Next Article in Journal
Roles of the Sec2p Gene in the Growth and Pathogenicity Regulation of Aspergillus fumigatus
Previous Article in Journal
Ex Situ Conservation, DNA Barcoding and Enzymatic Potential Evaluation of Macrofungi (Basidiomycota, Ascomycota) from Vietnam
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Population Structure Based on Microsatellite Length Polymorphism, Antifungal Susceptibility Profile, and Enzymatic Activity of Candida auris Clinical Isolates in Russia

by
Ellina Oganesyan
1,2,*,
Victoria Klimenteva
1,
Irina Vybornova
1,
Valentina Venchakova
2,
Ekaterina Parshikova
2,
Sergey Kovyrshin
1,2,
Olga Orlova
3,
Alexander Kruglov
4,
Svetlana Gordeeva
5,
Natalya Vasilyeva
1,2 and
Anastasiya Taraskina
1
1
Kashkin Research Institute of Medical Mycology, North-Western State Medical University Named after I.I. Mechnikov, 191015 Saint Petersburg, Russia
2
Department of Medical Microbiology, North-Western State Medical University Named after I.I. Mechnikov, 191015 Saint Petersburg, Russia
3
Moscow L.A. Vorokhobov Municipal Clinical Hospital № 67, 123423 Moscow, Russia
4
Moscow Municipal Clinical Hospital № 40, 129301 Moscow, Russia
5
Clinical Infectious Diseases Hospital Named after S.P. Botkin, 195067 Saint Petersburg, Russia
*
Author to whom correspondence should be addressed.
J. Fungi 2025, 11(1), 35; https://doi.org/10.3390/jof11010035
Submission received: 28 November 2024 / Revised: 21 December 2024 / Accepted: 31 December 2024 / Published: 4 January 2025

Abstract

:
Candida auris is an emerging multidrug-resistant fungal pathogen causing nosocomial transmission and invasive infections with high mortality. This study aimed to investigate the genetic relationships, enzymatic activities, and drug-resistance profiles of C. auris isolates to evaluate the population and epidemiological diversity of candidiasis in Russia. A total of 112 clinical isolates of C. auris were analyzed from May 2017 to March 2023 in 18 hospitals across Saint Petersburg, the Leningrad Region, and Moscow. Species identification was confirmed by ITS sequencing, and genotyping was performed using 12 short tandem repeat (STR) markers. Antifungal susceptibility was tested using Sensititre™ YeastOne™ plates, and hydrolytic enzyme production was measured by the plate method. ITS sequencing confirmed that all isolates belonged to a single ITS cluster (clades I and III). Fifteen distinct STR genotypes were identified, with genotype I being dominant (n = 53). The most variable of the analyzed markers turned out to be M3-Ia, which was represented in the Russian population by eight different variants. Fluconazole resistance was found in 111 isolates, 17% were resistant to amphotericin B, and 3.6% to 5-flucytosine. Phospholipase activity was strong in most strains, especially in urine isolates (p = 0.014). Conclusion: The predominance of STR genotype I and its variability at the M3-Ia locus suggest its association with nosocomial outbreaks and transmissibility in Russia.

1. Introduction

Invasive fungal infections due to opportunistic pathogens have become a major clinical and pharmaceutical challenge since the end of the 20th century, especially for the population of immunocompromised patients [1,2,3]. The introduction of new medical technologies into practice (surgical procedures, transplantation of organs and tissues, high-dosage cytostatic and immunosuppressive therapy, etc.), along with the HIV/AIDS pandemic, led to an increase in the frequency of systemic mycoses [1]. In the context of nosocomial invasive fungal infections, Candida species are the predominant causative agents, with mortality rates exceeding 40% [2,3].
Among fungal yeast infections, emerging species are a special threat, as they are often resistant to various antifungal drugs and present diagnostic challenges. The Centers for Disease Control and Prevention (CDC) and the World Health Organization (WHO) recently identified Candida auris as a high-priority health threat based on several key variables such as global mortality rates, availability of diagnostics, and reports of antifungal drug resistance [4,5].
C. auris belongs to the Metschnikowiaceae family, which includes species that are often resistant to multiple antifungal drug classes [6,7]. Molecular clock evaluation (based on spontaneous and evolutionary mutation rates) has demonstrated that the most recent common ancestor (TMRCA) of C. auris is older than 360 years, with clade II being the oldest. Estimates indicate that nearly all outbreak-causing clusters from clades I, III, and IV originated between 1982 and 1984, approximately 38 to 40 years ago. The occurrence of these clusters coincides with the introduction of azole drugs into clinical practice and the early stages of the AIDS epidemic [8,9]. However, the environmental reservoirs of this pathogen remain unknown. The salt marsh wetlands and sandy beaches of the Andaman Islands have been identified as natural niches for C. auris [10]. Additionally, yeast pathogens, including C. auris, have been found in dairy production facilities [11], though the connection between these findings and human infection remains unclear. It has been shown that the use of fungicides in the agricultural industry, particularly in fruit storage, is a significant factor driving the selection of drug resistance in clinical settings [12,13].
Currently, C. auris represents the most significant clinical challenge in controlling nosocomial infections globally. In addition to its increased multidrug resistance, this pathogen exhibits high transmissibility within healthcare facilities and can be transmitted from patient to patient, causing clusters of cases or outbreaks that are difficult to control, as this species persists in hospital environments, where it is difficult to eradicate [14,15]. Besides antifungal drug resistance, fungal virulence factors can also negatively impact disease outcomes and enhance the pathogen’s transmissibility. Proteolytic enzymes such as proteinase, aspartyl protease, hemolysins, lipases, and phospholipase are crucial for C. auris to adhere to the tissue surfaces and invade host cells [16]. Phospholipase and esterase enzymes play crucial roles in the virulence of Candida species, including C. auris. These enzymes facilitate the invasion of host tissues by degrading phospholipids and ester bonds in cellular membranes, thus enhancing pathogenicity [17]. Specifically, phospholipase activity has been associated with increased tissue adherence and invasion, while esterase activity aids in the breakdown of lipids essential for cellular membrane integrity. The examination of these enzymatic activities is therefore critical for understanding the mechanisms behind C. auris virulence, its ability to colonize various body sites, and its resistance to antifungal treatments. These factors collectively contribute to the pathogen’s potential for causing persistent, hard-to-treat infections, particularly in immunocompromised patients. Thus, evaluating the levels of phospholipase and esterase activity in clinical isolates of C. auris is essential for elucidating its pathogenic profile and improving therapeutic strategies [18,19,20].
This ascomycete yeast is a haploid species with high genetic variability among clinical isolates from different geographic populations (clades) and limited diversity within each clade. Low intra- and high inter-group variability proves the independent emergence and evolution of C. auris in different regions of the world. Initially, four major clades were identified. In 2018, the existence of a potential fifth clade was reported in Iran, and in 2023, a new (sixth) clade of C. auris was found in Singapore and Bangladesh. Notably, isolates from Iran were most closely related to East Asian clade II, while isolates from Singapore and Bangladesh were closely related to representatives of the South American clade IV [21,22,23,24]. The above information, along with the species ability to mate and undergo meiosis, as well as the detection of chromosomal rearrangements between different clades [8,25,26], demonstrates the heterogeneity of the global C. auris population, the possibility of recombination of genetic material, and the potential for further evolution, increased virulence, and inheritance of acquired molecular mechanisms of drug resistance [8,9]. Thus, the activity lytic enzyme levels, as well as the sensitivity to antifungal drugs of C. auris, currently clearly varies between isolates depending on their geographical origin [27].
In 2017, the first known Russian case of candidemia due to C. auris was reported [28]. Genome-wide data analysis showed that this strain clustered within South Asian C. auris clade I and seemingly represented an independent event of dissemination from the original species range. From 2017 to May 2020, prior to the COVID-19 pandemic, 30 strains of C. auris were identified in Russia. During the COVID-19 pandemic, more than 350 clinical isolates of C. auris were deposited in the Russian Collection of Pathogenic Fungi (RCPF) (Kashkin Research Institute of Medical Mycology), isolated from patients in intensive care units of various hospitals and the environment of healthcare institutions. At the same time, the population genetic structure of C. auris strains circulating in Russia remains practically unstudied to date.
The molecular intraspecies (within-clade) typing of C. auris clinical isolates is important for studying their population structure, epidemiology, and transmission dynamics, in order to identify the epidemic genotype and the origin of C. auris outbreaks. Currently, three approaches are most commonly used for molecular intraspecies typing: whole-genome sequencing (WGS), amplified fragment length polymorphism (AFLP), and microsatellite (or short tandem repeat (STR)) length polymorphism analysis. However, WGS is expensive and labor-intensive, and AFLP is a complex technique with results obtained by different research groups being difficult to interpret and compare, while STR-based genotyping has proven to be an effective method for assessing population variation, comparable in efficiency to WGS [29,30]. The STR assay will allow many laboratories to type C. auris during outbreaks, and it may also be useful for the initial classification of large sets of isolates at a subspecies or subclade level. A comparative study of five methods (microsatellite typing, ITS sequencing, AFLP, fingerprinting, and MALDI-TOF MS) showed that microsatellite typing is the tool of choice for investigating C. auris outbreaks [31]. For example, in India, comparing microsatellite typing to whole-genome sequencing allowed researchers to trace sources and patterns of hospital-acquired infections, enhancing their understanding of outbreak dynamics [32]. Similarly, in Brazil, microsatellite analysis provided insight into the spread of C. auris during a COVID-19 outbreak [33]. Moreover, when the first case of C. auris emerged in Taiwan, STR typing allowed researchers to determine the isolate’s genetic clade and clarify its epidemiological origin [34]. Despite these studies, there is a lack of research using microsatellite analysis to investigate C. auris in Russia, and this study aims to fill this gap by providing new insights into the population structure and epidemiology of this pathogen in Russian healthcare facilities.
The goal of this study is to examine the genetic relationships, virulence levels, and drug-resistance profiles among C. auris isolates from different healthcare facilities, with the aim of determining population diversity and the epidemiological landscape of C. auris candidiasis in Russia.

