In Silico Study Suggesting the Bias of Primers Choice in the Molecular Identification of Fungal Aerosols
Abstract
1. Introduction
2. Methods
2.1. UNITE Dataset
2.2. In Silico Amplification
2.3. Fungal Bioaerosol Data
3. Results
3.1. Amplicon Length
3.2. Representative Sequences of ITS1 and ITS2 in UNITE
3.3. Taxonomic Bias of Primer Choice
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Fröhlich-Nowoisky, J.; Kampf, C.J.; Weber, B.; Huffman, J.A.; Pöhlker, C.; Andreae, M.O.; Lang-Yona, N.; Burrows, S.M.; Gunthe, S.S.; Elbert, W.; et al. Bioaerosols in the earth system: Climate, health and ecosystem interactions. Atmos. Res. 2016, 182, 346–376. [Google Scholar] [CrossRef]
- Yoo, K.; Lee, T.K.; Choi, E.J.; Yang, J.; Shukla, S.K.; Hwang, S.I.; Park, J. Molecular approaches for the detection and monitoring of microbial communities in bioaerosols: A review. J. Environ. Sci. 2017, 51, 234–247. [Google Scholar] [CrossRef]
- Hawksworth, D.L.; Lücking, R. Fungal diversity revisited: 2.2 to 3.8 million species. Microbiol. Spectr. 2017, 5, 28752818. [Google Scholar] [CrossRef]
- Fröhlich-Nowoisky, J.; Pickersgill, D.A.; Després, V.R.; Pöschl, U. High diversity of fungi in air particulate matter. PNAS 2009, 106, 12814–12819. [Google Scholar] [CrossRef]
- Fabian, M.P.; Miller, S.L.; Reponen, T.; Hernanadez, M. Ambient bioaerosol indices for indoor air quality assessments in flood reclamation. J. Aerosol Sci. 2005, 36, 763–783. [Google Scholar] [CrossRef]
- Mbareche, H.; Veillette, M.; Bonifait, L.; Dubuis, M.E.; Bernard, Y.; Marchand, G.; Bilodeau, G.J.; Duchaine, C. A next generation sequencing approach with a suitable bioinformatics workflow to study fungal diversity in bioaerosols released from two different types of composting plants. Sci. Total Environ. 2017, 601–602, 1306–1314. [Google Scholar] [CrossRef]
- Mbareche, H.; Veillette, M.; Dubuis, M.È.; Bakhiyi, B.; Marchand, G.; Zayed, J.; Lavoie, J.; Bilodeau, G.J.; Duchaine, C. Fungal bioaerosols in biomethanization facilities. J. Air Waste Manag. Assoc. 2018, 68, 1198–1210. [Google Scholar] [CrossRef] [PubMed]
- Mbareche, H.; Veillette, M.; Bilodeau, G.J.; Duchaine, C. Comparison of the performance of ITS1 and ITS2 as barcodes in amplicon-based sequencing of bioaerosols. PeerJ 2020, 8, e8523. [Google Scholar] [CrossRef] [PubMed]
- Nilsson, R.H.; Ryberg, M.; Abarenkov, K.; Sjökvist, E.; Kristiansson, E. The ITS region as a target for characterization of fungal communities using emerging sequencing technologies. FEMS Microbiol. Lett. 2009, 296, 97–101. [Google Scholar] [CrossRef] [PubMed]
- Bellemain, E.; Carlsen, T.; Brochmann, C.; Coissac, E.; Taberlet, P.; Kauserud, H. ITS as an environmental DNA barcode for fungi: An in silico approach reveals potential PCR biases. BMC Microbiol. 2010, 10, 189. [Google Scholar] [CrossRef] [PubMed]
- Toju, H.; Tanabe, A.S.; Yamamoto, S.; Sato, H. High-Coverage ITS primers for the DNA-based identification of ascomycetes and basidiomycetes in environmental samples. PLoS ONE 2012, 7, e40863. [Google Scholar] [CrossRef] [PubMed]
- Nilsson, R.H.; Larsson, K.H.; Taylor, A.F.S.; Bengtsson-Palme, J.; Jeppesen, T.S.; Schigel, D.; Kennedy, P.; Picard, K.; Glöckner, F.O.; Tedersoo, L.; et al. The UNITE database for molecular identification of fungi: Handling dark taxa and parallel taxonomic classifications. Nucleic Acids Res. 2019, 47, D259–D264. [Google Scholar] [CrossRef] [PubMed]
- Tedersoo, L.; Anslan, S.; Bahram, M.; Polme, S.; Riit, T.; Liiv, I.; Koljalg, U.; Kisand, V.; Nilsson, R.H.; Hildebrand, F.; et al. Shotgun metagenomes and multiple primer pair-barcode combinations of amplicons reveal biases in metabarcoding analyses of fungi. MycoKeys 2015, 10, 1–43. [Google Scholar] [CrossRef]
- Shagin, D.A.; Lukyanov, K.A.; Vagner, L.L.; Matz, M.V. Regulation of average length of complex PCR product. Nucleic Acids Res. 1999, 27, e23-i–e23-iii. [Google Scholar] [CrossRef]
- Nilsson, R.H.; Anslan, S.; Bahram, M.; Wurzbacher, C.; Baldrian, P.; Tedersoo, L. Mycobiome diversity: High-throughput sequencing and identification of fungi. Nat. Rev. Microbiol. 2019, 17, 95–109. [Google Scholar] [CrossRef]
- Bengtsson-Palme, J.; Ryberg, M.; Hartmann, M.; Branco, S.; Wang, Z.; Godhe, A.; De Wit, P.; Sànchez-Garcìa, M.; Ebersberger, I.; de Sousa, F.; et al. Improved software detection and extraction of ITS1 and ITS2 from ribosomal ITS sequences of fungi and other eukaryotes for analyses of environmental sequencing data. Methods Ecol. Evol. 2013, 4, 37–63. [Google Scholar] [CrossRef]
- Ficetola, G.F.; Coissac, E.; Zundel, S.; Riaz, T.; Shehzad, W.; Bessière, J.; Taberlet, P.; Pompanon, F. An in silico approach for the evaluation of DNA barcodes. BMC Genom. 2010, 11, 434. [Google Scholar] [CrossRef]
- Cruz, D.; Suárez, J.P.; Kottke, I.; Piepenbring, M.; Oberwinkler, F. Defining species in Tulasnella by correlating morphology and nrDNA ITS-5.8S sequence data of basidiomata from a tropical Andean forest. Mycol. Prog. 2011, 10, 229–238. [Google Scholar] [CrossRef]
- Schoch, C.L.; Seifert, K.A.; Huhndorf, S.; Robert, V.; Spouge, J.L.; Levesque, C.A.; Chen, W. Fungal barcoding consortium: Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proc. Natl. Acad. Sci. USA 2012, 109, 6241–6246. [Google Scholar] [CrossRef]
- Op De Beeck, M.; Lievens, B.; Busschaert, P.; Declerck, S.; Vangronsveld, J.; Colpaert, J. Comparison and validation of some ITS primer pairs useful for fungal metabarcoding studies. PLoS ONE 2014, 9, e97629. [Google Scholar] [CrossRef]
- Kõljalg, U.; Nilsson, R.H.; Abarenkov, K.; Tedersoo, L.; Taylor, A.F.S.; Bahram, M.; Bates, S.T.; Bruns, T.D.; Bengtsson-Palme, J.; Callaghan, T.M.; et al. Towards a unified paradigm for sequence-based identification of fungi. Mol. Ecol. 2013, 22, 5271–5277. [Google Scholar] [CrossRef] [PubMed]
- Rychlik, W.; Spencer, W.J.; Rhoads, R.E. Optimization of the annealing temperature for DNA amplification In Vitro. Nucleic Acids Res. 1990, 18, 6409–6412. [Google Scholar] [CrossRef] [PubMed]
- Bazzicalupo, A.L.; Bálint, M.; Schmitt, I. Comparison of ITS1 and ITS2 rDNA in 454 sequencing of hyperdiverse fungal communities. Fungal Ecol. 2013, 6, 102–109. [Google Scholar] [CrossRef]
- Martin, K.J.; Rygiewicz, P.T. Fungal-specific PCR primers developed for analysis of the ITS region of environmental DNA extracts. BMC Microbiol. 2005, 5, 28. [Google Scholar] [CrossRef] [PubMed]
- Mello, A.; Napoli, C.; Murat, C.; Morin, E.; Marceddu, G.; Bonfante, P. ITS-1 versus ITS-2 pyrosequencing: A comparison of fungal populations in truffle grounds. Mycologia 2011, 103, 1184–1193. [Google Scholar] [CrossRef]
- Kohout, P.; Sudová, R.; Janoušková, M.; Čtvrtlíková, M.; Hejda, M.; Pánková, H.; Slavíková, R.; Štajerová, K.; Vosátka, M.; Sýkorová, Z. Comparison of commonly used primer sets for evaluating arbuscular mycorrhizal fungal communities: Is there a universal solution? Soil Biol. Biochem. 2014, 68, 482–493. [Google Scholar] [CrossRef]



