Alternatives in Molecular Diagnostics of Encephalitozoon and Enterocytozoon Infections
Abstract
:1. Introduction
2. Microscopic, Serological and Immunological Diagnosis of Encephalitozoon spp. and Enterocytozoon bieneusi
3. Sample Processing and DNA Extraction
4. Diagnostic Methods Based on Nucleic Acid Analysis
5. MLST (Multilocus Sequence Typing)
6. Diagnostic Procedures—Recommendation
7. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Hinney, B.; Sak, B.; Joachim, A.; Kvac, M. More than a rabbit’s tale—Encephalitozoon spp. in wild mammals and birds. Int. J. Parasitol. Parasites Wildl. 2016, 5, 76–87. [Google Scholar] [CrossRef] [Green Version]
- Stentiford, G.D.; Bass, D.; Williams, B.A.P. Ultimate opportunists-The emergent Enterocytozoon group Microsporidia. PLoS Pathog. 2019, 15, e1007668. [Google Scholar] [CrossRef] [PubMed]
- Keeling, P.J.; Fast, N.M. Microsporidia: Biology and Evolution of Highly Reduced Intracellular Parasites. Annu. Rev. Microbiol. 2002, 56, 93–116. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Han, B.; Weiss, L.M. Microsporidia: Obligate intracellular pathogens within the fungal kingdom. Microbiol. Spectr. 2017, 5. [Google Scholar] [CrossRef] [Green Version]
- Stentiford, G.D.; Becnel, J.; Weiss, L.M.; Keeling, P.J.; Didier, E.S.; Williams, B.P.; Bjornson, S.; Kent, M.L.; Freeman, M.A.; Brown, M.J.F.; et al. Microsporidia–emergent pathogens in the global food chain. Trends Parasitol. 2016, 32, 336–348. [Google Scholar] [CrossRef] [Green Version]
- Henriques-Gil, N.; Haro, M.; Izquierdo, F.; Fenoy, S.; del Aguila, C. Phylogenetic approach to the variability of the microsporidian Enterocytozoon bieneusi and its implications for inter- and intrahost transmission. Appl. Environ. Microbiol. 2010, 76, 3333–3342. [Google Scholar] [CrossRef] [Green Version]
- Stentiford, G.D.; Feist, S.W.; Stone, D.M.; Bateman, K.S.; Dunn, A.M. Microsporidia: Diverse, dynamic, and emergent pathogens in aquatic systems. Trends Parasitol. 2013, 29, 567–578. [Google Scholar] [CrossRef]
- Zeman, D.H.; Baskin, G.B. Encephalitozoonosis in squirrel monkeys (Saimiri sciureus). Vet. Pathol. 1985, 22, 24–31. [Google Scholar] [CrossRef] [Green Version]
- Mc Innes, E.F.; Stewart, C.G. The pathology of subclinical infection of Encephalitozoon cuniculi in canine dams’ production of pups with over encephalitozoonosis. Tydskr. S. Afr. Vet. Ver. 1991, 62, 51–54. [Google Scholar] [CrossRef]
- Vávra, J.; Dahbiová, R.; Hollister, W.S.; Canning, E.U. Staining of microsporidian spores by optical brighteners with remarks on the use of brighteners for the diagnosis of AIDS associated human microsporidioses. Folia Parasitol. 1993, 40, 267–272. [Google Scholar]
- Dowd, S.E.; John, D.; Eliopolus, J.; Gerba, C.P.; Naranjo, J.; Klein, R.; López, B.; de Mejía, M.; Mendoza, C.E.; Pepper, I.L. Confirmed detection of Cyclospora cayetanesis, Encephalitozoon intestinalis and Cryptosporidium parvum in water used for drinking. J. Water Health 2003, 1, 117–123. [Google Scholar] [CrossRef] [PubMed]
- Fournier, S.; Dubrou, S.; Liguory, O.; Gaussin, F.; Santillana-Hayat, M.; Sarfati, C.; Molina, J.M.; Derouin, F. Detection of Microsporidia, cryptosporidia and Giardia in swimming pools: A one-year prospective study. FEMS Immunol. Med. Microbiol. 2002, 33, 209–213. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ardila-Garcia, A.M.; Raghuram, N.; Sihota, P.; Fast, N.M. Microsporidian diversity in soil, sand, and compost of the Pacific Northwest. J. Eukaryot. Microbiol. 2013, 60, 601–608. [Google Scholar] [CrossRef] [PubMed]
- Williams, B.A.P.; Hamilton, K.M.; Jones, M.D.; Bass, D. Group-specific environmental sequencing reveals high levels of ecological heterogeneity across the microsporidian radiation. Environ. Microbiol. Rep. 2018, 10, 328–336. [Google Scholar] [CrossRef]
- Cotte, L.; Rabodonirina, M.; Chapuis, F.; Bailly, F.; Bissuel, F.; Raynal, C.; Gelas, P.; Persat, F.; Piens, M.A.; Trepo, C. Waterborne outbreak of intestinal microsporidiosis in persons with and without human immunodeficiency virus infection. J. Infect. Dis. 1999, 180, 2003–2008. [Google Scholar] [CrossRef] [Green Version]