2. Materials and Methods

2.1. Patients and Specimen Collection

In total, 112 Candida auris isolates were included in this study, primarily from cases of fungemia and other invasive mycoses, collected between May 2017 and March 2023 at 18 hospitals in Saint Petersburg, the Leningrad Region, and Moscow. The exception was one isolate obtained from an environmental surface (toilet rim) of the healthcare facility. All C. auris isolates were collected by standard methods in the laboratories of the 18 hospitals included in the study and were submitted to Mycological Reference Center based at the Kashkin Research Institute of Medical Mycology, North-Western State Medical University, named after I. I. Mechnikov (Saint Petersburg, Russia), for re-testing and determining sensitivity to antifungal drugs. A total of 111 isolates of C. auris were recovered from 106 adult immunosuppressed patients (mean age: 63 years; range: 37–97) both with (n = 69, 66%) and without (n = 35, 34%) COVID-19 pneumonia. Among these patients, 49% (n = 51) were female and 51% (n = 53) were male. Patients from neonatal and pediatric intensive care units were excluded from the study. Samples from C. auris cases were obtained from various specimen sources, including blood, urine, and other sites (see Table 1 for an overview of isolates). For five patients, two consecutive C. auris strains, isolated from different localizations (urine, blood) at intervals of 1–2 months, were included in the study. Additionally, to assess result reproducibility, two consecutive C. auris strains, isolated from the same site over a short observation period, were included from two patients. In the Section 3 (Figure 3), for the reader’s convenience, samples from the same patient are highlighted in the same color.

2.2. Preliminary Identification and Growth Media

The yeast strains of C. auris used in this study were deposited in the Russian Collection of Pathogenic Fungi (RCPF) and maintained through traditional subcultivation methods (periodic reseeding on fresh agar media) until use. The preliminary identification of the yeast was performed using matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) mass spectrometry with an AutoFlex Speed MALDI-TOF MS (Bruker Daltonics, Bremen, Germany), followed by confirmation through the sequencing of the internal transcribed spacer (ITS) rDNA region as universal DNA barcoding for fungi. For all experiments in this study, 24-h cultures grown on Sabouraud dextrose agar (Research Center for Pharmacotherapy, Russia) supplemented with chloramphenicol and incubated at 37 °C were used.

2.3. DNA Extraction and Molecular Identification (Internal Transcribed Spacer Region (ITS) Sequencing)

Total genomic DNA was extracted from C. auris isolate cultures using the Monarch® HMW DNA Extraction Kit (New England Biolabs Inc., Ipswich, MA, USA) according to the kit’s instructions. The amplification of the internal transcribed spacer (ITS) region of the ribosomal subunit was carried out using fungal general primers: ITS1 (5′-TCCGTAGGTGAACCTGCGG-3′) and ITS4 (5′-TCCTCCGCTTATTGATATGC-3′) (Sinthol, Russia) [35]. PCR reaction was performed in a final volume of 50 µL containing 5 µL dNTP mix (2.5 mM), 5 µL 10× reaction buffer (750 mM Tris-HCl (pH 8.8), 200 mM (NH4)2SO4, 0.1%Tween 20), 2 µL of each primer (5 pM), 5 µL 25 mM MgCl2, 2.5 µL DNA template, 0.2 µL Taq DNA polymerase (5000 U/mL) (New England BioLabs, Ipswich, MA, USA), and 28.3 µL nuclease-free water. A negative control (water instead of fungal DNA template) was included. The amplification program consisted of an initial denaturation at 95 °C for 5 min, followed by 35 cycles of 94 °C for 30 s, 56 °C for 30 s, and 72 °C for 1 min, with a final extension at 72 °C for 10 min. PCR products were analyzed by 6% polyacrylamide gel electrophoresis to evaluate size and quality. After that, PCR products were purified using GeneJET PCR Purification Kit (Thermo Scientific, Foster City, CA, USA) and used as the template for sequencing PCR. The sequencing reaction was carried out using the BigDye Terminator v 3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) with the aforementioned forward and reverse primers, followed by analysis of the reaction products on an Applied Biosystems 3500 Genetic Analyzer. For species identification, GenBank Basic Local Alignment Search Tool (BLAST) search (http://www.ncbi.nlm.nih.gov/BLAST/Blast.cgi, accessed on 20 November 2023) was used. Pairwise sequence alignment was performed using the Seaview program version 4.7 and used to assess the nucleotide polymorphism of the ITS region of all C. auris isolates included in the study.

2.4. Phospholipase Activity

Sabouraud dextrose agar (Research Center for Pharmacotherapy, Russia, supplemented) with 0.005 mol/L CaCl2, 1 mol/L NaCl, and 8% sterile egg yolk emulsion (Condalab, Madrid, Spain) was used to assess the phospholipase activity of C. auris isolates. Yeast cell inoculates at a concentration of 106 CFU/mL (equivalent to McFarland 0.5 standard) were prepared from 24-hour-old cultures, and 10 µL of these inoculates were spotted onto the surface of the agar test medium. The plates were incubated at 37 °C for 3 days. C. albicans (ATCC 14053) was used as the positive control. Phospholipase activity (Pz) was measured as described by Price et al. [36]. According to this definition, the Pz value was expressed as the ratio of the colony diameter to precipitation zone plus the colony diameter. It was scored as follows: no phospholipase activity (1), weak phospholipase activity (0.9–0.99), medium phospholipase activity (0.8–0.89), strong phospholipase activity (0.7–0.79), and high productivity (<0.69). The assay was performed in triplicate for each isolate.

2.5. Esterase Activity

Agar medium for assessing esterase activity was prepared using 10.0 g Bacteriological Peptone (Condalab, Spain), 5.0 g of NaCl, 0.1 g of CaCl2, 15.0 g of European Bacteriological Agar (Condalab, Spain), and 1000 mL of distilled water. After autoclaving, the medium was cooled to approximately 50 °C, and 5 mL of sterile Tween 80 (Sigma-Aldrich, St. Louis, MO, USA) was added. The final pH of this medium was 6.8. Yeast cell inoculum was prepared as described above. The seeded agar plates were incubated at 35 °C and monitored daily for 10 days. Esterase activity was assessed similarly to phospholipase activity.

