Leck, A.K.; Myatt, M. Characteristic clinical features as an aid to the diagnosis of suppurative keratitis caused by filamentous fungi. Br. J. Ophthalmol. 2005, 89, 1554–1558. [Google Scholar] [CrossRef] [PubMed]
- Dahlgren, M.A.; Lingappan, A.; Wilhelmus, K.R. The clinical diagnosis of microbial keratitis. Am. J. Ophthalmol. 2007, 143, 940–944. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dalmon, C.; Porco, T.C.; Lietman, T.M.; Prajna, N.V.; Prajna, L.; Das, M.R.; Kumar, J.A.; Mascarenhas, J.; Margolis, T.P.; Whitcher, J.P.; et al. The Clinical Differentiation of Bacterial and Fungal Keratitis: A Photographic SurveyDifferentiation of Bacterial and Fungal Keratitis. Investig. Ophthalmol. Vis. Sci. 2012, 53, 1787–1791. [Google Scholar] [CrossRef]
- Kuo, M.T.; Hsu, B.W.Y.; Yin, Y.K.; Fang, P.C.; Lai, H.Y.; Chen, A.; Yu, M.-S.; Tseng, V.S. A deep learning approach in diagnosing fungal keratitis based on corneal photographs. Sci. Rep. 2020, 10, 14424. [Google Scholar] [CrossRef]
- Mundra, J.; Dhakal, R.; Mohamed, A.; Jha, G.; Joseph, J.; Chaurasia, S.; Murthy, S. Outcomes of therapeutic penetrating keratoplasty in 198 eyes with fungal keratitis. Indian J. Ophthalmol. 2019, 67, 1599–1605. [Google Scholar] [CrossRef] [PubMed]
- Ho, J.W.; Fernandez, M.M.; Rebong, R.A.; Carlson, A.N.; Kim, T.; Afshari, N.A. Microbiological profiles of fungal keratitis: A 10-year study at a tertiary referral center. J. Ophthalmic Inflamm. Infect. 2016, 6, 5. [Google Scholar] [CrossRef] [Green Version]
- Cunha, A.M.; Loja, J.T.; Torrão, L.; Moreira, R.; Pinheiro, D.; Falcão-Reis, F.; Pinheiro-Costa, J. A 10-Year Retrospective Clinical Analysis of Fungal Keratitis in a Portuguese Tertiary Centre. Clin. Ophthalmol. 2020, 14, 3833–3839. [Google Scholar] [CrossRef] [PubMed]
- Tew, T.B.; Chu, H.S.; Hou, Y.C.; Chen, W.L.; Wang, I.J.; Hu, F.R. Therapeutic penetrating keratoplasty for microbial keratitis in Taiwan from 2001 to 2014. J. Formos. Med. Assoc. 2020, 119, 1061–1069. [Google Scholar] [CrossRef]
- Hoffman, J.J.; Burton, M.J.; Leck, A. Mycotic Keratitis—A Global Threat from the Filamentous Fungi. J. Fungi 2021, 7, 273. [Google Scholar] [CrossRef]
- Manikandan, P.; Abdel-Hadi, A.; Randhir Babu Singh, Y.; Revathi, R.; Anita, R.; Banawas, S.; Bin Dukhyil, A.A.; Alshehri, B.; Shobana, C.S.; Panneer Selvam, K.; et al. Fungal Keratitis: Epidemiology, Rapid Detection, and Antifungal Susceptibilities of Fusarium and Aspergillus Isolates from Corneal Scrapings. BioMed Res. Int. 2019, 2019, 6395840. [Google Scholar] [CrossRef] [Green Version]
- Prajna, N.V.; Lalitha, P.; Rajaraman, R.; Krishnan, T.; Raghavan, A.; Srinivasan, M.; O’Brien, K.S.; Zegans, M.; McLeod, S.D.; Acharya, N.R.; et al. Changing Azole Resistance: A Secondary Analysis of the MUTT I Randomized Clinical Trial. JAMA Ophthalmol. 2016, 134, 693–696. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lalitha, P.; Sun, C.Q.; Prajna, N.V.; Karpagam, R.; Geetha, M.; O’Brien, K.S.; Cevallos, V.; McLeod, S.D.; Acharya, N.R.; Lietman, T.M. In vitro susceptibility of filamentous fungal isolates from a corneal ulcer clinical trial. Am. J. Ophthalmol. 2014, 157, 318–326. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Prajna, N.V.; Krishnan, T.; Rajaraman, R.; Patel, S.; Shah, R.; Srinivasan, M.; Devi, L.; Das, M.; Ray, K.J.; O’Brien, K.S.; et al. Adjunctive Oral Voriconazole Treatment of Fusarium Keratitis: A Secondary Analysis From the Mycotic Ulcer Treatment Trial II. JAMA Ophthalmol. 2017, 135, 520–525. [Google Scholar] [CrossRef] [Green Version]