- Sivapalasingam, S.; Friedman, C.R.; Cohen, L.; Tauxe, R.V. Fresh produce: A growing cause of outbreaks of foodborne illness in the United States, 1973 through 1997. J. Food Prot. 2004, 67, 2342–2353. [Google Scholar] [CrossRef]
- Jedrzejewski, S.; Graczyk, T.K.; Slodkowicz-Kowalska, A.; Tamang, L.; Majewska, A.C. Quantitative assessment of contamination of fresh food produce of various retail types by human-virulent microsporidian spores. Appl. Environ. Microbiol. 2007, 73, 4071–4073. [Google Scholar] [CrossRef] [Green Version]
- Valencáková, A.; Halánová, M.; Bálent, P.; Dvoroznáková, E.; Jamborová, E.; Lesník, F.; Neuschl, J.; Páleník, L.; Cisláková, L. Immune response in mice infected by Encephalitozoon cuniculi and suppressed by dexamethasone. Acta. Vet. Hung. 2004, 52, 61–69. [Google Scholar] [CrossRef]
- Valenčáková, A.; Revajová, V.; Bálent, P.; Levkut, M. Immunosuppressive effect of Encephalitozoon cuniculi. Bull. Vet. Inst. Pulawy 2003, 47, 113–120. [Google Scholar]
- Valencakova, A.; Halanova, A. Immune response to Encephalitozoon infection. Comp. Immunol. Microbiol. Infect. Dis. 2002, 35, 1–7. [Google Scholar] [CrossRef]
- Orenstein, J.M. Diagnostic pathology of microsporidiosis. Ultrastruct. Pathol. 2003, 27, 141–149. [Google Scholar] [CrossRef]
- Halánová, M.; Valenčáková, A.; Malčeková, B.; Kváč, M.; Sak, B.; Květoňová, D.; Bálent, P.; Čisláková, L. Occurrence of microsporidia as emerging pathogens in Slovak roma children and their impact for public health. AAEM 2013, 20, 814–817. [Google Scholar]
- Ladapo, T.A.; Nourse, P.; Pillay, K.; Frean, J.; Birkhead, M.; Poonsamy, B.; Gajjar, P. Microsporidiosis in pediatric renal transplant patients in Cape Town, South Africa: Two case reports. Pediatr. Transplant. 2014, 7, E220–E226. [Google Scholar] [CrossRef] [PubMed]
- Halánová, M.; Valenčáková, A.; Jarčuška, P.; Halán, M.; Danišová, O.; Babinská, I.; Dedinská, K.; Čisláková, L. Screening of opportunistic Encephalitozoon intestinalis and Enterocytozoon bieneusi in immunocompromised patients in Slovakia. Cent. Eur. J. Public. Health. 2019, 27, 330–334. [Google Scholar] [CrossRef] [PubMed]
- Wesołowska, M.; Szetela, B.; Kicia, M.; Kopacz, Ż.; Sak, B.; Rymer, W.; Kváč, M.; Sałamatin, R. Dual infection of urinary tract with Enterocytozoon bieneusi and Encephalitozoon cuniculi in HIV/AIDS patients. Ann. Parasitol. 2019, 65, 77–81. [Google Scholar]
- Karimi, K.; Mirjalali, H.; Niyyati, M.; Haghighi, A.; Pourhoseingholi, M.A.; Sharifdini, M.; Naderi, N.; Zali, M.R. Molecular epidemiology of Enterocytozoon bieneusi and Encephalitozoon sp., among immunocompromised and immunocompetent subjects in Iran. Microb. Pathog. 2020, 21, 103988. [Google Scholar] [CrossRef]
- Valenčáková, A.; Bálent, P.; Húska, M.; Novotný, F.; Luptáková, L. First case report of infections caused by Encephalitozoon intestinalis in swine in Europe. Acta Vet. Hung. 2006, 54, 407–411. [Google Scholar] [CrossRef]
- Valenčáková, A.; Bálent, P.; Ravaszová, P.; Horák, A.; Oborník, M.; Halánová, M.; Malčeková, B.; Novotný, F.; Goldová, M. Molecular identification and genotyping of Microsporidia in selected hosts. Parasitol. Res. 2012, 110, 689–693. [Google Scholar] [CrossRef]
- Valenčáková, A.; Danišová, O. Molecular characterization of new genotypes Enterocytozoon bieneusi in Slovakia. Acta Tropica 2019, 191, 217–220. [Google Scholar] [CrossRef]
- Prasertbun, R.; Mori, H.; Sukthana, Y.; Popruk, S.; Kusolsuk, T.; Hagiwara, K.; Mahittikorn, A. Enterocytozoon bieneusi and Cryptosporidium: A cross-sectional study conducted throughout Thailand. BMC Infect. Dis. 2019, 14, 808. [Google Scholar] [CrossRef] [Green Version]
- Valenčáková, A.; Bálent, P.; Petrovová, E.; Novotný, F.; Luptáková, L. Encephalitozoonosis in the Breed Nederland Dwarf of Oryctolagus cuniculus keeping in households. Vet. Parasitol. 2008, 153, 265–269. [Google Scholar] [CrossRef] [PubMed]
- Zietek, J.; Adaszek, Ł.; Dziegiel, B.; Kalinowski, M.; Bartnicki, M.; Kalinowska, A.; Jarosz, Ł.; Winiarczyk, S. Diagnosis of the Encephalitozoon cuniculi infections in pet rabbits with neurological symptoms. Pol. J. Vet. Sci. 2014, 17, 361–363. [Google Scholar] [CrossRef] [Green Version]