2.6. Antifungal Susceptibility Testing

Antifungal susceptibility testing was performed using the Sensititre™ YeastOne™ YO9 AST Plate (Thermo Fisher Scientific, USA) according to the manufacturer’s instructions. The susceptibility testing panel consists of the following 9 antifungal drugs: micafungin, caspofungin, 5-flucytosine, posaconazole, voriconazole, itraconazole, fluconazole, anidulafungin, and amphotericin B. Stock inoculum suspensions of the yeast were obtained in 5 mL of sterile 0.145 mol/L saline (8.5 g/L NaCl; 0.85% saline) from five colonies of ~1 mm in diameter of 24-h C. auris cultures on Sabouraud dextrose agar at 35 °C. The turbidity of each yeast suspension was adjusted by the spectrophotometric method as described in the M27-A4 guidelines [37] initially to a stock suspension concentration of 0.5 McFarland standard (1 × 106 cells per mL) followed by the dilution of the stock suspension to 5.0 × 102 to 2.5 × 103 cells per mL. All experiments included the quality control strain Candida parapsilosis (ATCC 22019). Minimum inhibitory concentrations (MICs) were determined colorimetrically after plate incubation at 35 °C for 24 h. Since the Clinical and Laboratory Standards Institute (CLSI) does not provide specific antifungal breakpoints for C. auris, categorical results were interpreted according to the tentative MIC breakpoints for C. auris published by the Centers for Disease Control and Prevention (CDC): ≥32 μg/mL for fluconazole; not available for voriconazole and other second-generation triazoles (posaconazole and itraconazole); ≥2 μg/mL for amphotericin B and caspofungin; ≥4 μg/mL for micafungin and anidulafungin; and not available for 5-flucytosine (https://www.cdc.gov/fungal/candida-auris/recommendations.html, accessed on 20 November 2023).

2.7. Microsatellite Length Polymorphism Genotyping (Short Tandem Repeat Analysis)

Microsatellite analysis of the Russian C. auris population by STR typing was performed as previously described, with modifications [29]. A set of primers, M2a, M2b, M2c, M3-1a, M3-1b, M3-1c, M3-2a, M3-2b, M3-2c, M9a, M9b, and M9c (Sinthol, Russia), proposed by de Groot et al. [29] was employed to target 12 STR loci with repeat sizes of two, three, or nine nucleotides (Table 2). C. auris DNA was extracted as described above. Polyacrylamide gel electrophoresis was performed to check the quality of the isolated DNA and subsequent PCR products.
The PCR mixture, assembled on ice, contained 75 mM Tris-HCl (pH 8.8), 20 mM (NH4)2SO4, 0.01% Tween 20, 0.25 mM of each dNTP, 2.5 mM MgCl2, 1 U of Taq polymerase (New England BioLabs, Ipswich, MA, USA), 1.20 pM of each forward and reverse primer, 25 ng of DNA template, and water to a total volume of 25 µL. A separate PCR reaction was performed with each pair of primers on the following thermal protocol: 5 min of denaturation at 95 °C, followed by 35 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 1 min, and a final extension at 72 °C for 10 min. For the STR analysis, PCR products were purified using the GeneJET PCR Purification Kit (Thermo Scientific, Foster City, CA, USA) according to the instructions. After that, purified samples were diluted 100 times with water, and 1 µL of the diluent together with 8.8 µL of formamide and 0.2 µL of GeneScan™ 600 LIZ™ DNA Size Standard v2.0 (Thermo Scientific, Foster City, CA, USA) were denatured for 1 min at 96 °C. Capillary electrophoresis was performed using a standard fragment analysis program on an Applied Biosystems 3500 Genetic Analyzer (Applied Biosystem, Waltham, MA, USA).

2.8. Data Analysis

ITS rDNA sequence alignment was performed using the SeaView software (version 4.7). A phylogenetic tree of the ITS sequences was constructed with the maximum likelihood algorithm (PhyML). The copy number of the twelve STR markers in the C. auris isolates was determined using GeneMapper Software 5 (Applied Biosystems), and the allele sizes were rounded up. Relatedness among isolates was analyzed with the MEGA 11 software, employing the unweighted pair group method with arithmetic mean (UPGMA) using a distance matrix. The genetic relationships between strain genotypes were visualized through Principal coordinate analysis (PCoA). This analysis was conducted in R 4.1.2, using the genetic distance metric of Bruvo et al. [38] via the POLYSAT v. 1.2-1 package [39].
Statistical analyses were performed in SPSS software version 20.0 (SPSS Inc., Chicago, IL, USA). Differences in phospholipase activity between isolates from different specimen sources were evaluated using the non-parametric Mann–Whitney U test. Spearman’s correlation coefficient was employed to assess the correlation between enzyme activity and antifungal MICs in C. auris isolates. A p-value of < 0.05 was considered statistically significant (the threshold for detecting differences). In addition, MIC50 (the MIC value inhibiting half of the isolates) and MIC90 (the MIC value inhibiting 90% of the isolates) were calculated using MIC values rounded up to the next highest concentration.

3. Results

3.1. Sequence Analysis of ITS Genes

The analysis of ITS rDNA sequences using BLAST confirmed the species identification of all study isolates as C. auris with 99–100% identity. It has been shown that the nucleotide polymorphism of the ITS region of C. auris isolates has clade-specific features [31,40], allowing the differentiation of three out of five known clades. The exceptions are C. auris clades I and III, which possess identical ITS regions. Typing of C. auris clades has clinical value, as it can help to assess virulence, transmission, and drug resistance potential of a strain [8,21]. C. auris isolates from patients in Russia had an identical ITS sequence and belonged to the same ITS-based cluster, which included clades I and III (Figure 1). Previously, based on the WGS sequence, we determined that strain C1-E20, a causative agent of the first known clinical case of C. auris candidemia in Russia, belongs to clade I [28]. These data suggest that all C. auris isolates that are STR-typed in this study are of South Asian origin.

3.2. Phospholipase and Esterase Activity

Figure 2 and Figure 3 illustrate the phospholipase and esterase activities of C. auris produced on selected solid mediaThe Russian clinical C. auris isolates exhibited varying abilities to produce phospholipase. Although phospholipase activity was predominantly strong and very strong (74.1%), 8.03% of the strains showed low or no activity (Table 3). At the same time, esterase activity among all strains of C. auris was very strong with a precipitation zone from 0.32 to 0.62 when measured after 10 days. For the comparative analysis of enzymatic activity, C. auris strains were grouped as follows: isolates from urine and urinary catheters formed one group, isolates from blood and central venous catheters formed another group, and isolates from other loci were combined into the “other localization” group. Data analysis by the Mann–Whitney U test showed a significant difference in extracellular phospholipase activity between C. auris strains isolated from blood and those isolates from urine (p = 0.014), with a higher fermentative activity in urine strains, as shown in Figure 4. Detailed information on enzymatic activity profiles of all studied C. auris isolates is presented in Figure 5.

3.3. Antifungal Susceptibility Testing Profiles (Patterns)

Table 4 shows the results of MIC ranges, MIC50 and MIC90 of antifungal drugs against 112 C. auris isolates. Almost all C. auris isolates in the present study were resistant to fluconazole (with the exception of one strain). Moreover, 93% of the studied strains had an MIC of ≥256 μg/mL. For second-generation triazoles, there are currently no established MIC breakpoints for any species of the genus Candida. Voriconazole (for which specific antifungal breakpoints have not been established) had MIC50 and MIC90 of 4 and 8, respectively. Among the fluconazole-resistant C. auris isolates, 17% (n = 19) showed cross-resistance to amphotericin B (MIC ≥ 2 μg/mL), and 3.6% (n = 4) exhibited high MIC values for 5-flucytosine (≥32 μg/mL). Notably, among all the samples, only one isolate was resistant to the three classes of antifungal drugs (azoles, polyenes, pyrimidines) (0.89%). Echinocandins such as anidulafungin, micafungin and caspofungin showed strong activity (MIC ≤ 1 mg/mL) against 100% of C. auris strains. All isolates had wild-type echinocandin MICs. The antifungal susceptibility pattern with the STR genotype of 112 C. auris clinical isolates is presented on Figure 5. Additionally, correlation analysis results using Spearman’s coefficient revealed no statistically significant association between virulence factor (phospholipase and esterase) and antifungal susceptibility profiles (p > 0.05); see Table 5.