- Oechsler, R.A.; Feilmeier, M.R.; Miller, D.; Shi, W.; Hofling-Lima, A.L.; Alfonso, E.C. Fusarium keratitis: Genotyping, in vitro susceptibility and clinical outcomes. Cornea 2013, 32, 667–673. [Google Scholar] [CrossRef] [Green Version]
- Kuo, M.T.; Chang, H.C.; Cheng, C.K.; Chien, C.C.; Fang, P.C.; Chang, T.C. A highly sensitive method for molecular diagnosis of fungal keratitis: A dot hybridization assay. Ophthalmology 2012, 119, 2434–2442. [Google Scholar] [CrossRef] [PubMed]
- Hsiao, C.R.; Huang, L.; Bouchara, J.-P.; Barton, R.; Li, H.C.; Chang, T.C. Identification of medically important molds by an oligonucleotide array. J. Clin. Microbiol. 2005, 43, 3760–3768. [Google Scholar] [CrossRef] [Green Version]
- Leaw, S.N.; Chang, H.C.; Barton, R.; Bouchara, J.-P.; Chang, T.C. Identification of medically important Candida and non-Candida yeast species by an oligonucleotide array. J. Clin. Microbiol. 2007, 45, 2220–2229. [Google Scholar] [CrossRef] [Green Version]
- Fang, P.C.; Chien, C.C.; Yu, H.J.; Ho, R.W.; Tseng, S.L.; Lai, Y.H.; Kuo, M.T. A dot hybridization assay for the diagnosis of bacterial keratitis. Mol. Vis. 2017, 23, 306–317. [Google Scholar]
- Kuo, M.T.; Fang, P.C.; Yu, H.J.; Chao, T.L.; Chien, C.C.; Chen, S.H.; Wang, J.R.; Tseng, S.L.; Lai, Y.H.; Hsiao, C.C.; et al. A Multiplex Dot Hybridization Assay For Detection and Differentiation of Acanthamoeba and Herpes Keratitis. Investig. Ophthalmol. Vis. Sci. 2016, 57, 2158–2163. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huang, F.C.; Hsieh, H.Y.; Chang, T.C.; Su, S.L.; Tseng, S.L.; Lai, Y.H.; Kuo, M.T. A DNA dot hybridization model for molecular diagnosis of parasitic keratitis. Mol. Vis. 2017, 23, 614–623. [Google Scholar] [PubMed]
- Bouchara, J.-P.; Hsieh, H.Y.; Croquefer, S.; Barton, R.; Marchais, V.; Pihet, M.; Chang, T.C. Development of an Oligonucleotide Array for Direct Detection of Fungi in Sputum Samples from Patients with Cystic Fibrosis. J. Clin. Microbiol. 2009, 47, 142–152. [Google Scholar] [CrossRef] [Green Version]
- Lalitha, P.; Shapiro, B.L.; Srinivasan, M.; Prajna, N.V.; Acharya, N.R.; Fothergill, A.W.; Ruiz, J.; Chidambaram, J.D.; Maxey, K.J.; Hong, K.C.; et al. Antimicrobial susceptibility of Fusarium, Aspergillus, and other filamentous fungi isolated from keratitis. Arch. Ophthalmol. 2007, 125, 789–793. [Google Scholar] [CrossRef] [PubMed]
- Sun, C.Q.; Lalitha, P.; Prajna, N.V.; Karpagam, R.; Geetha, M.; O’Brien, K.S.; Oldenburg, C.E.; Ray, K.J.; McLeod, S.D.; Acharya, N.R.; et al. Association between in vitro susceptibility to natamycin and voriconazole and clinical outcomes in fungal keratitis. Ophthalmology 2014, 121, 1495–1500.e1. [Google Scholar] [CrossRef] [Green Version]