- Deng, L.; Li, W.; Zhong, Z.; Chai, Y.; Yang, L.; Zheng, H.; Wang, W.; Fu, H.; He, M.; Huang, X.; et al. Molecular characterization and new genotypes of Enterocytozoon bieneusi in pet chipmunks (Eutamias asiaticus) in Sichuan province, China. BMC Microbiol. 2018, 18, 37. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Malčeková, B.; Valenčáková, A.; Luptáková, L.; Molnár, L.; Ravaszová, P.; Novotný, F. First detection and genotyping of Encephalitozoon cuniculi in a new host species, gyrfalcon (Falco rusticolus). Parasitol. Res. 2011, 108, 1479–1482. [Google Scholar] [CrossRef] [PubMed]
- Malčeková, B.; Valenčáková, A.; Molnár, L.; Kočišová, A. First detection and genotyping of human-associated microsporidia in wild waterfowl of Slovakia. Acta Parasitol. 2013, 58, 13–17. [Google Scholar] [CrossRef] [Green Version]
- Danisova, O.; Valencakova, A.; Stanko, M.; Luptákova, L.; Hasajova, A. First report of Enterocytozoon bieneusi and Encephalitozoon intestinalis infection of wild mice in Slovakia. AAEM 2015, 22, 250–251. [Google Scholar]
- Amer, S.; Kim, S.; Han, J.I.; Na, K.J. Prevalence and genotypes of Enterocytozoon bieneusi in wildlife in Korea: A public health concern. Parasit. Vectors. 2019, 8, 160. [Google Scholar] [CrossRef]
- Weber, R.; Bryan, R.T.; Owen, R.L.; Wilcox, C.M.; Gorelkin, L.; Visvesvara, G.S. Improved light-microscopical detection of microsporidia spores in stool and duodenal aspirates. The Enteric Opportunistic Infections Working Group. N. Engl. J. Med. 1992, 326, 161–166. [Google Scholar] [CrossRef]
- Thellier, M.; Accoceberry, I.; Desportes, I.; Biligui, S.; Bart-Delabesse, E.; Ripert, C.; Danis, M.; Datry, A. First United Workshop on Microsporidia from Invertebrate and Vertebreate Hosts (NATO). Folia Parasitol. 2005, 52, 1–7. [Google Scholar]
- Halánová, M.; Čisláková, L.; Valenčáková, A.; Bálent, P.; Adam, J.; Trávniček, M. Serological screening of occurrence of antibodies to Encephalitozoon cuniculi in humans and animals in eastern Slovakia. AAEM 2003, 10, 117–120. [Google Scholar]
- Adam, J.; Valencakova, A.; Halanova, M.; Danisova, O.; Gorbarova, K.; Cislakova, L. Serological screening of selected microsporidia in HPV-positive women. Acta Parasitol. 2015, 60, 50–53. [Google Scholar] [CrossRef] [PubMed]
- Didier, E.S.; Rogers, L.B.; Brush, A.D.; Wong, S.; Traina-Dorge, V.; Bertucci, D. Diagnosis of disseminated microsporidian Encephalitozoon hellem infection by PCR-Southern analysis and successful treatment with albendazole and fumagillin. J. Clin. Microbiol. 1996, 34, 947–952. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Valencakova, A.; Bálent, P.; Novotný, F.; Cislakova, L. Application of specific primers in the diagnosis of Encephalitozoon spp. AAEM 2005, 12, 321–323. [Google Scholar] [PubMed]
- Fedorko, D.P.; Hijazi, Y.M. Application of molecular techniques to the diagnosis of microsporidial infection. Emerg. Infect. Dis. 1996, 2, 183–191. [Google Scholar] [CrossRef]
- Raynaud, L.; Delbac, F.; Broussolle, V.; Rabodonirina, M.; Girault, V.; Wallon, M.; Cozon, G.; Vivares, C.P.; Peyron, F. Identification of Encephalitozoon intestinalis in travelers with chronic diarrhea by specific PCR amplification. J. Clin. Microbiol. 1998, 36, 37–40. [Google Scholar] [CrossRef] [Green Version]
- Ausuhel, E.M.; Brent, R.; Kingston, R.E.; Moore, D.D.; Smith, J.A.; Seidman, J.; Struhl, K. Current Protocols in Molecular Biology; John Wiley & Sons: New York, NY, USA, 1997. [Google Scholar]
- Innis, M.A.; Gelfand, D.H.; Sninsky, J.J.; White, T.J. PCR Protocols: A Guide to Methods and Applications; Academic Press: San Diego, CA, USA, 1990. [Google Scholar]
- Hylis, M.; Weiser, J.; Obornik, M.; Vavra, J. DNA isolation from museum and type collection slides of microsporidia. J. Inverteb. Pathol. 2005, 88, 257–260. [Google Scholar] [CrossRef]
- Katzwinkel-Wladarsch, S.; Lieb, M.; Helse, W.; Löscher, T.; Rinder, H. Direct amplification and species determination of microsporidian DNA from stool specimens. Trop. Med. Int. Health. 1996, 1, 373–378. [Google Scholar] [CrossRef]
- Liguory, O.; David, F.; Sarfati, C.; Schuitema, A.R.J.; Hartskeerl, R.A.; Derouin, F.; Modai, J.; Molina, J.M. Diagnosis of infections caused by Enterocytozoon bieneusi and Encephalitozoon intestinalis using polymerase chain reaction in stool specimens. AIDS 1997, 11, 723–726. [Google Scholar] [CrossRef]