3.4. Microsatellite Length Polymorphism Genotyping

A total of fifteen distinct STR types were identified among 112 C. auris strains from 18 different hospitals in Russia (Table 6, Figure 5), differing from each other in one or two markers. A total of 53 studied strains of C. auris from 14 healthcare facilities in Saint Petersburg, the Leningrad Region, and Moscow, isolated from 2017 to 2023, were classified as the STR genotype I. These STR genotype I strains also included the first known isolated strain of C. auris (C1-E20) in Russia. The second most prevalent genotype was STR type IV, which differs from STR type I by a single repeat in the M3-IIb marker, suggesting it may represent a microevolutionary variant within the population. STR type IV was represented by 23 isolates from nine hospitals in three regions. Several STR genotypes (such as II, VI, VII, and XIV) were represented predominantly (or entirely) by single-hospital strains isolated during the COVID-19 pandemic. These data suggest a nosocomial origin within the STR type of C. auris isolates and their subsequent circulation within the healthcare settings. The remaining genotypes were represented by single strains from various hospitals. The most variable of the analyzed markers was M3-Ia, which exhibited eight distinct variants within the Russian population. In contrast, eight microsatellite markers (M2a, M2b, M2c, M3-Ib, M3-Ic, M9a, M9b, and M9c) showed no variation in STR number among all C. auris isolates included in this study.
Principal coordinate analysis (PCoA) of the Bruvo et al. distances between STR genotypes of the Candida auris strains from the Russian population revealed low variability among the studied isolates (Figure 6). The plot of the first two principal coordinates represents a “cloud” without the distinct clustering of strains, though small outliers corresponding to individual genotypes are present. The first identified strain of C. auris in Russia (C1-E20), classified as STR genotype I, is positioned near the center of the “cloud,” reflecting its foundational role within the studied population. Clustering of genotypes based on the year of strain isolation suggests the potential vectors of intrapopulation microevolution of C. auris strains in Russia.
When analyzing consecutive C. auris strains isolated from the different loci of the same patient over a long observation period, three pairs of isolates (C56-E20 and C131-E20, C57-E20 and C125-E20, C356-E20 and C359-E20) showed identical STR genotypes. However, in two patients (C150-E20 and C152-E20, C171-E20 and C237-E20), the genotypes of clinical isolates obtained from different locations were different. This may be attributed to either the microevolution of the strain during persistence in the host or possible reinfection through nosocomial transmission. The adequacy and reproducibility of the methods used were confirmed. For instance, independent consecutive isolated strains (C67-E20 and C158-E20, C144-E20 and C149-E20) from the same patient’s biomaterial after a short time interval had an identical STR genotype and antifungal susceptibility and enzymatic activity patterns.
In a comparative analysis of STR genotypes with the date of isolation of the strains, the source, susceptibility drug profile, and phospholipase and esterase activity, no significant correlations were identified. However, the phenotypic absence of phospholipase activity was observed exclusively among strains belonging to the STR genotype I.

4. Discussion

C. auris is an emerging yeast pathogen; currently, it is one of the four fungi classified as a high-priority health threat (according to WHO).
This study is the first to describe the population structure (based on microsatellite marker analysis), antifungal susceptibility patterns, and proteolytic enzyme expression of C. auris strains isolated in Russia. The genetic structure of the population was determined using the STR typing approach for C. auris, proposed by de Groot T. et al. [29,41]. This genotyping technique has proven to be a simple and high-resolution screening tool for leassessing genetic diversity in C. auris, with results comparable to whole-genome sequencing (WGS) analysis, as variations in STR markers correlate with single-nucleotide polymorphism (SNP) differences [30,32]. The discriminatory power of the proposed STR analysis enables the identification of both inter-clade genetic differences and relationships between isolates within a clade, such as those observed in outbreak clusters. The authors of the typing technique suggest that small inter-strain variations (copy number < 5) in STR markers with a repeat unit of 2–3 nucleotides should be considered as microevolutionary changes within an outbreak. However, more copy number variations in these STR markers or variation in a M9 STR marker strongly indicates that the isolates are not related [29].
During the analysis of 12 STR markers, all studied isolates were grouped into 15 genotypes, similar to the C. auris genotypes of South Asian origin (clade I), identified in a number of studies by our colleagues [29,33,42]. Thus, based on the ITS polymorphism assessment, STR typing, and previous WGS analysis of the C1-E20 strain [28], we conclude that all Russian clinical isolates of C. auris belong to clade I and share a common South Asian ancestor.
The C. auris strain (C1-E20) was assigned to the most prevalent I STR genotype. The long period of I STR genotype strain isolation and their presence in the hospitals in all studied regions of the country allow us to consider it as the first genotype introduced into the territory of Russia. Genetic distances estimated based on the PCoA analysis (Figure 6) and small variations (copy number < 5) in STR markers between I and VIII genotypes indicate the intrapopulation microevolution of strains derived from genotype I in different hospitals. In addition, this genotype in Russia is apparently associated with the formation of nosocomial outbreaks of invasive candidiasis that are difficult to eradicate. The independent introduction of other strains (IX–XV genotypes), highly divergent from the I STR genotype, cannot currently be denied. A small number of isolates (n = 1–3) belonging to these genotypes suggests a community-acquired origin, outside of the healthcare system, and their lack of predisposition to nosocomial spread (the development of infectious processes with reduced contagiousness). However, to form conclusions, the further monitoring of clinical isolates of C. auris using this analysis scheme is necessary.
Studies by other authors also demonstrate the intrapopulation dominance of one specific STR genotype. Thus, when studying the molecular epidemiology of an outbreak of invasive candidiasis (n = 71), which lasted for 1.5 years in one of the medical institutions of Kuwait, and comparing STR typing data of clinical isolates of C. auris from other hospitals in the country, it was shown that all studied C. auris isolates belong to South Asian clade I, are very closely related to isolates from India and Oman, and differ only at one M3-Ia locus [43]. In total, three STR genotypes variable for M3-Ia were isolated in Kuwait, with the dominance of one genotype 1c, associated with the first isolate of C. auris documented in Kuwait, and the remaining two genotypes were represented in strains from single patients. The researchers concluded that clade I isolates of C. auris have been transmitted over many years in Kuwait, undergoing microevolution in various healthcare facilities. This process led to the emergence of three distinct genotypes of clade I, with genotype 1c being specifically linked to nosocomial outbreaks of invasive candidiasis.
It should be noted that the M3-Ia locus is the most variable marker, both according to the results of our study and global research, reflecting microevolutionary changes in outbreak studies [29,42,44]. Our study showed the simultaneous presence in the same patient of C. auris strains with distinct STR genotypes variable at the M3-Ia locus (per one repeat), which were isolated from different biological materials (blood, urine, etc.). A similar case was previously described in a study by our colleagues that studied the nosocomial transmission dynamics of C. auris in a referral chest hospital in India. In patient D, C. auris strains were found from different body sites (ear, nose, groin), which differed only in copy number (2 or 4) of the M3-Ia locus [32]. However, despite its variability and mutational plasticity, it can possibly serve as a marker of adaptive evolution and influence the transmissibility, epidemic potential, and disease emergence of C. auris isolates.
The virulence of the polyphyletic genus Candida, to which C. auris belongs, is also associated with the production of multiple hydrolytic enzymes that facilitate invasion into host tissues by damaging cell surface structures and degrading various host proteins [19,45]. Several studies have demonstrated that the higher expression of phospholipase and esterase correlates with the higher virulence of strains, confirming their roles as key pathogenicity factors. C. auris strains tested across different geographical regions exhibit-varying levels of phospholipase and esterase activities. This fact may be associated with both the geographical clade of the species and the strain-specific characteristics [46]. Thus, of 107 isolates from two cities in Colombia, phospholipase activity was observed in 67.3% of 107 C. auris isolates [47]. Various studies on the phospholipase activity of Candida species demonstrate a possible correlation between the locus of isolates and enzyme activity [20,48]. In our study, C. auris strains isolated from urine have a higher phospholipase activity than that of strains from blood. However, esterase activity was uniformly high across all strains.
Currently, the recommended first-line drugs for treating invasive candidiasis in the intensive care units (ICUs) are limited to echinocandins and azoles. Taking into account that the resistance of C auris isolates to fluconazole is nearly universal, especially among clade I [49], de-escalation therapy for invasive candidiasis caused by this pathogen is limited to one class of antifungal drugs [50]. However, the frequency of resistance to echinocandins in clinical C auris isolates is increasing worldwide. According to published data, it is reported that echinocandin resistance has increased from 0% to 4% in New York from 2016 to 2020 [51]. The current results showed that the vast majority of Russian C. auris strains are resistant to fluconazole, while resistance to echinocandins was not detected among them. Therefore, at present (based on the high fungicidal activity against most strains of C auris), echinocandins are the only alternative for effective and safe therapy of invasive candidiasis in ICU conditions.
Amphotericin B and 5-flucytosine are less recommended due to potential toxicity as well as poor activity against urinary tract infections for amphotericin B and rapid development of resistance in monotherapy for 5-flucytosine. However, the narrow spectrum of antifungal drugs that are potentially effective against infections caused by C. auris does not preclude their use in clinical practice [50]. In most populations, resistance to amphotericin B in C. auris isolates ranges from 0% to 30% [52,53]. The resistance of Russian C. auris strains falls within this range and is 17%. There is no CDC advisory for flucytosine breakpoints, and we note four Candida auris isolates with an MIC value of ≥32 μg/mL. Flucytosine is used less frequently compared to other antifungal agents; fewer studies have been conducted to detect C. auris resistance. These four strains were isolated from patients from intensive care units of three hospitals in Moscow. Two strains, C285-E20 and C310-E20, were isolated from different patients placed in different departments of the same hospital with a one-month difference in isolation. Two other strains, C374-E20 and C245-E20, were isolated from non-communicating hospitals. Unfortunately, we have no data on the possible flucytosine therapy administered to these patients.
Although preliminary MIC breakpoints are suggested by the CDC for only five drugs (fluconazole, amphotericin, anidulafungin, caspofungin, and micafungin), it is also important to monitor susceptibility levels for other antifungal drugs in order to determine, in a timely manner, the trends in increasing resistance in this potentially multidrug-resistant pathogen.
The current study has a number of limitations. First, the studied C. auris strains had limited metadata such as geographic region, site of infection, healthcare facilities, gender, and age of the patient. There are no data on patient outcome, possible pharmacotherapy (antifungal medications), and epidemiological anamnesis. Second, this research was retrospective; therefore, the environmental studies of healthcare facilities were not carried out according to the recommendations. This fact makes it difficult to determine the sources and routes of pathogen transmission within hospitals, as well as predisposing factors for the nosocomial persistence of strains and the emergence of genetic diversity (microevolutionary changes). Third, because there are no universally accepted breakpoints for all antifungals against C. auris, antifungal susceptibility for some drugs has been interpreted based on the MIC and by comparison with breakpoints for other species. Fourth, the study is limited to three geographical regions; since at the time when this study was conducted, there was no information on C. auris isolation in hospitals of other cities.