- Prajna, N.V.; Krishnan, T.; Mascarenhas, J.; Rajaraman, R.; Prajna, L.; Srinivasan, M.; Raghavan, A.; Oldenburg, C.E.; Ray, K.J.; Zegans, M.E.; et al. The mycotic ulcer treatment trial: A randomized trial comparing natamycin vs voriconazole. JAMA Ophthalmol. 2013, 131, 422–429. [Google Scholar] [CrossRef]
- Lalitha, P.; Prajna, N.V.; Kabra, A.; Mahadevan, K.; Srinivasan, M. Risk factors for treatment outcome in fungal keratitis. Ophthalmology 2006, 113, 526–530. [Google Scholar] [CrossRef]
- Kuo, M.T.; Chien, C.C.; Lo, J.; Hsiao, C.C.; Tseng, S.L.; Lai, Y.H.; Fang, P.C.; Chang, T.C. A DNA dot hybridization model for assessment of bacterial bioburden in orthokeratology lens storage cases. Investig. Ophthalmol. Vis. Sci. 2015, 56, 445–450. [Google Scholar] [CrossRef] [Green Version]
- Pinna, A.; Donadu, M.G.; Usai, D.; Dore, S.; Boscia, F.; Zanetti, S. In Vitro Antimicrobial Activity of a New Ophthalmic Solution Containing Hexamidine Diisethionate 0.05% (Keratosept). Cornea 2020, 39, 1415–1418. [Google Scholar] [CrossRef]
- Zhu, Z.; Zhang, H.; Yue, J.; Liu, S.; Li, Z.; Wang, L. Antimicrobial efficacy of corneal cross-linking in vitro and in vivo for Fusarium solani: A potential new treatment for fungal keratitis. BMC Ophthalmol. 2018, 18, 65. [Google Scholar] [CrossRef]
- Kunt, Z.; Yağmur, M.; Kandemir, H.; Harbiyeli, I.; Erdem, E.; Kalkancı, A.; De Hoog, G.S.; Ilkit, M. In Vitro Efficacy of Chlorhexidine and a riboflavin/UVA Combination on Fungal Agents of Keratitis. Curr. Eye Res. 2020, 45, 7–11. [Google Scholar] [CrossRef] [PubMed]
Species | Reference Strain (s) a | No. of Clinical Isolates | Total No. of Strains |
---|---|---|---|
Target fungal species for sensitivity test for species and genus probes | |||
Fusarium solani | ATCC 36031, CBS 109028, BCRC 32448 | 6 | 9 |
Fusarium verticillioides | BCRC 31492, BCRC 31745, BCRC 35113, BCRC 32878 | 0 | 4 |
Fusarium oxysporum | ATCC 26225, CBS 798.95 | 0 | 2 |
Other Fusarium spp. | BCRC33554 | 4 | 5 |
Aspergillus flavus | BCRC 30006, BCRC 30007, BCRC 30008, BCRC 30009, BCRC 30187 | 2 | 7 |
Aspergillus fumigatus | BCRC 30099, BCRC 30502, BCRC 32120, BCRC 32149, BCRC 32836 | 1 | 6 |
Aspergillus niger | BCRC 30201, BCRC 30204, BCRC 31130 | 0 | 3 |
Aspergillus nidulans | ATCC 11267, ATCC 13833, BCRC 30100 | 0 | 3 |
Aspergillus terreus | BCRC 30135, BCRC 31128, BCRC 32068 | 0 | 3 |
Aspergillus clavatus | BCRC 31116, BCRC 31486, BCRC 31736 | 0 | 3 |
Aspergillus versicolor | BCRC 30225, BCRC 31123, BCRC 31488 | 0 | 3 |
Non-target fungal species for specificity test for species and genus probes | |||
Curvularia spp. | CBS 351.65, BCRC 30899, CBS 102694, CBS 149.71, CBS 148.63 | 2 | 7 |
Candida albicans | BCRC 20511, BCRC 20512, BCRC 20513 | 0 | 3 |
Candida krusei | BCRC 20514, BCRC 21321, BCRC 21720 | 0 | 3 |
Candida glabrata | BCRC 20586, CBS 860, CBS 861 | 0 | 3 |
Candida parapsilosis | BCRC 20515, BCRC 21253, BCRC 21544 | 0 | 3 |
Candida tropicalis | BCRC 20520, BCRC 21436, BCRC 21560 | 0 | 3 |
Candida guilliermondii | BCRC 20862, BCRC 21549, BCRC 21500 | 0 | 3 |