- Ombrouck, C.; Ciceron, L.; Biligui, S.; Brown, S.; Marechal, P.; Van Gool, T.; Datry, A.; Danis, M.; Desportes-Livage, I. Specific PCR assay for direct detection of intestinal microsporidia Enterocytozoon bieneusi and Encephalitozoon intestinalis in fecal specimens from human immunodeficiency virus-infected patients. J. Clin. Microbiol. 1997, 35, 652–655. [Google Scholar] [CrossRef] [Green Version]
- Subrungruan, I.; Mungthi, M.; Chavalitshewinkoon-Petmit, P.; Rangsi, R.; Naaglor, T.; Leelayoova, S. Evaluation of DNA extraction and PCR methods for detection of Enterocytozoon bienuesi in stool specimens. J. Clin. Microbiol. 2004, 42, 3490–3494. [Google Scholar] [CrossRef] [Green Version]
- Yang, S.; Rothman, R.E. PCR-based diagnostics for infectious diseases: Uses, limitations, and future applications in acute-care settings. Lancet Infect. Dis. 2004, 4, 337–348. [Google Scholar] [CrossRef]
- Mittleider, D.; Green, L.C.; Mann, V.H.; Michael, S.F.; Didier, E.S.; Brindley, P.J. Sequence survey of the genome of the opportunistic microsporidian pathogen, Vittaforma corneae. J. Eukaryot. Microbiol. 2002, 49, 393–401. [Google Scholar] [CrossRef] [PubMed]
- Vossbrinck, C.R.; Maddox, J.V.; Friedman, S.; Debrunner-Vossbrinck, B.A.; Woese, C.R. Ribosomal RNA sequence suggests microsporidia are extremely ancient eukaryotes. Nature 1987, 326, 411–414. [Google Scholar] [CrossRef] [PubMed]
- Visvesvara, G.S.; Leitch, G.J.; da Silva, A.J.; Croppo, G.P.; Moura, H.; Wallace, S.; Slemenda, S.B.; Schwartz, D.A.; Moss, D.; Bryan, R.T.; et al. Polyclonal and monoclonal antibody and PCR-amplified small subunit rRNA identification of a microsporidian, Encephalitozoon hellem, isolated from an AIDS patient with disseminated infection. J. Clin. Microbiol. 1994, 32, 2760–2768. [Google Scholar] [CrossRef] [Green Version]
- Zhu, X.; Wittner, M.; Tanowitz, H.B.; Cali, A.; Weiss, L.M. Nucleotide sequence of the small subunit rRNA of Septata intestinalis. Nucleic Acids Res. 1993, 21, 4846. [Google Scholar] [CrossRef] [Green Version]
- Zhu, X.; Wittner, M.; Tanowitz, H.B.; Kotler, D.; Cali, A.; Weiss, L.M. Small subunit rRNA sequence of Enterocytozoon bieneusi and its potential diagnostic role with use of the polymerase chain reaction. J. Infect. Dis. 1993, 168, 1570–1575. [Google Scholar] [CrossRef]
- Zhu, X.; Wittner, M.; Tanowitz, H.B.; Cali, A.; Weiss, L.M. Ribosomal RNA sequences of Enterocytozoon bieneusi, Septata intestinalis and Ameson michaelis: Phylogenetic construction and structural correspondence. J. Eukaryot. Microbiol. 1994, 41, 204–209. [Google Scholar] [CrossRef]
- Weiss, L.M.; Zhu, X.; Cali, A.; Tanowitz, H.B.; Wittner, M. Utility of microsporidian rRNA in diagnosis and phylogeny: A review. Folia Parasitol. 1994, 41, 81–90. [Google Scholar]
- Visvesvara, G.S.; da Silva, A.J.; Croppo, G.P.; Pieniazek, N.J.; Leitch, G.J.; Ferguson, D.; de Moura, H.; Wallace, S.; Slemenda, S.B.; Tyrrell, I.; et al. In vitro culture and serologic and molecular identification of Septata intestinalis isolated from urine of a patient with AIDS. J. Clin. Microbiol. 1995, 33, 930–936. [Google Scholar] [CrossRef] [Green Version]
- Delbac, F.; Peyret, P.; Méténier, G.; David, D.; Danchin, A.; Vivarès, C.P. On proteins of the microsporidian invasive apparatus: Complete sequence of a polar tube protein of Encephalitozoon cuniculi. Mol. Microbiol. 1998, 29, 825–834. [Google Scholar] [CrossRef] [Green Version]
- Katzwinkel-Wladarsch, S.; Deplazes, P.; Weber, R.; Löscher, T.; Rinder, H. Comparison of polymerase chain reaction with light microscopy for detection of microsporidia in clinical specimens. Eur. J. Clin. Microbiol. Infect. Dis. 1997, 16, 7–10. [Google Scholar] [CrossRef] [PubMed]
- Özkoç, S.; Bayram Delibaş, S.; Akısü, Ç. Evaluation of pulmonary microsporidiosis in iatrogenically immunosuppressed patients. Tuberk. Toraks 2016, 64, 9–16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rosell, J.; Máinez, M.; Didier, E.S.; Bowers, L.C.; Marco, A.; Juan-Sallés, C. Encephalitozoon hellem infection in aviary passerine and psittacine birds in Spain. Vet. Parasitol. 2016, 30, 57–60. [Google Scholar] [CrossRef] [PubMed]