5. Conclusions

This study is the first to explore the genetic diversity of Candida auris strains circulating in Russian healthcare facilities, based on short tandem repeat (STR) lengths, antifungal susceptibility profiles, and enzymatic activity. The utility of STR analysis for epidemiological monitoring, tracking global emergence, and understanding transmission dynamics of this pathogen is demonstrated. Our findings reveal the predominance of a single STR genotype (I) in most hospitals across Russia and identify a specific genotype (M3-Ia locus) that is presumably linked to transmissibility, epidemic potential, and the occurrence of nosocomial outbreaks of invasive candidiasis caused by C. auris. Ultimately, the integration of genetic information into anti-epidemic measures, along with the appropriate selection of antifungal agents based on susceptibility profiles, will aid in controlling the spread and transmission of this dangerous yeast pathogen in Russia.

Author Contributions

Conceptualization, N.V. and E.O.; methodology, E.O. and A.T.; validation E.O., V.K., S.K. and A.T., formal analysis, E.O. and V.K.; investigation, E.O., V.K., I.V., V.V., E.P. and S.G.; resources, O.O., A.K., S.G., N.V. and A.T.; data curation E.O., O.O., A.K., S.G., N.V. and A.T.; writing—original draft preparation, E.O.; writing—review and editing, A.T. and N.V.; visualization, E.O. and V.K.; supervision, A.T. and N.V.; project administration, N.V. All authors have read and agreed to the published version of the manuscript.

Funding

Research reported in this publication was supported by Russian Ministry of Health [Research topic: Genetic biomarkers and biological characteristics of Candida auris, the causative agent of contagious invasive candidiasis. No. 122012100283-8].

Institutional Review Board Statement

The local ethics committee of North-Western State Medical University named after I.I. Mechnikov approved this project (protocol no. 7 of 7 October 2020). This study was conducted according to the principles expressed in the Declaration of Helsinki (revised in 1983).

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.