Candida rugosa | BCRC 21356, BCRC 21709 | 0 | 2 |
Acremonium spp. | BCRC 33315, BCRC 32239 | 1 | 3 |
Bipolaris spp. | CBS 274.52 | 1 | 2 |
Pseudallescheria boydii | ATCC 44329, ATCC 44331, ATCC 44332 | 0 | 3 |
Cryptococcus neoformans | BCRC 20528, BCRC 20532, BCRC 22873 | 0 | 5 |
Non-target species from non-fungal pathogens for specificity test for all probes | |||
Staphylococcus aureus | BCRC 10451, BCRC 15287 | 0 | 2 |
Staphylococcus epidermidis | BCRC 10785, BCRC 15245 | 0 | 2 |
Streptococcus pneumoniae | BCRC 14733, BCRC 10794 | 0 | 2 |
Acinetobacter baumannii | BCRC 10591, BCRC 15884 | 0 | 3 |
Moraxella catarhalis | BCRC 10629, BCRC 10628 | 0 | 2 |
Klebsiella pneumoniae | BCRC 11644, CCUG 15938 | 0 | 4 |
Escherichia coli | BCRC 15481, BCRC 15484 | 0 | 4 |
Pseudomonas aeruginosa | BCRC 10944, ATCC 27853 | 6 | 8 |
Serratia marcescens | BCRC 15326, BCRC 11576 | 0 | 5 |
Burkholderia cepacia | BCRC 13208, BCRC 13906 | 0 | 2 |
Stenotrophomonas maltophilia | BCRC 10737 | 0 | 3 |
Mycobacterium chelonae | ATCC 35749, CCUG 37827 | 0 | 2 |
Mycobacterium fortuitum | BCRC 15320, JCM 6387 | 0 | 2 |
Mycobacterium abscessus | NCTC 10269 | 0 | 1 |
Herpes simplex virus type 1 | 2 | 2 | |
Herpes simplex virus type 2 | 2 | 2 | |
Varicella zoster virus | Rod strain | 3 | 4 |
Encephalitozoon cuniculi | ATCC 50789 | 0 | 1 |
Encephalitozoon hellem | ATCC 50504 | 0 | 1 |
Encephalitozoon intestinalis | ATCC 50651 | 0 | 1 |
Vittaforma corneae | 1 | 1 | |
Acanthamoeba castellanii | ATCC 30010, ATCC 50374, ATCC 50370 | 0 | 3 |
Acanthamoeba griffini | ATCC 30731, ATCC 50702 | 0 | 2 |
Target Microorganism | Probe Code a | Sequence (5′ to 3′) | Length (bp) | Tm b (°C) | Location | GenBank Accession No. |
---|---|---|---|---|---|---|
All fungi | FP [17] | GCATCGATGAAGAACGCAGCttttttttt c | 20 | 57.2 | 228–247 | FR727118 |
Fusarium solani | Fuso [18] | AGTAGCTAACACCTCGCGACTGGAGA | 26 | 56.0 | 446–471 | AF129105 |
Fusarium verticillioides | Fumo [18] | CGAGTCAAATCGCGTTCCCCAAATTG | 26 | 54.4 | 395–420 | AY533376 |
Aspergillus flavus | Asfl [18] | CGAACGCAAATCAATCTTTTTCCAGGT | 27 | 51.6 | 512–538 | AY373848 |
Aspergillus fumigatus | Asfu [18] | GCCAGCCGACACCCAACTTTATTTTTCTAA | 30 | 55.2 | 213–242 | AY230140 |
Fusarium sp. | Fu1 d | GCGTCATTTCAACCCTCAAGCCCC | 24 | 63.7 | 340–363 | AM412639 |
Fu2 d | CTTCTGAGTAAAACAAGCAAATAAAT | 26 | 48.9 | 164–189 | AM412639 | |
Fu3 d | AGCTTCCATAGCGTAGTAGYAA | 22 | 53.8 | 442–463 | AM412639 | |
Aspergillus sp. | Asp2 d | GGACGGGCCCRAAAGGCAGCGGCGGC | 26 | 77.8 | 426–451 | AF138290 |
Asp3 d | GGCAGCGGCGGCACCGYGTCCGGTCCT | 27 | 79.7 | 440–466 | AF138290 |
Clinical Parameters | Value |
---|---|
Number of patients | 146 |
Age (years; mean ± s.d.) | 59.3 ± 15.8 |
Sex (women/men; no./no.) | 52/94 |
Disease eye (OD/OS; no./no.) | 72/74 |
Final diagnosis (no.) | |
Fungal keratitis | 107 |
Bacterial keratitis | 16 |
Herpes keratitis | 2 |
Acanthamoebic keratitis | 3 |
Microsporidial stromal keratitis | 3 |
Noninfectious keratitis | 15 |
Major risk factors (no.) | |
Trauma | 65 |
Contact lens wear | 14 |
Dirty water exposure | 7 |
Ocular surface disease | 3 |
Neurotrophic keratopathy | 1 |