- Malčeková, B.; Valenčáková, A.; Luptáková, L.; Ravaszová, P.; Halánová, M. Genotyping of medically important species of microsporidia and their geographic distribution. Folia Vet. 2010, 54, 154–166. [Google Scholar]
- Visvesvara, G.S.; Moura, H.; Leitch, G.J.; Schwartz, D.A. Culture and propagation of microsporidia. In Microsporidia and Microsporidiosis; Wittner, M., Ed.; ASM Press: Washington, DC, USA, 1999; pp. 363–392. [Google Scholar]
- Kock, N.P.; Petersen, H.; Fenner, T.; Sobottka, I.; Schmetzm, C.; Deplazes, P.; Pieniazek, N.J.; Albrecht, H.; Schottelius, J. Species-specific identification of microsporidia in stool and intestinal biopsy specimens by the polymerase chain reaction. Eur. J. Clin. Microbiol. Infect. Dis. 1997, 16, 369–376. [Google Scholar] [CrossRef]
- Mirjalali, H.; Mohebali, M.; Mirhendi, H.; Gholami, R.; Keshavarz, H.; Meamar, A.R.; Rezaeian, M. Emerging Intestinal Microsporidia Infection in HIV(+)/AIDS Patients in Iran: Microscopic and Molecular Detection. Iran. J. Parasitol. 2014, 9, 149–154. [Google Scholar]
- Coyle, C.M.; Wittner, M.; Kotler, D.P.; Noyer, C.; Orenstein, J.M.; Tanowitz, H.B.; Weiss, L.M. Prevalence of microsporidiosis due to Enterocytozoon bieneusi and Encephalitozoon (Septata) intestinalis among patients with AIDS-related diarrhea: Determination by polymerase chain reaction to the microsporidian small-subunit rRNA gene. Clin. Infect. Dis. 1996, 23, 1002–1006. [Google Scholar] [CrossRef]
- Carville, A.; Mansfield, K.; Widmer, G.; Lackner, A.; Kotler, D.; Wiest, P.; Gumbo, T.; Sarbah, S.; Tzipori, S. Development and application of genetic probes for detection of Enterocytozoon bieneusi in formalin-fixed stools and in intestinal biopsy specimens from infected patients. Clin. Diagn. Lab. Immunol. 1997, 4, 405–408. [Google Scholar] [CrossRef] [Green Version]
- Mansfield, K.G.; Carville, A.; Shvetz, D.; MacKey, J.; Tzipori, S.; Lackner, A. Identification of an Enterocytozoon bieneusi-like microsporidian parasite in simian-immunodeficiency-virus-inoculated macaques with hepatobiliary disease. Am. J. Pathol. 1997, 150, 1395–1405. [Google Scholar]
- Velasquez, J.N.; Carnevale, S.; Guarnera, E.A.; Labbé, J.H.; Chertcoff, A.; Cabrera, M.G.; Rodríguez, M.I. Detection of the microsporidian parasite Enterocytozoon bieneusi in specimens from patients with AIDS by PCR. J. Clin. Microbiol. 1996, 34, 3230–3232. [Google Scholar] [CrossRef] [Green Version]
- David, F.; Schuitema, A.R.J.; Sarfati, C. Detection and species identification of intestinal microsporidia by polymerase chain reaction in duodenal biopsies from human immunodeficiency virus-infected patients. J. Infect. Dis. 1996, 174, 874–877. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schuitema, A.R.J.; Hartskeerl, R.A.; van Gool, T.; Laxminarayan, R.; Terpstra, W.J. Application of the polymerase chain reaction for the diagnosis of microsporidiosis. AIDS 1993, 7, 62–63. [Google Scholar]
- Da Silva, A.J.; Slemenda, S.B.; Visvesvara, G.S.; Schwartz, D.A.; Wilcox, C.M.; Wallace, S.; Pieniazek, N.J. Detection of Septata intestinalis (microsporidia) using polymerase chain reaction primers targeting the small subunit ribosomal RNA coding region. Mol. Diagn. 1997, 2, 47–52. [Google Scholar] [CrossRef]
- De Groote, M.A.; Visvesvara, G.; Wilson, M.L.; Pieniazek, N.J.; Slemenda, S.B.; da Silva, A.J.; Leitch, G.J.; Bryan, R.T.; Reves, R. PCR and culture confirmation of disseminated Encephalitozoon cuniculi in a patient with AIDS: Successful therapy with albendazole. J. Infect. Dis. 1995, 171, 1375–1378. [Google Scholar] [CrossRef] [PubMed]
- Weiss, L.M.; Vossbrinck, C.R. Molecular biology, molecular phylogeny, and molecular diagnostic approaches to the microsporidia. In The Microsporidia and Microsporidiosis; Wittner, M., Weiss, L.M., Eds.; American Society for Microbiology: Washington, DC, USA, 1999; pp. 129–171. [Google Scholar]
- Vossbrinck, C.R.; Debrunner-Vossbrinck, B.A. Molecular phylogeny of the Microsporidia: Ecological, ultrastructural and taxonomic considerations. Folia Parasitol. 2005, 52, 131–142. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Baker, M.D.; Vossbrinck, C.R.; Didier, E.S.; Maddox, J.V.; Shadduck, J.A. Small subunit ribosomal DNA phylogeny of various microsporidia with emphasis on AIDS related forms. J. Eucaryot. Microbiol. 1995, 42, 564–570. [Google Scholar] [CrossRef]