Acknowledgments

We thank all the collaborators of Kashkin Research Institute of Medical Mycology for the insightful discussions concerning the topic of this manuscript. We would like to thank Moshkevich I.R. and Kozlova O.P. for their contributions to the C. auris isolated collection. We also thank Marochkovich O.A. and Rusetskaya E.V. for the species identification of the studied strains using ITS sequencing and Chilina G.A. and Bosak I.A. for assistance in maintaining the collection of C. auris isolates and preparing samples. Furthermore, the authors are grateful to George Mamulashvili for helping with the English language.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Rodrigues, M.L.; Albuquerque, P.C. Searching for a Change: The Need for Increased Support for Public Health and Research on Fungal Diseases. PLoS Negl. Trop. Dis. 2018, 12, e0006479. [Google Scholar] [CrossRef] [PubMed]
  2. Brown, G.D.; Denning, D.W.; Gow, N.A.R.; Levitz, S.M.; Netea, M.G.; White, T.C. Hidden Killers: Human Fungal Infections. Sci. Transl. Med. 2012, 4, 165rv13. [Google Scholar] [CrossRef] [PubMed]
  3. Mba, I.E.; Nweze, E.I. Mechanism of Candida Pathogenesis: Revisiting the Vital Drivers. Eur. J. Clin. Microbiol. Infect. Dis. 2020, 39, 1797–1819. [Google Scholar] [CrossRef] [PubMed]
  4. Centers for Disease Control and Prevention (U.S.). Antibiotic Resistance Threats in the United States, 2019; Centers for Disease Control and Prevention (U.S.): Atlanta, GA, USA, 2019. [Google Scholar]
  5. WHO. Fungal Priority Pathogens List to Guide Research, Development and Public Health Action, 1st ed.; World Health Organization: Geneva, Switzerland, 2022; ISBN 978-92-4-006024-1. [Google Scholar]
  6. Jackson, B.R.; Chow, N.; Forsberg, K.; Litvintseva, A.P.; Lockhart, S.R.; Welsh, R.; Vallabhaneni, S.; Chiller, T. On the Origins of a Species: What Might Explain the Rise of Candida Auris? J. Fungi 2019, 5, 58. [Google Scholar] [CrossRef] [PubMed]
  7. Du, H.; Bing, J.; Hu, T.; Ennis, C.L.; Nobile, C.J.; Huang, G. Candida Auris: Epidemiology, Biology, Antifungal Resistance, and Virulence. PLOS Pathog. 2020, 16, e1008921. [Google Scholar] [CrossRef] [PubMed]
  8. Chow, N.A.; Muñoz, J.F.; Gade, L.; Berkow, E.L.; Li, X.; Welsh, R.M.; Forsberg, K.; Lockhart, S.R.; Adam, R.; Alanio, A.; et al. Tracing the Evolutionary History and Global Expansion of Candida Auris Using Population Genomic Analyses. MBio 2020, 11, 10–1128. [Google Scholar] [CrossRef]
  9. Muñoz, J.F.; Welsh, R.M.; Shea, T.; Batra, D.; Gade, L.; Howard, D.; Rowe, L.A.; Meis, J.F.; Litvintseva, A.P.; Cuomo, C.A. Clade-Specific Chromosomal Rearrangements and Loss of Subtelomeric Adhesins in Candida Auris. Genetics 2021, 218, iyab029. [Google Scholar] [CrossRef]
  10. Arora, P.; Singh, P.; Wang, Y.; Yadav, A.; Pawar, K.; Singh, A.; Padmavati, G.; Xu, J.; Chowdhary, A. Environmental Isolation of Candida Auris from the Coastal Wetlands of Andaman Islands, India. MBio 2021, 12, 10-1128. [Google Scholar] [CrossRef]
  11. Geronikou, A.; Larsen, N.; Lillevang, S.K.; Jespersen, L. Occurrence and Identification of Yeasts in Production of White-Brined Cheese. Microorganisms 2022, 10, 1079. [Google Scholar] [CrossRef] [PubMed]
  12. Yadav, A.; Jain, K.; Wang, Y.; Pawar, K.; Kaur, H.; Sharma, K.K.; Tripathy, V.; Singh, A.; Xu, J.; Chowdhary, A. Candida Auris on Apples: Diversity and Clinical Significance. MBio 2022, 13, e00518-22. [Google Scholar] [CrossRef] [PubMed]
  13. Glushakova, A.; Kachalkin, A.; Rodionova, E. The Role of Fruits as Reservoirs for Resistant and Virulent Strains of Opportunistic Yeasts. World J. Microbiol. Biotechnol. 2023, 39, 313. [Google Scholar] [CrossRef] [PubMed]
  14. Ahmad, S.; Alfouzan, W. Candida Auris: Epidemiology, Diagnosis, Pathogenesis, Antifungal Susceptibility, and Infection Control Measures to Combat the Spread of Infections in Healthcare Facilities. Microorganisms 2021, 9, 807. [Google Scholar] [CrossRef] [PubMed]
  15. Cristina, M.L.; Spagnolo, A.M.; Sartini, M.; Carbone, A.; Oliva, M.; Schinca, E.; Boni, S.; Pontali, E. An Overview on Candida Auris in Healthcare Settings. J. Fungi 2023, 9, 913. [Google Scholar] [CrossRef] [PubMed]
  16. Chybowska, A.D.; Childers, D.S.; Farrer, R.A. Nine Things Genomics Can Tell Us About Candida Auris. Front. Genet. 2020, 11, 351. [Google Scholar] [CrossRef]
  17. Mroczyńska, M.; Brillowska-Dąbrowska, A. Virulence of Clinical Candida Isolates. Pathogens 2021, 10, 466. [Google Scholar] [CrossRef] [PubMed]
  18. Sardi, J.C.O.; Scorzoni, L.; Bernardi, T.; Fusco-Almeida, A.M.; Mendes Giannini, M.J.S. Candida Species: Current Epidemiology, Pathogenicity, Biofilm Formation, Natural Antifungal Products and New Therapeutic Options. J. Med. Microbiol. 2013, 62, 10–24. [Google Scholar] [CrossRef]
  19. Ghannoum, M.A. Potential Role of Phospholipases in Virulence and Fungal Pathogenesis. Clin. Microbiol. Rev. 2000, 13, 122–143. [Google Scholar] [CrossRef] [PubMed]
  20. SBasu, H.C.; Gugnani, S.; Joshi, N. Gupta, Distribution of Candida species in different clinical sources in Delhi, India, and proteinase and phospholipase activity of Candida albicans isolates. Rev. Iberoam. Micol. 2003, 20, 137–140. [Google Scholar]
  21. Lockhart, S.R.; Etienne, K.A.; Vallabhaneni, S.; Farooqi, J.; Chowdhary, A.; Govender, N.P.; Colombo, A.L.; Calvo, B.; Cuomo, C.A.; Desjardins, C.A.; et al. Simultaneous Emergence of Multidrug-Resistant Candida Auris on 3 Continents Confirmed by Whole-Genome Sequencing and Epidemiological Analyses. Clin. Infect. Dis. 2017, 64, 134–140. [Google Scholar] [CrossRef] [PubMed]
  22. Chow, N.A.; de Groot, T.; Badali, H.; Abastabar, M.; Chiller, T.M.; Meis, J.F. Potential Fifth Clade of Candida Auris, Iran, 2018. Emerg. Infect. Dis. J.—CDC 2019, 25, 1780–1781. [Google Scholar] [CrossRef] [PubMed]
  23. Spruijtenburg, B.; Badali, H.; Abastabar, M.; Mirhendi, H.; Khodavaisy, S.; Sharifisooraki, J.; Taghizadeh Armaki, M.; de Groot, T.; Meis, J.F. Confirmation of Fifth Candida Auris Clade by Whole Genome Sequencing. Emerg. Microbes Infect. 2022, 11, 2405–2411. [Google Scholar] [CrossRef]
  24. Suphavilai, C.; Ko, K.K.K.; Lim, K.M.; Tan, M.G.; Boonsimma, P.; Chu, J.J.K.; Goh, S.S.; Rajandran, P.; Lee, L.C.; Tan, K.Y.; et al. Detection and Characterisation of a Sixth Candida Auris Clade in Singapore: A Genomic and Phenotypic Study. Lancet Microbe 2024, 5, 100878. [Google Scholar] [CrossRef] [PubMed]
  25. Muñoz, J.F.; Gade, L.; Chow, N.A.; Loparev, V.N.; Juieng, P.; Berkow, E.L.; Farrer, R.A.; Litvintseva, A.P.; Cuomo, C.A. Genomic Insights into Multidrug-Resistance, Mating and Virulence in Candida Auris and Related Emerging Species. Nat. Commun. 2018, 9, 5346. [Google Scholar] [CrossRef] [PubMed]
  26. Narayanan, A.; Vadnala, R.N.; Ganguly, P.; Selvakumar, P.; Rudramurthy, S.M.; Prasad, R.; Chakrabarti, A.; Siddharthan, R.; Sanyal, K. Functional and Comparative Analysis of Centromeres Reveals Clade-Specific Genome Rearrangements in Candida Auris and a Chromosome Number Change in Related Species. MBio 2021, 12, 10-1128. [Google Scholar] [CrossRef]
  27. Spivak, E.S.; Hanson, K.E. Candida Auris: An Emerging Fungal Pathogen. J. Clin. Microbiol. 2018, 56, 10-1128. [Google Scholar] [CrossRef] [PubMed]
  28. Pchelin, I.M.; Azarov, D.V.; Churina, M.A.; Ryabinin, I.A.; Vibornova, I.V.; Apalko, S.V.; Kruglov, A.N.; Sarana, A.M.; Taraskina, A.E.; Vasilyeva, N.V. Whole Genome Sequence of First Candida Auris Strain, Isolated in Russia. Med. Mycol. 2020, 58, 414–416. [Google Scholar] [CrossRef] [PubMed]
  29. De Groot, T.; Puts, Y.; Berrio, I.; Chowdhary, A.; Meis, J.F. Development of Candida Auris Short Tandem Repeat Typing and Its Application to a Global Collection of Isolates. MBio 2020, 11, e02971. [Google Scholar] [CrossRef] [PubMed]
  30. Cuomo, C.A.; Alanio, A. Tracking a Global Threat: A New Genotyping Method for Candida Auris. MBio 2020, 11, e00259-20. [Google Scholar] [CrossRef]
  31. Vatanshenassan, M.; Boekhout, T.; Mauder, N.; Robert, V.; Maier, T.; Meis, J.F.; Berman, J.; Then, E.; Kostrzewa, M.; Hagen, F. Evaluation of Microsatellite Typing, ITS Sequencing, AFLP Fingerprinting, MALDI-TOF MS, and Fourier-Transform Infrared Spectroscopy Analysis of Candida auris. J. Fungi 2020, 6, 146. [Google Scholar] [CrossRef] [PubMed]
  32. Yadav, A.; Singh, A.; Wang, Y.; van Haren, M.H.; Singh, A.; de Groot, T.; Meis, J.F.; Xu, J.; Chowdhary, A. Colonisation and Transmission Dynamics of Candida Auris among Chronic Respiratory Diseases Patients Hospitalised in a Chest Hospital, Delhi, India: A Comparative Analysis of Whole Genome Sequencing and Microsatellite Typing. J. Fungi 2021, 7, 81. [Google Scholar] [CrossRef] [PubMed]
  33. de Almeida, J.N.; Francisco, E.C.; Hagen, F.; Brandão, I.B.; Pereira, F.M.; Presta Dias, P.H.; de Miranda Costa, M.M.; de Souza Jordão, R.T.; de Groot, T.; Colombo, A.L. Emergence of Candida Auris in Brazil in a COVID-19 Intensive Care Unit. J. Fungi 2021, 7, 220. [Google Scholar] [CrossRef] [PubMed]
  34. Tsai, Y.-T.; Lu, P.-L.; Tang, H.-J.; Huang, C.-H.; Hung, W.-C.; Tseng, Y.-T.; Lee, K.-M.; Lin, S.-Y. The First Invasive Candida Auris Infection in Taiwan. Emerg. Microbes Infect. 2022, 11, 1867–1875. [Google Scholar] [CrossRef] [PubMed]
  35. White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and Direct Sequencing of Fungal Ribosomal RNA Genes for Phylogenetics. In PCR Protocols; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press: San Diego, CA, USA, 1990; pp. 315–322. ISBN 978-0-12-372180-8. [Google Scholar]
  36. Price, M.F.; Wilkinson, I.D.; Gentry, L.O. Plate Method for Detection of Phospholipase Activity in Candida Albicans. Sabouraudia 1982, 20, 7–14. [Google Scholar] [CrossRef] [PubMed]
  37. CLSI. Reference Method for Broth Dilution Antifungal Susceptibility Testing of Yeasts, 4th ed.; CLSI standard M27; Clinical and Laboratory Standards Institute: Philadelphia, PA, USA, 2017. [Google Scholar]
  38. Bruvo, R.; Michiels, N.K.; D’Souza, T.G.; Schulenburg, H. A Simple Method for the Calculation of Microsatellite Genotype Distances Irrespective of Ploidy Level. Mol. Ecol. 2004, 13, 2101–2106. [Google Scholar] [CrossRef] [PubMed]
  39. Clark, L.V.; Jasieniuk, M. POLYSAT: An R package for polyploid microsatellite analysis. Mol. Ecol. Resour. 2011, 11, 562–566. [Google Scholar] [CrossRef]
  40. Carolus, H.; Jacobs, S.; Lobo Romero, C.; Deparis, Q.; Cuomo, C.A.; Meis, J.F.; Van Dijck, P. Diagnostic Allele-Specific PCR for the Identification of Candida Auris Clades. J. Fungi 2021, 7, 754. [Google Scholar] [CrossRef] [PubMed]
  41. de Groot, T.; Spruijtenburg, B.; Parnell, L.A.; Chow, N.A.; Meis, J.F. Optimization and Validation of Candida auris Short Tandem Repeat Analysis. Microbiol. Spectr. 2022, 10, e02645-22. [Google Scholar] [CrossRef] [PubMed]
  42. Mohsin, J.; Weerakoon, S.; Ahmed, S.; Puts, Y.; Al Balushi, Z.; Meis, J.F.; Al-Hatmi, A.M.S. A Cluster of Candida Auris Blood Stream Infections in a Tertiary Care Hospital in Oman from 2016 to 2019. Antibiotics 2020, 9, 638. [Google Scholar] [CrossRef] [PubMed]
