Rosmarinic Acid Exhibits Antifungal and Antibiofilm Activities Against Candida albicans: Insights into Gene Expression and Morphological Changes
Abstract
:1. Introduction
2. Materials and Methods
2.1. Candida Strains
2.2. Antifungal Susceptibility Testing
2.3. Biofilm Formation and Inhibition
2.4. The Effect of Rosmarinic Acid on Adhesion, Hyphae and Biofilm-Related Gene Expression
2.5. Field Emission Scanning Electron Microscopy (FESEM)
2.6. Statistical Analysis
3. Results
3.1. Antifungal Activity
3.2. Biofilm-Forming Capacity and Anti-Biofilm Activity
3.3. Biofilm-Related Gene Expressions
3.4. FESEM Analysis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Li, H.; Miao, M.X.; Jia, C.L.; Cao, Y.B.; Yan, T.H.; Jiang, Y.Y.; Yang, F. Interactions between Candida albicans and the resident microbiota. Front. Microbiol. 2022, 13, 930495. [Google Scholar] [CrossRef] [PubMed]
- Mba, I.E.; Nweze, E.I. Mechanism of Candida pathogenesis: Revisiting the vital drivers. Eur. J. Clin. Microbiol. Infect. Dis. 2020, 39, 1797–1819. [Google Scholar] [CrossRef]
- Barantsevich, N.; Barantsevich, E. Diagnosis and Treatment of Invasive Candidiasis. Antibiotics 2022, 11, 718. [Google Scholar] [CrossRef] [PubMed]
- Salazar, S.B.; Simões, R.S.; Pedro, N.A.; Pinheiro, M.J.; Carvalho, M.F.N.N.; Mira, N.P. An Overview on Conventional and Non-Conventional Therapeutic Approaches for the Treatment of Candidiasis and Underlying Resistance Mechanisms in Clinical Strains. J. Fungi 2020, 6, 23. [Google Scholar] [CrossRef]
- Hernández-Pabón, J.C.; Tabares, B.; Gil, Ó.; Lugo-Sánchez, C.; Santana, A.; Barón, A.; Firacative, C. Candida Non-albicans and Non-auris Causing Invasive Candidiasis in a Fourth-Level Hospital in Colombia: Epidemiology, Antifungal Susceptibility, and Genetic Diversity. J. Fungi 2024, 10, 326. [Google Scholar] [CrossRef] [PubMed]
- Whaley, S.G.; Berkow, E.L.; Rybak, J.M.; Nishimoto, A.T.; Barker, K.S.; Rogers, P.D. Azole Antifungal Resistance in Candida albicans and Emerging Non-albicans Candida Species. Front. Microbiol. 2017, 7, 2173. [Google Scholar] [CrossRef]
- Kitaya, S.; Kanamori, H.; Katori, Y.; Tokuda, K. Clinical Features and Outcomes of Persistent Candidemia Caused by Candida albicans versus Non-albicans Candida Species: A Focus on Antifungal Resistance and Follow-Up Blood Cultures. Microorganisms 2023, 11, 928. [Google Scholar] [CrossRef]
- Arastehfar, A.; Gabaldón, T.; Garcia-Rubio, R.; Jenks, J.D.; Hoenigl, M.; Salzer, H.J.F.; Ilkit, M.; Lass-Flörl, C.; Perlin, D.S. Drug-Resistant Fungi: An Emerging Challenge Threatening Our Limited Antifungal Armamentarium. Antibiotics 2020, 9, 877. [Google Scholar] [CrossRef]
- Silva, L.N.; de Mello, T.P.; de Souza Ramos, L.; Branquinha, M.H.; Dos Santos, A.L.S. New and Promising Chemotherapeutics for Emerging Infections Involving Drug-resistant Non-albicans Candida Species. Curr. Top. Med. Chem. 2019, 19, 2527–2553. [Google Scholar] [CrossRef]
- Chow, E.W.L.; Pang, L.M.; Wang, Y. From Jekyll to Hyde: The Yeast-Hyphal Transition of Candida albicans. Pathogens 2021, 10, 859. [Google Scholar] [CrossRef]
- Watchaputi, K.; Jayasekara, L.A.C.B.; Ratanakhanokchai, K.; Soontorngun, N. Inhibition of cell cycle-dependent hyphal and biofilm formation by a novel cytochalasin 19,20-epoxycytochalasin Q in Candida albicans. Sci. Rep. 2023, 13, 9724. [Google Scholar] [CrossRef] [PubMed]