- Visvesvara, G.; Leitch, G.J.; Pieniazek, N.J.; da Silva, A.J.; Wallace, S.; Slemenda, S.B.; Weber, R.; Schwartz, D.A.; Gorelkin, L.; Wilcox, C.M.; et al. Short-term in vitro culture and molecular analysis of the microsporidian, Enterocytozoon bieneusi. J. Eukaryot. Microbiol. 1995, 42, 506–510. [Google Scholar] [CrossRef]
- Didier, E.S.; Vossbrinck, C.R.; Baker, M.D.; Rogers, L.B.; Bertucci, D.C.; Shadduck, J.A. Identification and characterization of three Encephalitozoon cuniculi strains. Parasitology 1995, 111, 411–421. [Google Scholar] [CrossRef]
- Vossbrinck, C.R.; Baker, M.D.; Didier, E.S.; Debrunner-Vossbrinck, B.A.; Shadduck, J.A. Ribosomal DNA sequences of Encephalitozoon hellem and Encephalitozoon cuniculi: Species identification and phylogenetic construction. J. Eukaryot. Microbiol. 1993, 40, 354–362. [Google Scholar] [CrossRef]
- Menotti, J.; Cassinat, B.; Sarfati, C.; Liguory, O.; Derouin, F.; Molina, J.M. Development of a real-time PCR assay for quantitative detection of Encephalitozoon intestinalis DNA. J. Clin. Microbiol. 2003, 41, 1410–1413. [Google Scholar] [CrossRef] [Green Version]
- Verweij, J.J.; ten Hove, R.; Brienen, E.A.T.; van Lieshout, L. Multiplex detection of Enterocytozoon bieneusi and Encephalitozoon spp. in fecal samples using real-time PCR. Diagn. Microbiol. Infect. Dis. 2007, 57, 163–167. [Google Scholar] [CrossRef] [PubMed]
- Menotti, J.; Cassinat, B.; Porcher, R.; Sarfati, C.; Derouin, F.; Molina, J.M. Development of a real-time polymerase-chain-reaction assay for quantitative detection of Enterocytozoon bieneusi DNA in stool specimens from immunocompromised patients with intestinal microsporidiosis. J. Infect. Dis. 2003, 187, 1469–1474. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hester, J.D.; Varma, M.; Bobst, A.M.; Ware, M.W.; Lindquist, H.D.; Schaefer, F.W., 3rd. Species-specific detection of three human-pathogenic microsporidial species from the genus Encephalitozoon via fluorogenic 5’ nuclease PCR assays. Mol. Cell Probes. 2002, 16, 435–444. [Google Scholar] [CrossRef] [PubMed]
- Santín, M.; Fayer, R. Enterocytozoon bieneusi Genotype Nomenclature Based on the Internal Transcribed Spacer Sequence: A Consensus. J. Eukaryot. Microbiol. 2009, 56, 34–38. [Google Scholar] [CrossRef] [PubMed]
- Feng, Y.; Li, N.; Dearen, T.; Lobo, M.L.; Matos, O.; Cama, V.; Xiao, L. Development of a Multilocus Sequence Typing Tool for High-Resolution Genotyping of Enterocytozoon bieneusi. Appl. Environ. Microbiol. 2011, 77, 4822–4828. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, W.; Cama, V.; Feng, Y.; Gilman, R.H.; Bern, C.; Zhang, X.; Xiao, L. Population genetic analysis of Enterocytozoon bieneusi in humans. Int. J. Parasitol. 2012, 42, 287–293. [Google Scholar] [CrossRef]
- Li, W.; Deng, L.; Yu, X.; Zhong, Z.; Wang, Q.; Liu, X.; Niu, L.; Xie, N.; Deng, J.; Lei, S.; et al. Multilocus genotypes and broad host-range of Enterocytozoon bieneusi in captive wildlife at zoological gardens in China. Parasit. Vectors 2016, 9, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Li, W.; Xiao, L. Multilocus Sequence Typing and Population Genetic Analysis of Enterocytozoon bieneusi: Host Specificity and Its Impacts on Public Health. Front. Genet. 2019, 2, 307. [Google Scholar] [CrossRef]
- Deng, L.; Li, W.; Zhong, Z.; Gong Ch Liu, X.; Huang, X.; Xiao, L.; Zhao, R.; Wang, W.; Feng, F.; Zhang, Y.; et al. Molecular characterization and multilocus genotypes of Enterocytozoon bieneusi among horses in southwestern China. Parasit. Vectors 2016, 9, 561. [Google Scholar] [CrossRef] [Green Version]
- Wang, X.T.; Wang, R.J.; Ren, G.J.; Yu, Z.Q.; Zhang, L.X.; Zhang, S.Y.; Lu, H.; Peng, X.Q.; Zhao, G.H. Multilocus genotyping of Giardia duodenalis and Enterocytozoon bieneusi in dairy and native beef (Qinchuan) calves in Shaanxi province, northwestern China. Parasitol. Res. 2016, 115, 1355–1361. [Google Scholar] [CrossRef]