  43. Alfouzan, W.; Ahmad, S.; Dhar, R.; Asadzadeh, M.; Almerdasi, N.; Abdo, N.M.; Joseph, L.; de Groot, T.; Alali, W.Q.; Khan, Z.; et al. Molecular Epidemiology of Candida Auris Outbreak in a Major Secondary-Care Hospital in Kuwait. J. Fungi 2020, 6, 307. [Google Scholar] [CrossRef] [PubMed]
  44. Steinmann, J.; Schrauzer, T.; Kirchhoff, L.; Meis, J.F.; Rath, P.-M. Two Candida Auris Cases in Germany with No Recent Contact to Foreign Healthcare—Epidemiological and Microbiological Investigations. J. Fungi 2021, 7, 380. [Google Scholar] [CrossRef]
  45. Satala, D.; Juszczak, M.; Wronowska, E.; Surowiec, M.; Kulig, K.; Kozik, A.; Rapala-Kozik, M.; Karkowska-Kuleta, J. Similarities and Differences among Species Closely Related to Candida albicans: C. tropicalis, C. dubliniensis, and C. auris. Cell. Microbiol. 2022, 2022, 2599136. [Google Scholar] [CrossRef]
  46. Larkin, E.; Hager, C.; Chandra, J.; Mukherjee, P.K.; Retuerto, M.; Salem, I.; Long, L.; Isham, N.; Kovanda, L.; Borroto-Esoda, K.; et al. The Emerging Pathogen Candida Auris: Growth Phenotype, Virulence Factors, Activity of Antifungals, and Effect of SCY-078, a Novel Glucan Synthesis Inhibitor, on Growth Morphology and Biofilm Formation. Antimicrob. Agents Chemother. 2017, 61, e02396-16. [Google Scholar] [CrossRef] [PubMed]
  47. Shaban, S.; Patel, M.; Ahmad, A. Improved Efficacy of Antifungal Drugs in Combination with Monoterpene Phenols against Candida Auris. Sci. Rep. 2020, 10, 1162. [Google Scholar] [CrossRef] [PubMed]
  48. Zarei Mahmoudabadi, A.; Zarrin, M.; Miry, S. Phospholipase activity of Candida albicans isolated from vagina and urine samples. Jundishapur. J. Microbiol. 2010, 3, 169–173. [Google Scholar]
  49. Chakrabarti, A.; Sood, P. On the Emergence, Spread and Resistance of Candida Auris: Host, Pathogen and Environmental Tipping Points. J. Med. Microbiol. 2021, 70, 001318. [Google Scholar] [CrossRef]
  50. Pappas, P.G.; Kauffman, C.A.; Andes, D.R.; Clancy, C.J.; Marr, K.A.; Ostrosky-Zeichner, L.; Reboli, A.C.; Schuster, M.G.; Vazquez, J.A.; Walsh, T.J.; et al. Clinical Practice Guideline for the Management of Candidiasis: 2016 Update by the Infectious Diseases Society of America. Clin. Infect. Dis. 2016, 62, e1–e50. [Google Scholar] [CrossRef]
  51. Kilburn, S.; Innes, G.; Quinn, M.; Southwick, K.; Ostrowsky, B.; Greenko, J.A.; Lutterloh, E.; Greeley, R.; Magleby, R.; Chaturvedi, V.; et al. Antifungal Resistance Trends of Candida Auris Clinical Isolates in New York and New Jersey from 2016 to 2020. Antimicrob. Agents Chemother. 2022, 66, e02242-21. [Google Scholar] [CrossRef]
  52. Chowdhary, A.; Prakash, A.; Sharma, C.; Kordalewska, M.; Kumar, A.; Sarma, S.; Tarai, B.; Singh, A.; Upadhyaya, G.; Upadhyay, S.; et al. A Multicentre Study of Antifungal Susceptibility Patterns among 350 Candida Auris Isolates (2009–17) in India: Role of the ERG11 and FKS1 Genes in Azole and Echinocandin Resistance. J. Antimicrob. Chemother. 2018, 73, 891–899. [Google Scholar] [CrossRef] [PubMed]
  53. Calvo, B.; Melo, A.S.A.; Perozo-Mena, A.; Hernandez, M.; Francisco, E.C.; Hagen, F.; Meis, J.F.; Colombo, A.L. First Report of Candida Auris in America: Clinical and Microbiological Aspects of 18 Episodes of Candidemia. J. Infect. 2016, 73, 369–374. [Google Scholar] [CrossRef] [PubMed]
Figure 1. The nucleotide polymorphism of the ITS rDNA region of different C. auris clades. (A) A phylogenetic tree generated by the maximum likelihood analysis of C. auris ITS rDNA sequences. (B) ITS rDNA sequence alignment. A clade-specific area of the ITS region is highlighted in a frame. Five typed strains from five different clades [30], submitted with their GenBank accessions, and two strain studied in this study, represented by the numbers C512−E20 and C536−E20. Four ITS-based clusters are shown: clades I and III, clade II, clade IV, and clade V.
Figure 1. The nucleotide polymorphism of the ITS rDNA region of different C. auris clades. (A) A phylogenetic tree generated by the maximum likelihood analysis of C. auris ITS rDNA sequences. (B) ITS rDNA sequence alignment. A clade-specific area of the ITS region is highlighted in a frame. Five typed strains from five different clades [30], submitted with their GenBank accessions, and two strain studied in this study, represented by the numbers C512−E20 and C536−E20. Four ITS-based clusters are shown: clades I and III, clade II, clade IV, and clade V.
Jof 11 00035 g001
Figure 2. Examples of different groups of phospholipase activity of Candida auris strains.
Figure 2. Examples of different groups of phospholipase activity of Candida auris strains.
Jof 11 00035 g002
Figure 3. Esterase activity isolates of Candida auris.
Figure 3. Esterase activity isolates of Candida auris.
Jof 11 00035 g003
Figure 4. Phospholipase production by C. auris strains isolated from blood and urine.
Figure 4. Phospholipase production by C. auris strains isolated from blood and urine.
Jof 11 00035 g004
Figure 5. A phylogenetic tree of 112 Candida auris strains isolated in Russia, generated using the STR Bruvo distance matrix with the MEGA 11 software. The UPGMA dendrogram illustrates the genotyping of the 112 Candida auris isolates based on the STR data, with supplementary information on antifungal susceptibility profiles and enzymatic activity. The numbers of strains isolated from biomaterial of the same patients are highlighted in the same color. The absence of phospholipase activity is indicated by pink color.
Figure 5. A phylogenetic tree of 112 Candida auris strains isolated in Russia, generated using the STR Bruvo distance matrix with the MEGA 11 software. The UPGMA dendrogram illustrates the genotyping of the 112 Candida auris isolates based on the STR data, with supplementary information on antifungal susceptibility profiles and enzymatic activity. The numbers of strains isolated from biomaterial of the same patients are highlighted in the same color. The absence of phospholipase activity is indicated by pink color.
Jof 11 00035 g005
Figure 6. PCoA analysis using Bruvo et al. distance of genetic diversity between C. auris isolates included in this study. G-STR genotype; next to the genotype are the years in which the strains were isolated. The genotypes highlighted in the oval have the greatest distances from the most represented genotype in the population.
Figure 6. PCoA analysis using Bruvo et al. distance of genetic diversity between C. auris isolates included in this study. G-STR genotype; next to the genotype are the years in which the strains were isolated. The genotypes highlighted in the oval have the greatest distances from the most represented genotype in the population.
Jof 11 00035 g006
Table 1. The major characteristics of Candida auris strains.
Table 1. The major characteristics of Candida auris strains.
CharacteristicNo. (%)
Localization
Blood60 (53.57%)
Central venous catheter13 (11.60%)
Urine25 (22.30%)
Urine catheter7 (6.25%)
BAL1 (0.90%)
Sputum3 (2.68%)
Pus1 (0.90%)
Throat swab1 (0.90%)
Environmental object1 (0.90%)
Isolation year
20171 (0.90%)
20183 (2.68%)
20194 (3.57%)
202018 (16.07%)
202149 (43.75%)
202235 (31.25%)
20232 (1.78%)
Table 2. Amplification primers used for microsatellite genotyping of Candida auris isolates.
Table 2. Amplification primers used for microsatellite genotyping of Candida auris isolates.
MarkerPrimer Sequence (5′–3′)Repeat Unit
Forward PrimerReverse Primer
M2a FAM-GCAACATCCTGAGCAGTATCAC GGTGTTGACGTGCCCAAATATGC AG
M2b HEX-CCACTCCGTTTTGGGTCTG AGAGAATCTACAAATGTGTCGC AG
M2c ROX-CTGTTTCTGTGGCAGGCTTCC GCCACGTTTCACYGCYACCAT AG
M3-Ia FAM-GCATGGATCAACAGCTAACAG AGTGCCAGGCTGTGTACTTTTG CAA
M3-Ib HEX-CATCCTAACGCTGGCTCTTC GGYTTTGAGGYTGCCCTAGC CAA
M3-Ic ROX-GCAACTACGCATTGTGTATTC CTAACAGAGGATTTCAATTGCC TTA
M3-IIa FAM-GTTCAAAATCGCTGACGGTC GAGATGATGATGGCACTTGC CTA
M3-IIb HEX-GTGAATGGAGCACCACAACCAG GCGCAAATGACTGGCCCATG GTA
M3-IIc ROX-GTGATGAGCGCACTACACAGG GGCGAAGAAACGGTGAGTAC CTA
M9a FAM-CTTGTCTAGTTTGCGATCTACGC GAGACTGCCAAGCCAAGC GATGATGAA
M9b HEX-CTGCTTACTGGAGACTCTTCC GATGAGGAGGACGAGGACG TCATCGTCA
M9c ROX-GTACGAAATGGGGATAATTGGG ACCAACCGTGCTATTCTC TCCTTCTTC
Table 3. Phospholipase activity of C. auris isolates.
Table 3. Phospholipase activity of C. auris isolates.
Sample TypePhospholipase Activity, Pz
<0.69 (++++)0.70–0.79 (+++)0.80–0.89 (++)0.90–0.99 (+)1.00 (−)
Urine (n = 32)25 (78.12%)3 (9.38%)3 (9.38%)1 (3.16%)0 (0%)
Blood (n = 73)37 (50.68%)11 (15.07%)17 (23.29%)4 (5.48%)4 (5.48%)
Other localization (n = 7)6 (85.71%)1 (14.29%)0 (0%)0 (0%)0 (0%)
All (n = 112)68 (60.71%)15 (13.40%)20 (17.86)5 (4.46%)4 (3.57%)
Activity level: −, Pz  =  1 (no phospholipase activity); +, Pz  =  0.90 to 0.99 (weak phospholipase activity); ++, Pz  =  0.80 to 0.89 (medium phospholipase activity); +++, Pz  =  0.70 to 0.79 (strong phospholipase activity); ++++, Pz  =  < 0.69 (very strong phospholipase activity).
Table 4. In vitro antifungal susceptibility profile of C. auris isolates (n = 112).
Table 4. In vitro antifungal susceptibility profile of C. auris isolates (n = 112).
Antifungal DrugsMIC Range (μg/mL)MIC50MIC90MIC (μg/mL)
(μg/mL)(μg/mL)≥256128643284210.50.250.125≤0.060.030.015
AmB0.25–212 1957324
VOR0.015–848 33371865444 1
ITR0.015–20.51 121491781312
PZ0.015–10.250.5 53140184113
FCZ8–≥256256256936571
AND0.015–0.50.120.25 120651943
CAS0.06–0.50.250.25 849478
MCF0.015–10.120.25 1410553561
FC-5≤0.06–≥640.060.12 22 12580
AmB—amphotericin; VOR—voriconazole; ITR—itraconazole; PZ—posaconazole; FCZ—fluconazole; AND—anidulafungin; CAS—caspofungin; MCF—micafungin; FC-5—flucytosine.
Table 5. Correlation coefficients between virulence factors and antifungal MICs in C. auris isolates.
Table 5. Correlation coefficients between virulence factors and antifungal MICs in C. auris isolates.
Antifungal DrugsVirulence Factors (p-Value)
EsterasePhospholipase
AmB−0.002 (0.986)0.070 (0.462)
VOR−0.001 (0.992)−0.220 (0.200)
ITR0.085 (0.375)−0.162 (0.087)
PZ0.096 (0.312)−0.225 (0.017)
FCZ0.025 (0.795)−0.033 (0.726)
AND0.052 (0.584)0.018 (0.849)
CAS−0.075 (0.432)−0.006 (0.949)
MCF0.092 (0.332)0.045 (0.635)
FC-5−0.086 (0.367)−0.077 (0.419)
Table 6. STR genotypes of 112 C. auris isolates of Russia.
Table 6. STR genotypes of 112 C. auris isolates of Russia.
GenotypeM2aM2bM2cM3-1aM3-1bM3-1cM3-2aM3-2bM3-2cM9aM9bM9cNo. of IsolatesNo. of Hospitals
GI66199621018362922191195314
GII661996210183729221911992
GIII661996210183629231911911
GIV6619962101836302219119239
GV661996210193730221911911
GVI661996210183730221911961
GVII661996310183629221911972
GVIII661996410183629221911922
GIX661997010183629221911922
GX661996910183729221911911
GXI661995510183629231911911
GXII661995410183629221911911
GXIII661995310183629221911911
GXIV661994910183629221911931
GXV661995410183629291911911
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Oganesyan, E.; Klimenteva, V.; Vybornova, I.; Venchakova, V.; Parshikova, E.; Kovyrshin, S.; Orlova, O.; Kruglov, A.; Gordeeva, S.; Vasilyeva, N.; et al. Population Structure Based on Microsatellite Length Polymorphism, Antifungal Susceptibility Profile, and Enzymatic Activity of Candida auris Clinical Isolates in Russia. J. Fungi 2025, 11, 35. https://doi.org/10.3390/jof11010035