Lagophthalmos | 3 |
Facial palsy | 1 |
Hyperthyroidism | 1 |
Diabetes mellitus | 11 |
Chemotherapy | 1 |
Undetermined | 39 |
N = 146 | Culture | Culture or DNA Sequencing | Sensitivity | Specificity | PPR | NPR | |||
---|---|---|---|---|---|---|---|---|---|
Positive | Negative | Positive | Negative | (C.I.; %) | (C.I.; %) | (C.I.; %) | (C.I.; %) | ||
DHA | Positive | 74 | 27 | 100 | 1 | 93.5 | 97.4 | 99.0 | 84.4 |
Negative | 7 | 38 | 7 | 38 | (87.1–96.8) | (86.8–99.9) | (94.6–100.0) | (71.2–92.3) |
N = 140 a | Post-Discrepancy | Sensitivity | Specificity | PPR | NPR | |||
---|---|---|---|---|---|---|---|---|
Positive | Negative | (C.I.; %) | (C.I.; %) | (C.I.; %) | (C.I.; %) | |||
DHA | Fusarium sp. | Positive | 41 | 6 | 93.2 | 93.8 | 87.2 | 96.8 |
Negative | 3 | 90 | (81.8–97.7) | (87.0–97.1) | (74.8–94.0) | (90.9–99.1) | ||
F. solani | Positive | 26 | 0 | 83.9 | 100.0 | 100.0 | 95.6 | |
Negative | 5 | 109 | (67.4–92.9) | (96.6–100.0) | (87.1–100.0) | (90.1–98.1) | ||
F. verticillioides | Positive | 1 | 1 | 100.0 | 99.3 | 50.0 | 100.0 | |
Negative | 0 | 138 | (5.1–100.0) | (96.0–100.0) | (2.6–97.4) | (97.3–100.0) |
N = 140 a | Post-Discrepancy | Sensitivity | Specificity | PPR | NPR | |||
---|---|---|---|---|---|---|---|---|
Positive | Negative | (C.I.; %) | (C.I.; %) | (C.I.; %) | (C.I.; %) | |||
DHA | Aspergillus sp. | Positive | 5 | 0 | 83.3 | 100.0 | 100.0 | 99.3 |
Negative | 1 | 134 | (43.7–99.2) | (97.2–100.0) | (56.6–100.0) | (95.9–100.0) | ||
A. flavus | Positive | 2 | 0 | 100.0 | 100.0 | 100.0 | 100.0 | |
Negative | 0 | 138 | (17.8–100.0) | (97.3–100.0) | (17.8–100.0) | (97.3–100.0) | ||
A. fumigatus | Positive | 2 | 0 | 100.0 | 100.0 | 100.0 | 100.0 | |
Negative | 0 | 138 | (17.8–100.0) | (97.3–100.0) | (17.8–100.0) | (97.3–100.0) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kuo, M.-T.; Hsu, S.-L.; You, H.-L.; Kuo, S.-F.; Fang, P.-C.; Yu, H.-J.; Chen, A.; Tseng, C.-Y.; Lai, Y.-H.; Chen, J.-L. Diagnosing Fungal Keratitis and Simultaneously Identifying Fusarium and Aspergillus Keratitis with a Dot Hybridization Array. J. Fungi 2022, 8, 64. https://doi.org/10.3390/jof8010064
Kuo M-T, Hsu S-L, You H-L, Kuo S-F, Fang P-C, Yu H-J, Chen A, Tseng C-Y, Lai Y-H, Chen J-L. Diagnosing Fungal Keratitis and Simultaneously Identifying Fusarium and Aspergillus Keratitis with a Dot Hybridization Array. Journal of Fungi. 2022; 8(1):64. https://doi.org/10.3390/jof8010064
Chicago/Turabian StyleKuo, Ming-Tse, Shiuh-Liang Hsu, Huey-Ling You, Shu-Fang Kuo, Po-Chiung Fang, Hun-Ju Yu, Alexander Chen, Chia-Yi Tseng, Yu-Hsuan Lai, and Jiunn-Liang Chen. 2022. "Diagnosing Fungal Keratitis and Simultaneously Identifying Fusarium and Aspergillus Keratitis with a Dot Hybridization Array" Journal of Fungi 8, no. 1: 64. https://doi.org/10.3390/jof8010064
APA StyleKuo, M.-T., Hsu, S.-L., You, H.-L., Kuo, S.-F., Fang, P.-C., Yu, H.-J., Chen, A., Tseng, C.-Y., Lai, Y.-H., & Chen, J.-L. (2022). Diagnosing Fungal Keratitis and Simultaneously Identifying Fusarium and Aspergillus Keratitis with a Dot Hybridization Array. Journal of Fungi, 8(1), 64. https://doi.org/10.3390/jof8010064