- Zhao, W.; Yu, S.; Yang, Z.; Zhang, Y.; Zhang, L.; Wang, R.; Zhang, W.; Yang, F.; Liu, A. Genotyping of Enterocytozoon bieneusi (Microsporidia) isolated from various birds in China. Infect. Genet. Evol. 2016, 40, 151–154. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Y.; Tao, W.; Wan, Q.; Li, Q.; Yang, Y.; Li, Y.; Zhang, S.; Li, W. Zoonotic and potentially host-adapted Enterocytozoon bieneusi genotypes in sheep and cattle in northeast China and an increasing concern about the zoonotic importance of previously considered ruminant-adapted genotypes. Appl. Environ. Microbiol. 2015, 81, 3326–3335. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Karim, M.R.; Dong, H.; Li, T.; Yu, F.; Li, D.; Zhang, L.; Li, J.; Wang, R.; Li, S.; Li, X.; et al. Predomination and new genotypes of Enterocytozoon bieneusi in captive nonhuman primates in zoos in China: High genetic diversity and zoonotic significance. PLoS ONE 2015, 10, e0117991. [Google Scholar] [CrossRef]
- Karim, M.R.; Wang, R.; Dong, H.; Zhang, L.; Li, J.; Zhang, S.; Rume, F.I.; Qui, M.; Jian, F.; Sun, M.; et al. Genetic polymorphism and zoonotic potential of Enterocytozoon bieneusi from nonhuman primates in China. Appl. Environ. Microbiol. 2014, 80, 1893–1898. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, N.; Xiao, L.; Wang, L.; Zhao, S.; Zhao, X.; Duan, L.; Guo, M.; Liu, L.; Feng, Y. Molecular surveillance of Cryptosporidium spp., Giardia duodenalis, and Enterocytozoon bieneusi by genotyping and subtyping parasites in wastewater. PLoS Negl. Trop. Dis. 2012, 6, e1809. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tang, C.; Cai, M.; Wang, L.; Guo, Y.; Li, N.; Feng, Y.; Xiao, L. Genetic diversity within dominant Enterocytozoon bieneusi genotypes in pre-weaned calves. Parasit. Vectors 2018, 11, 170. [Google Scholar] [CrossRef]
- Morrison, C.L.; Eackles, M.S.; Johnson, R.L.; King, T.L. Characterization of 13 microsatellite loci for the deep-sea coral, Lophelia pertusa (Linnaeus 1758), from the western North Atlantic Ocean and Gulf of Mexico. Mol. Ecol. Resour. 2008, 8, 1037–1039. [Google Scholar] [CrossRef]
- Gui, B.Z.; Zou, Y.; Chen, Y.W.; Li, F.; Jin, Y.C.; Liu, M.T.; Yi, J.N.; Zheng, W.B.; Liu, G.H. Novel genotypes and multilocus genotypes of Enterocytozoon bieneusi in two wild rat species in China: Potential for zoonotic transmission. Parasitol. Res. 2020, 119, 283–290. [Google Scholar] [CrossRef]
Species | Sequence (5′→3′) | Primer Designation | Ta | bp | Ref. |
---|---|---|---|---|---|
Encephalitozoon spp. and E. bieneusi | -CACCAGGTTGATTCTGCCTGAC- -CCTCTCCGGAACCAAACCCTG- | PMP1(V1) PMP2 | 60 | Eb 250 Ec 268 Ei 270 Eh 279 | [67] |
Encephalitozoon spp. and E. bieneusi | -CACCAGGTTGATTCTGCC- -GTGACGGGCGGTGTCTAC- | C1(part V1) C2 | 56 | Eb 1 170 Ec 1 190 Eh 1 205 Ei 1 186 | [45] |
Encephalitozoon spp. and E. bieneusi | -CACCAGGTTGATTCTGCCTGAC- -GGTTACCTTGTTACGACTT- | V1 1 492 | - | around 1200 | - |
Encephalitozoon spp. | -TGCAGTTAAAATGTCCGTAGT- -TTTCACTCGCCGCTACTCAG- | int530f int580r | 40 | around 1000 | [42] |
Nested PCR Encephalitozoon spp. and E. bieneusi | -TGAATG(G/T)GTCCCTGT- -TCACTCGCCGCTACT- | MSP1–PR MSP2A | 58 | - | [49] |
-GGAATTCACACCGCCCGTC(A/G)(C/T)TAT- -CCAAGCTTATGCTTAAGT(C/T)(A/C)AA(A/G)GGGT- | MSP3–DR MSP4A | 58 | Ec 289 Ei 305 | ||
-TGAATG(G/T)GTCCCTGT- -GTTCATCGCACTACT- | MSP1–PR MSP2B | 58 | − | ||
-GGAATTCACACCGCCCGTC(A/G)(C/T)TAT- -CCAAGCTTATGCTTAAGTCCAGGGAG- | MSP3–DR MSP4B | 58 | Eb 508 | ||
Nested PCR Encephalitozoon spp. and E. bieneusi | -CCAGGUTGATUCTGCCUGACG- -TUACCGCGGCUGCUGGCAC- | Mic3U–PR Mic421U | 65 | Eb 410 Ec 419 Ei 421 Eh 433 | [68] |
-AAGGAGCCTGAGAGATGGCT- -CAATTGCTTCACCCTAAGGTC- -GACCCCTTTGCACTCGCACAC- -TGCCCTCCAGTAAATCACAAC- -CCTCCAATCAATCTCGACTC- | Mic266–DR Eb379 Ec378 Eh410 Ei395 | 62 | Eb 132 Ec 113 Eh 134 Ei 128 | ||
Nested PCR | -GGTTGATTCTGCCTGACG- -CTTGCGAGC(G/A)TACTATCC- | PMicF PMicR | 55 | Eb 779 Enc 779 | [69] |
-GGTAATTTGGTCTCTGTGTGTGTG- | EnbF | 57 | Eb 440 | ||
-CTACACTCCCTATCCGTTC- | EnbR | ||||
-AGTACGATGATTTGGTTG- -ATCCACAT-ACCA- | EncepF Aceptac | Enc 629 | |||
Real-Time PCR Encephalitozoon spp. | -TGTACACACCGCCCGTCG- -TTTCACTCGCCGCTACTC- | ecfITSf ecfITSr | 60 | Ec 349 Ei 334 Eh 359 | [35] |
Species | Sequence (5′→3′) | Primer Designation | Ta | bp | Reference |
---|---|---|---|---|---|
E. bieneusi | -GAAACTTGTCCACTCCTTACG- -CCATGCACCACTCCTGCCATT- | EBIEF1 EBIER1 | 55 | 607 | [65] |