- Poon, Y.; Hui, M. Inhibitory effect of lactobacilli supernatants on biofilm and filamentation of Candida albicans, Candida tropicalis, and Candida parapsilosis. Front. Microbiol. 2023, 14, 1105949. [Google Scholar] [CrossRef]
- Malinovská, Z.; Čonková, E.; Váczi, P. Biofilm Formation in Medically Important Candida Species. J. Fungi 2023, 9, 955. [Google Scholar] [CrossRef]
- Kaur, J.; Nobile, C.J. Antifungal drug-resistance mechanisms in Candida biofilms. Curr. Opin. Microbiol. 2023, 71, 102237. [Google Scholar] [CrossRef] [PubMed]
- Czajka, K.M.; Venkataraman, K.; Brabant-Kirwan, D.; Santi, S.A.; Verschoor, C.; Appanna, V.D.; Singh, R.; Saunders, D.P.; Tharmalingam, S. Molecular Mechanisms Associated with Antifungal Resistance in Pathogenic Candida Species. Cells 2023, 12, 2655. [Google Scholar] [CrossRef] [PubMed]
- Bandara, H.M.; Matsubara, V.H.; Samaranayake, L.P. Future therapies targeted towards eliminating Candida biofilms and associated infections. Expert. Rev. Anti-Infect. Ther. 2017, 15, 299–318. [Google Scholar] [CrossRef]
- Mota Fernandes, C.; Dasilva, D.; Haranahalli, K.; McCarthy, J.B.; Mallamo, J.; Ojima, I.; Del Poeta, M. The Future of Antifungal Drug Therapy: Novel Compounds and Targets. Antimicrob. Agents Chemother. 2021, 65, e01719-20. [Google Scholar] [CrossRef]
- Fisher, M.C.; Alastruey-Izquierdo, A.; Berman, J.; Bicanic, T.; Bignell, E.M.; Bowyer, P.; Bromley, M.; Brüggemann, R.; Garber, G.; Cornely, O.A.; et al. Tackling the emerging threat of antifungal resistance to human health. Nat. Rev. Microbiol. 2022, 20, 557–571. [Google Scholar] [CrossRef]
- Nasim, N.; Sandeep, I.S.; Mohanty, S. Plant-derived natural products for drug discovery: Current approaches and prospects. Nucleus 2022, 65, 399–411. [Google Scholar] [CrossRef]
- Guan, H.; Luo, W.; Bao, B.; Cao, Y.; Cheng, F.; Yu, S.; Fan, Q.; Zhang, L.; Wu, Q.; Shan, M. A Comprehensive Review of Rosmarinic Acid: From Phytochemistry to Pharmacology and Its New Insight. Molecules 2022, 27, 3292. [Google Scholar] [CrossRef]
- Nadeem, M.; Imran, M.; Gondal, T.A.; Imran, A.; Shahbaz, M.; Amir, R.M.; Sajid, M.W.; Qaisrani, T.B.; Atif, M.; Hussain, G.; et al. Therapeutic potential of rosmarinic acid: A comprehensive review. Appl. Sci. 2019, 9, 3139. [Google Scholar] [CrossRef]
- Marchev, A.S.; Vasileva, L.V.; Amirova, K.M.; Savova, M.S.; Koycheva, I.K.; Balcheva-Sivenova, Z.P.; Vasileva, S.M.; Georgiev, M.I. Rosmarinic acid-From bench to valuable applications in food industry. Trends Food Sci. Technol. 2021, 117, 182–193. [Google Scholar] [CrossRef]
- Noor, S.; Mohammad, T.; Rub, M.A.; Raza, A.; Azum, N.; Yadav, D.K.; Hassan, M.I.; Asiri, A.M. Biomedical features and therapeutic potential of rosmarinic acid. Arch. Pharm. Res. 2022, 45, 205–228. [Google Scholar] [CrossRef] [PubMed]
- Ekambaram, S.P.; Perumal, S.S.; Balakrishnan, A.; Marappan, N.; Gajendran, S.S.; Viswanathan, V. Antibacterial synergy between rosmarinic acid and antibiotics against methicillin-resistant Staphylococcus aureus. J. Intercult. Ethnopharmacol. 2016, 5, 358–363. [Google Scholar] [CrossRef] [PubMed]
- Kernou, O.N.; Azzouz, Z.; Madani, K.; Rijo, P. Application of Rosmarinic Acid with Its Derivatives in the Treatment of Microbial Pathogens. Molecules 2023, 28, 4243. [Google Scholar] [CrossRef]