| Primers Name | Features | Sequence | Barcode | 
|---|---|---|---|
| ITS1Fngs | Fwd | ACACTCTTTCCCTACACGACGCTCTTCCGATCTGGTCATTTAGAGGAAGTAA | ITS1 | 
| ITS2 | Rev | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGCTGCGTTCTTCATCGATGC | ITS1 | 
| ITS3tagmix1-5 | Fwd | ACACTCTTTCCCTACACGACGCTCTTCCGATCTTAGACTCGTCATCGATGAAGAACGCAG | ITS2 | 
| ITS4ngs | Rev | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTTCCTSCGCTTATTGATATGC | ITS2 | 
| Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. | 
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mbareche, H.; Veillette, M.; Bilodeau, G.J. In Silico Study Suggesting the Bias of Primers Choice in the Molecular Identification of Fungal Aerosols. J. Fungi 2021, 7, 99. https://doi.org/10.3390/jof7020099
Mbareche H, Veillette M, Bilodeau GJ. In Silico Study Suggesting the Bias of Primers Choice in the Molecular Identification of Fungal Aerosols. Journal of Fungi. 2021; 7(2):99. https://doi.org/10.3390/jof7020099
Chicago/Turabian StyleMbareche, Hamza, Marc Veillette, and Guillaume J. Bilodeau. 2021. "In Silico Study Suggesting the Bias of Primers Choice in the Molecular Identification of Fungal Aerosols" Journal of Fungi 7, no. 2: 99. https://doi.org/10.3390/jof7020099
APA StyleMbareche, H., Veillette, M., & Bilodeau, G. J. (2021). In Silico Study Suggesting the Bias of Primers Choice in the Molecular Identification of Fungal Aerosols. Journal of Fungi, 7(2), 99. https://doi.org/10.3390/jof7020099
 
         
                                                


 
       