E. bieneusi | -CACCAGGTTGATTCTGCCTGAC- ACTCAGGTGTTATACTCACGTC- | V1 EB450 | 48 | 353 | [58,70] |
E. bieneusi–RE1 | -CACCAGGTTGATTCTGCCTGAC- -CAGCATCCACCATAGACAC- | V1 Mic3 | 54 | 446 | [71,72] |
E. bieneusi | -TCAGTTTTGGGTGTGGTATCGG- -GCTACCCATACACACATCATTC- | Eb.gc Eb.gt | 49 | 210 | [73] |
E. bieneusi | -GCCTGACGTAGATGCTAGTC- -ATGGTTCTCCAACTGAAACC- | EbF EbR | 55 | 1294 | [74] |
E. intestinalis | -CACCAGGTTGATTCTGCCTGAC- -CTCGCTCCTTTACACTCGAA- | V1 Si500 | 58 | 375 | [60] |
E. intestinalis | -GGGGGTAGGAGTGTTTTTG- -CAGCAGGCTCCCTCGCCATC- | 3 3 | 65 | 930 | [75] |
E. intestinalis | -TTTCGAGTGTAAGGAGTCGA- -CCGTCCTCGTTCTCCTGCCCG- | SINTF1 SINTR | 55 | 520 | [76,77] |
E. intestinalis | -CACCAGGTTGATTCTGCCTGAC- -CCTGCCCGCTTCAGAACC- | V1 Sep1 | 55 | 824 | - |
E. cuniculi | -ATGAGAAGTGATGTGTGTGCG- -TGCCATGCACTCACAGGCATC- | ECUNF ECUNR | 55 | 549 | [56,77] |
E. hellem | -TGAGAAGTAAGATGTTTAGCA- -GTAAAAAGACTCTCACACTCA- | EHELF EHELR | 55 | 547 | [56] |
Species | Sequence (5′→3′) | Target Region | Primer Designation | bp | Reference |
---|---|---|---|---|---|
E. bieneusi, E. hellem, E. intestinalis, E. cuniculi, other species | -ACCAGGTTGATTCTGCCTGAC- -GGTTACCTTGTTACGACTT- | SSU rRNA | V1 1492 | 1200 | [57,58,59,60] |
E. bieneusi, E. hellem, E. intestinalis, E. cuniculi, other species | -CACCAGGTTGATTCTGCC- -TTATGATCCTGCTAATGGTTC- | SSU rRN | 18f 1537r | 1300 | [80] |
E. intestinalis, E. cuniculi, E. hellem, other species | -CACCAGGTTGATTCTGCCTGA- -TTATGATCCTGCTAATGGTTCTCCAAC- | SSU rRNA | Micro-F Micro-R | 1300 | [56,81] |
E. bieneusi | -CACCAGGTTGATTCTGCCTGA- -CAACTGAAACCTTGTTACGACTT- | SSU rRNA | Micro-F 1492N4 | 1200 | [81] |
E. bieneusi, E. hellem, E. intestinalis, E. cuniculi, other species | -CACCAGGTTGATTCTGCCTGACG- -TTATGATCCTGCTAATGGTTCTCC- | SSU rRNA | − − | 1300 | [75] |
E. bieneusi, E. hellem, E. intestinalis, E. cuniculi, V. cornae, other species | -GTGCCAGC(C/A)GCCGCGG- -GGTCCGTGTTTCAAGACGG- | SSU rRNA, ITS, LSU rRNA | 530f 580r | 1550 1350 1350 1350 1300 | [59,60,82,83] |
E. intestinalis, E. hellem, E. cuniculi, other species | -TGCAGTTAAAATGTCCGTAGT- -TTTCACTCGCCGCTACTC- | SSU rRNA, ITS, LSU rRNA | int530f int580r | 1000 1000 1000 | [75,82] |
Locus | Sequence (5′→3′) Primers | Targeted Repeat | Annea-Ling Temp (°C) | bp | GenBank Accession No. (Nucleotide Positions) |
---|---|---|---|---|---|
MS-1 | F1, CAAGTTGCAAGTTCAGTGTTTGAA R1, GATGAATATGCATCCATTGATGTT F2, TTGTAAATCGACCAAATGTGCTAT R2, GGACATAAACCACTAATTAATGTAAC | (TAT)31 (TAG)11 | 58 58 | 843 676 | ABGB01000003 (63854–64529) |
MS-2 | F1, GTACAAGATGAAGTTCCTGAGT R1, CATGACATCATTTTACATACACAT F2, GGCCTGATAATAGATCGGATT R2, CAGCATCATCACACGTTCTCA | (TG)19 | 55 55 | 584 421 | ABGB01001554 (367–787) |
MS-3 | F1, CAAGCACTGTGGTTACTGTT R1, AAGTTAGGGCATTTAATAAAATTA F2, GTTCAAGTAATTGATACCAGTCT R2, CTCATTGAATCTAAATGTGTATAA | (TA)21 | 55 55 | 702 537 | ABGB01000035 (202–738) |
MS-4 | F1, GCATATCGTCTCATAGGAACA R1, GTTCATGGTTATTAATTCCAGAA F2, CGAAGTGTACTACATGTCTCT R2, GGACTTTAATAAGTTACCTATAGT | (TTATTTTTTCCATTTTT CTTCTTCTATTTCCTTTA)9 | 55 55 | 965 885 | ABGB01000033 (1063–1947) |
MS-5 | F1, GTCATGATCACCGGCACTTA R1, CTCAAGGATCGTCAAGCTGA F2, GCAGGCTTTGCAGTTGGCTT R2, GTGAAGGAAGCCGTAGCTAA | (GCGGCTGGTTTCGCAG CAGCGGTTTTAGCAA CTGGCTTC)12 | 55 55 | 882 599 | ABGB01000169 (546–1144) |
MS-6 | F1, GAATAGAATGATTCTAGCCATGA R1, CCATATAGCCTTTAAGACCAAA F2, CTTTTCAAGGATGGTTTGAATGA R2, CAAAGGGTACCTCCAATCAAA | (AT)14 | 55 55 | 706 498 | ABGB01000562 (660–1157) |
MS-7 | F1, GTTGATCGTCCAGATGGAATT R1, GACTATCAGTATTACTGATTATAT F2, CAATAGTAAAGGAAGATGGTCA R2, CGTCGCTTTGTTTCATAATCTT | (TAA)13 | 55 55 | 684 471 | ABGB01000014 (23807–24277) |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Valenčáková, A.; Sučik, M. Alternatives in Molecular Diagnostics of Encephalitozoon and Enterocytozoon Infections. J. Fungi 2020, 6, 114. https://doi.org/10.3390/jof6030114
Valenčáková A, Sučik M. Alternatives in Molecular Diagnostics of Encephalitozoon and Enterocytozoon Infections. Journal of Fungi. 2020; 6(3):114. https://doi.org/10.3390/jof6030114
Chicago/Turabian StyleValenčáková, Alexandra, and Monika Sučik. 2020. "Alternatives in Molecular Diagnostics of Encephalitozoon and Enterocytozoon Infections" Journal of Fungi 6, no. 3: 114. https://doi.org/10.3390/jof6030114