AMA Style

Oganesyan E, Klimenteva V, Vybornova I, Venchakova V, Parshikova E, Kovyrshin S, Orlova O, Kruglov A, Gordeeva S, Vasilyeva N, et al. Population Structure Based on Microsatellite Length Polymorphism, Antifungal Susceptibility Profile, and Enzymatic Activity of Candida auris Clinical Isolates in Russia. Journal of Fungi. 2025; 11(1):35. https://doi.org/10.3390/jof11010035

Chicago/Turabian Style

Oganesyan, Ellina, Victoria Klimenteva, Irina Vybornova, Valentina Venchakova, Ekaterina Parshikova, Sergey Kovyrshin, Olga Orlova, Alexander Kruglov, Svetlana Gordeeva, Natalya Vasilyeva, and et al. 2025. "Population Structure Based on Microsatellite Length Polymorphism, Antifungal Susceptibility Profile, and Enzymatic Activity of Candida auris Clinical Isolates in Russia" Journal of Fungi 11, no. 1: 35. https://doi.org/10.3390/jof11010035

APA Style

Oganesyan, E., Klimenteva, V., Vybornova, I., Venchakova, V., Parshikova, E., Kovyrshin, S., Orlova, O., Kruglov, A., Gordeeva, S., Vasilyeva, N., & Taraskina, A. (2025). Population Structure Based on Microsatellite Length Polymorphism, Antifungal Susceptibility Profile, and Enzymatic Activity of Candida auris Clinical Isolates in Russia. Journal of Fungi, 11(1), 35. https://doi.org/10.3390/jof11010035

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop