Differential Proinflammatory Responses to Aspergillus fumigatus by Airway Epithelial Cells In Vitro Are Protease Dependent
Abstract
:1. Introduction
2. Materials and Methods
2.1. A. fumigatus Culture
2.2. Epithelial Cell Culture, Conidia Germination and Growth
2.3. Protease Inhibition and Dectin-1 Receptor Inhibition
2.4. Human Nasal Epithelial Cell Culture
2.5. Cytokine Gene Expression and Protein Production
2.6. Statistical Analysis
3. Results
3.1. Germination of A. fumigatus Conidia Induces Cytokine Production by Airway Epithelial Cells
3.2. Primary Human Airway Epithelial Cells Show Increased Cytokine Production in Response to A. fumigatus
3.3. Proteases Play a Role in A. fumigatus (Af293)-Elicited IL-8 Induction
3.4. Secreted A. fumigatus Metalloprotease (A1160+) and Cysteine Proteases Induce IL-8 Production
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
Gene | Sense | Antisense |
---|---|---|
IL-6 | GCAGAAAACAACCTCAACCTT | ACCTCAAACTCCAAAAGACCA |
IL-8 | CAGAGGGTTGTGGAGAAGTTT | ATGAAGTGTTGAAGTAGATTTGCT |
References
- Brown, G.D.; Denning, D.W.; Gow, N.A.; Levitz, S.M.; Netea, M.G.; White, T.C. Hidden killers: Human fungal infections. Sci. Transl. Med. 2012, 4, 165rv113. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Latge, J.P.; Chamilos, G. Aspergillus fumigatus and Aspergillosis in 2019. Clin. Microbiol. Rev. 2019, 33. [Google Scholar] [CrossRef] [PubMed]
- Brenier-Pinchart, M.P.; Lebeau, B.; Borel, J.L.; Quesada, J.L.; Mallaret, M.R.; Garban, F.; Brion, J.P.; Molina, L.; Bosson, J.L.; Thiebaut-Bertrand, A.; et al. Community-acquired invasive aspergillosis and outdoor filamentous fungal spore load: A relationship? Clin. Microbiol. Infect. 2011, 17, 1387–1390. [Google Scholar] [CrossRef] [PubMed]
- Kosmidis, C.; Denning, D.W. The clinical spectrum of pulmonary aspergillosis. Thorax 2015, 70, 270–277. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Denning, D.W.; Cadranel, J.; Beigelman-Aubry, C.; Ader, F.; Chakrabarti, A.; Blot, S.; Ullmann, A.J.; Dimopoulos, G.; Lange, C. Chronic pulmonary aspergillosis: Rationale and clinical guidelines for diagnosis and management. Eur. Respir. J. 2016, 47, 45–68. [Google Scholar] [CrossRef] [PubMed]
- Bigot, J.; Guillot, L.; Guitard, J.; Ruffin, M.; Corvol, H.; Balloy, V.; Hennequin, C. Bronchial Epithelial Cells on the Front Line to Fight Lung Infection-Causing Aspergillus fumigatus. Front. Immunol. 2020, 11, 1041. [Google Scholar] [CrossRef]
- Amitani, R.; Kawanami, R. Interaction of Aspergillus with human respiratory mucosa: A study with organ culture model. Med. Mycol. 2009, 47 (Suppl. 1), S127–S131. [Google Scholar] [CrossRef] [Green Version]
- Bertuzzi, M.; Schrettl, M.; Alcazar-Fuoli, L.; Cairns, T.C.; Munoz, A.; Walker, L.A.; Herbst, S.; Safari, M.; Cheverton, A.M.; Chen, D.; et al. The pH-responsive PacC transcription factor of Aspergillus fumigatus governs epithelial entry and tissue invasion during pulmonary aspergillosis. PLoS Pathog 2014, 10, e1004413. [Google Scholar] [CrossRef] [Green Version]
- Wasylnka, J.A.; Moore, M.M. Aspergillus fumigatus conidia survive and germinate in acidic organelles of A549 epithelial cells. J. Cell Sci. 2003, 116, 1579–1587. [Google Scholar] [CrossRef] [Green Version]
- Jepsen, C.S.; Dubey, L.K.; Colmorten, K.B.; Moeller, J.B.; Hammond, M.A.; Nielsen, O.; Schlosser, A.; Templeton, S.P.; Sorensen, G.L.; Holmskov, U. FIBCD1 Binds Aspergillus fumigatus and Regulates Lung Epithelial Response to Cell Wall Components. Front. Immunol. 2018, 9, 1967. [Google Scholar] [CrossRef] [Green Version]
- Labram, B.; Namvar, S.; Hussell, T.; Herrick, S.E. Endothelin-1 mediates Aspergillus fumigatus-induced airway inflammation and remodelling. Clin. Exp. Allergy 2019, 49, 861–873. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Neveu, W.A.; Bernardo, E.; Allard, J.L.; Nagaleekar, V.; Wargo, M.J.; Davis, R.J.; Iwakura, Y.; Whittaker, L.A.; Rincon, M. Fungal allergen beta-glucans trigger p38 mitogen-activated protein kinase-mediated IL-6 translation in lung epithelial cells. Am. J. Respir. Cell Mol. Biol. 2011, 45, 1133–1141. [Google Scholar] [CrossRef] [Green Version]
- Oya, E.; Becher, R.; Ekeren, L.; Afanou, A.K.J.; Ovrevik, J.; Holme, J.A. Pro-Inflammatory Responses in Human Bronchial Epithelial Cells Induced by Spores and Hyphal Fragments of Common Damp Indoor Molds. Int. J. Environ. Res. Public Health 2019, 16, 85. [Google Scholar] [CrossRef] [Green Version]
- Sun, W.K.; Lu, X.; Li, X.; Sun, Q.Y.; Su, X.; Song, Y.; Sun, H.M.; Shi, Y. Dectin-1 is inducible and plays a crucial role in Aspergillus-induced innate immune responses in human bronchial epithelial cells. Eur. J. Clin. Microbiol. Infect. Dis. 2012, 31, 2755–2764. [Google Scholar] [CrossRef]
- Alekseeva, L.; Huet, D.; Femenia, F.; Mouyna, I.; Abdelouahab, M.; Cagna, A.; Guerrier, D.; Tichanne-Seltzer, V.; Baeza-Squiban, A.; Chermette, R.; et al. Inducible expression of beta defensins by human respiratory epithelial cells exposed to Aspergillus fumigatus organisms. BMC Microbiol. 2009, 9, 33. [Google Scholar] [CrossRef] [Green Version]
- Bertuzzi, M.; Hayes, G.E.; Icheoku, U.J.; van Rhijn, N.; Denning, D.W.; Osherov, N.; Bignell, E.M. Anti-Aspergillus Activities of the Respiratory Epithelium in Health and Disease. J. Fungi 2018, 4, 8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Balloy, V.; Sallenave, J.M.; Wu, Y.; Touqui, L.; Latge, J.P.; Si-Tahar, M.; Chignard, M. Aspergillus fumigatus-induced interleukin-8 synthesis by respiratory epithelial cells is controlled by the phosphatidylinositol 3-kinase, p38 MAPK, and ERK1/2 pathways and not by the toll-like receptor-MyD88 pathway. J. Biol. Chem. 2008, 283, 30513–30521. [Google Scholar] [CrossRef] [Green Version]
- Oosthuizen, J.L.; Gomez, P.; Ruan, J.; Hackett, T.L.; Moore, M.M.; Knight, D.A.; Tebbutt, S.J. Dual organism transcriptomics of airway epithelial cells interacting with conidia of Aspergillus fumigatus. PLoS ONE 2011, 6, e20527. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bellanger, A.P.; Millon, L.; Khoufache, K.; Rivollet, D.; Bieche, I.; Laurendeau, I.; Vidaud, M.; Botterel, F.; Bretagne, S. Aspergillus fumigatus germ tube growth and not conidia ingestion induces expression of inflammatory mediator genes in the human lung epithelial cell line A549. J. Med. Microbiol. 2009, 58, 174–179. [Google Scholar] [CrossRef]
- Shin, S.H.; Lee, Y.H.; Jeon, C.H. Protease-dependent activation of nasal polyp epithelial cells by airborne fungi leads to migration of eosinophils and neutrophils. Acta Otolaryngol. 2006, 126, 1286–1294. [Google Scholar] [CrossRef]
- Neveu, W.A.; Allard, J.B.; Dienz, O.; Wargo, M.J.; Ciliberto, G.; Whittaker, L.A.; Rincon, M. IL-6 is required for airway mucus production induced by inhaled fungal allergens. J. Immunol. 2009, 183, 1732–1738. [Google Scholar] [CrossRef] [PubMed]
- Kuhn III, C.; Homer, R.J.; Zhu, Z.; Ward, N.; Flavell, R.A.; Geba, G.P.; Elias, J.A. Airway hyperresponsiveness and airway obstruction in transgenic mice. Morphologic correlates in mice overexpressing interleukin (IL)-11 and IL-6 in the lung. Am. J. Respir. Cell Mol. Biol. 2000, 22, 289–295. [Google Scholar] [CrossRef]
- Heijink, I.H.; Vellenga, E.; Borger, P.; Postma, D.S.; de Monchy, J.G.; Kauffman, H.F. Interleukin-6 promotes the production of interleukin-4 and interleukin-5 by interleukin-2-dependent and -independent mechanisms in freshly isolated human T cells. Immunology 2002, 107, 316–324. [Google Scholar] [CrossRef] [PubMed]
- Neveu, W.A.; Allard, J.L.; Raymond, D.M.; Bourassa, L.M.; Burns, S.M.; Bunn, J.Y.; Irvin, C.G.; Kaminsky, D.A.; Rincon, M. Elevation of IL-6 in the allergic asthmatic airway is independent of inflammation but associates with loss of central airway function. Respir. Res. 2010, 11, 28. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cenci, E.; Mencacci, A.; Casagrande, A.; Mosci, P.; Bistoni, F.; Romani, L. Impaired antifungal effector activity but not inflammatory cell recruitment in interleukin-6-deficient mice with invasive pulmonary aspergillosis. J. Infect. Dis. 2001, 184, 610–617. [Google Scholar] [CrossRef] [Green Version]
- Ordonez, C.L.; Shaughnessy, T.E.; Matthay, M.A.; Fahy, J.V. Increased neutrophil numbers and IL-8 levels in airway secretions in acute severe asthma: Clinical and biologic significance. Am. J. Respir. Crit. Care Med. 2000, 161, 1185–1190. [Google Scholar] [CrossRef]
- Goncalves, S.M.; Lagrou, K.; Rodrigues, C.S.; Campos, C.F.; Bernal-Martinez, L.; Rodrigues, F.; Silvestre, R.; Alcazar-Fuoli, L.; Maertens, J.A.; Cunha, C.; et al. Evaluation of Bronchoalveolar Lavage Fluid Cytokines as Biomarkers for Invasive Pulmonary Aspergillosis in At-Risk Patients. Front. Microbiol. 2017, 8, 2362. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gibson, P.G.; Wark, P.A.; Simpson, J.L.; Meldrum, C.; Meldrum, S.; Saltos, N.; Boyle, M. Induced sputum IL-8 gene expression, neutrophil influx and MMP-9 in allergic bronchopulmonary aspergillosis. Eur. Respir. J. 2003, 21, 582–588. [Google Scholar] [CrossRef] [Green Version]
- Romani, L. Immunity to fungal infections. Nat. Rev. Immunol. 2011, 11, 275–288. [Google Scholar] [CrossRef]
- Steele, C.; Rapaka, R.R.; Metz, A.; Pop, S.M.; Williams, D.L.; Gordon, S.; Kolls, J.K.; Brown, G.D. The beta-glucan receptor dectin-1 recognizes specific morphologies of Aspergillus fumigatus. PLoS Pathog 2005, 1, e42. [Google Scholar] [CrossRef] [Green Version]
- Gessner, M.A.; Werner, J.L.; Lilly, L.M.; Nelson, M.P.; Metz, A.E.; Dunaway, C.W.; Chan, Y.R.; Ouyang, W.; Brown, G.D.; Weaver, C.T.; et al. Dectin-1-dependent interleukin-22 contributes to early innate lung defense against Aspergillus fumigatus. Infect. Immun. 2012, 80, 410. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Werner, J.L.; Metz, A.E.; Horn, D.; Schoeb, T.R.; Hewitt, M.M.; Schwiebert, L.M.; Faro-Trindade, I.; Brown, G.D.; Steele, C. Requisite role for the dectin-1 beta-glucan receptor in pulmonary defense against Aspergillus fumigatus. J. Immunol. 2009, 182, 4938–4946. [Google Scholar] [CrossRef] [Green Version]
- Liu, Z.C.; Wang, M.; Sun, W.K.; Xia, D.; Tan, M.M.; Ding, Y.; Qian, Q.; Su, X.; Shi, Y. Up-regulation of Dectin-1 in airway epithelial cells promotes mice defense against invasive pulmonary aspergillosis. Int. J. Clin. Exp. Med. 2015, 8, 17489. [Google Scholar]
- Borger, P.; Koeter, G.H.; Timmerman, J.A.; Vellenga, E.; Tomee, J.F.; Kauffman, H.F. Proteases from Aspergillus fumigatus induce interleukin (IL)-6 and IL-8 production in airway epithelial cell lines by transcriptional mechanisms. J. Infect. Dis. 1999, 180, 1267–1274. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kolattukudy, P.E.; Lee, J.D.; Rogers, L.M.; Zimmerman, P.; Ceselski, S.; Fox, B.; Stein, B.; Copelan, E.A. Evidence for possible involvement of an elastolytic serine protease in aspergillosis. Infect. Immun. 1993, 61, 2357–2368. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tomee, J.F.; Wierenga, A.T.; Hiemstra, P.S.; Kauffman, H.K. Proteases from Aspergillus fumigatus induce release of proinflammatory cytokines and cell detachment in airway epithelial cell lines. J. Infect. Dis. 1997, 176, 300–303. [Google Scholar] [CrossRef] [Green Version]
- Kauffman, H.F.; Tomee, J.F.; van de Riet, M.A.; Timmerman, A.J.; Borger, P. Protease-dependent activation of epithelial cells by fungal allergens leads to morphologic changes and cytokine production. J. Allergy Clin. Immunol. 2000, 105, 1185–1193. [Google Scholar] [CrossRef]
- Balenga, N.A.; Klichinsky, M.; Xie, Z.; Chan, E.C.; Zhao, M.; Jude, J.; Laviolette, M.; Panettieri, R.A., Jr.; Druey, K.M. A fungal protease allergen provokes airway hyper-responsiveness in asthma. Nat. Commun. 2015, 6, 6763. [Google Scholar] [CrossRef] [PubMed]
- Redes, J.L.; Basu, T.; Ram-Mohan, S.; Ghosh, C.C.; Chan, E.C.; Sek, A.C.; Zhao, M.; Krishnan, R.; Rosenberg, H.F.; Druey, K.M. Aspergillus fumigatus-Secreted Alkaline Protease 1 Mediates Airways Hyperresponsiveness in Severe Asthma. Immunohorizons 2019, 3, 368–377. [Google Scholar] [CrossRef] [PubMed]
- Basu, T.; Seyedmousavi, S.; Sugui, J.A.; Balenga, N.; Zhao, M.; Kwon Chung, K.J.; Biardel, S.; Laviolette, M.; Druey, K.M. Aspergillus fumigatus alkaline protease 1 (Alp1/Asp f13) in the airways correlates with asthma severity. J. Allergy Clin. Immunol. 2018, 141, 423–425. [Google Scholar] [CrossRef] [Green Version]
- Farnell, E.; Rousseau, K.; Thornton, D.J.; Bowyer, P.; Herrick, S.E. Expression and secretion of Aspergillus fumigatus proteases are regulated in response to different protein substrates. Fungal Biol. 2012, 116, 1003–1012. [Google Scholar] [CrossRef]
- Namvar, S.; Warn, P.; Farnell, E.; Bromley, M.; Fraczek, M.; Bowyer, P.; Herrick, S. Aspergillus fumigatus proteases, Asp f 5 and Asp f 13, are essential for airway inflammation and remodelling in a murine inhalation model. Clin. Exp. Allergy 2015, 45, 982–993. [Google Scholar] [CrossRef] [PubMed]
- Millien, V.O.; Lu, W.; Shaw, J.; Yuan, X.; Mak, G.; Roberts, L.; Song, L.Z.; Knight, J.M.; Creighton, C.J.; Luong, A.; et al. Cleavage of fibrinogen by proteinases elicits allergic responses through Toll-like receptor 4. Science 2013, 341, 792–796. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Griffiths, J.S.; Thompson, A.; Stott, M.; Benny, A.; Lewis, N.A.; Taylor, P.R.; Forton, J.; Herrick, S.; Orr, S.J.; McGreal, E.P. Differential susceptibility of Dectin-1 isoforms to functional inactivation by neutrophil and fungal proteases. FASEB J. 2018, 32, 3385–3397. [Google Scholar] [CrossRef] [Green Version]
- Cozens, A.L.; Yezzi, M.J.; Kunzelmann, K.; Ohrui, T.; Chin, L.; Eng, K.; Finkbeiner, W.E.; Widdicombe, J.H.; Gruenert, D.C. CFTR expression and chloride secretion in polarized immortal human bronchial epithelial cells. Am. J. Respir. Cell Mol. Biol. 1994, 10, 38–47. [Google Scholar] [CrossRef]
- Markaryan, A.; Morozova, I.; Yu, H.; Kolattukudy, P.E. Purification and characterization of an elastinolytic metalloprotease from Aspergillus fumigatus and immunoelectron microscopic evidence of secretion of this enzyme by the fungus invading the murine lung. Infect. Immun. 1994, 62, 2149–2157. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Monod, M.; Paris, S.; Sanglard, D.; Jaton-Ogay, K.; Bille, J.; Latge, J.P. Isolation and characterization of a secreted metalloprotease of Aspergillus fumigatus. Infect. Immun. 1993, 61, 4099–4104. [Google Scholar] [CrossRef] [Green Version]
- Futai, E.; Kubo, T.; Sorimachi, H.; Suzuki, K.; Maeda, T. Molecular cloning of PalBH, a mammalian homologue of the Aspergillus atypical calpain PalB. Biochim. Biophys. Acta 2001, 1517, 316–319. [Google Scholar] [CrossRef]
- Nierman, W.C.; Pain, A.; Anderson, M.J.; Wortman, J.R.; Kim, H.S.; Arroyo, J.; Berriman, M.; Abe, K.; Archer, D.B.; Bermejo, C.; et al. Genomic sequence of the pathogenic and allergenic filamentous fungus Aspergillus fumigatus. Nature 2005, 438, 1151–1156. [Google Scholar] [CrossRef]
- Neustadt, M.; Costina, V.; Kupfahl, C.; Buchheidt, D.; Eckerskorn, C.; Neumaier, M.; Findeisen, P. Characterization and identification of proteases secreted by Aspergillus fumigatus using free flow electrophoresis and MS. Electrophoresis 2009, 30, 2142–2150. [Google Scholar] [CrossRef]
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rowley, J.; Namvar, S.; Gago, S.; Labram, B.; Bowyer, P.; Richardson, M.D.; Herrick, S.E. Differential Proinflammatory Responses to Aspergillus fumigatus by Airway Epithelial Cells In Vitro Are Protease Dependent. J. Fungi 2021, 7, 468. https://doi.org/10.3390/jof7060468
Rowley J, Namvar S, Gago S, Labram B, Bowyer P, Richardson MD, Herrick SE. Differential Proinflammatory Responses to Aspergillus fumigatus by Airway Epithelial Cells In Vitro Are Protease Dependent. Journal of Fungi. 2021; 7(6):468. https://doi.org/10.3390/jof7060468
Chicago/Turabian StyleRowley, Jessica, Sara Namvar, Sara Gago, Briony Labram, Paul Bowyer, Malcolm D. Richardson, and Sarah E. Herrick. 2021. "Differential Proinflammatory Responses to Aspergillus fumigatus by Airway Epithelial Cells In Vitro Are Protease Dependent" Journal of Fungi 7, no. 6: 468. https://doi.org/10.3390/jof7060468