- Cheah, H.L.; Lim, V.; Sandai, D. Inhibitors of the glyoxylate cycle enzyme ICL1 in Candida albicans for potential use as antifungal agents. PLoS ONE 2014, 9, e95951. [Google Scholar] [CrossRef]
- Bittner Fialová, S.; Kello, M.; Čoma, M.; Slobodníková, L.; Drobná, E.; Holková, I.; Garajová, M.; Mrva, M.; Zachar, V.; Lukáč, M. Derivatization of Rosmarinic Acid Enhances its in vitro Antitumor, Antimicrobial and Antiprotozoal Properties. Molecules 2019, 24, 1078. [Google Scholar] [CrossRef]
- Ivanov, M.; Kostić, M.; Stojković, D.; Soković, M. Rosmarinic acid–Modes of antimicrobial and antibiofilm activities of common plant polyphenol. S. Afr. J. Bot. 2022, 146, 521–527. [Google Scholar] [CrossRef]
- Clinical Laboratory Standards Institute. Reference Method for Broth Dilution Antifungal Susceptibility Testing of Yeasts, Fourth Informational Supplement; CLSI: Wayne, PA, USA, 2012. [Google Scholar]
- Sumlu, E.; Aydin, M.; Korucu, E.N.; Alyar, S.; Nsangou, A.M. Artemisinin May Disrupt Hyphae Formation by Suppressing Biofilm-Related Genes of Candida albicans: In Vitro and In Silico Approaches. Antibiotics 2024, 13, 310. [Google Scholar] [CrossRef]
- Stepanovic, S.; Vuković, D.; Hola, V.; Bonaventura, G.D.; Djukić, S.; Ćirković, I.; Ruzicka, F. Quantification of biofilm in microtiterplates: Overview of testing conditions and practical recommendations for assessment of biofilm production by staphylococci. APMIS 2007, 115, 891–899. [Google Scholar] [CrossRef]
- Lobiuc, A.; Pavăl, N.E.; Mangalagiu, I.I.; Gheorghiță, R.; Teliban, G.C.; Amăriucăi-Mantu, D.; Stoleru, V. Future Antimicrobials: Natural and Functionalized Phenolics. Molecules 2023, 28, 1114. [Google Scholar] [CrossRef] [PubMed]
- Poli, J.P.; Guinoiseau, E.; Luciani, A.; Yang, Y.; Battesti, M.J.; Paolini, J.; Costa, J.; Quilichini, Y.; Berti, L.; Lorenzi, V. Key role of hydrogen peroxide in antimicrobial activity of spring, Honeydew maquis and chestnut grove Corsican honeys on Pseudomonas aeruginosa DNA. Lett. Appl. Microbiol. 2018, 66, 427–433. [Google Scholar] [CrossRef] [PubMed]
- Yue, D.; Zheng, D.; Bai, Y.; Yang, L.; Yong, J.; Li, Y. Insights into the anti-Candida albicans properties of natural phytochemicals: An in vitro and in vivo investigation. Phytother. Res. 2024, 38, 2518–2538. [Google Scholar] [CrossRef] [PubMed]
- Moreno, S.; Scheyer, T.; Romano, C.S.; Vojnov, A.A. Antioxidant and antimicrobial activities of rosemary extracts linked to their polyphenol composition. Free Radic. Res. 2006, 40, 223–231. [Google Scholar] [CrossRef]
- Wu, J.; Wu, D.; Zhao, Y.; Si, Y.; Mei, L.; Shao, J.; Wang, T.; Yan, G.; Wang, C. Sodium New Houttuyfonate Inhibits Candida albicans Biofilm Formation by Inhibiting the Ras1-cAMP-Efg1 Pathway Revealed by RNA-seq. Front. Microbiol. 2020, 11, 2075. [Google Scholar] [CrossRef]
- Wu, Y.; Sun, A.; Chen, F.; Zhao, Y.; Zhu, X.; Zhang, T.; Ni, G.; Wang, R. Synthesis, structure-activity relationship and biological evaluation of indole derivatives as anti-Candida albicans agents. Bioorg. Chem. 2024, 146, 107293. [Google Scholar] [CrossRef]
- Lu, Y.; Su, C.; Liu, H. Candida albicans hyphal initiation and elongation. Trends Microbiol. 2014, 22, 707–714. [Google Scholar] [CrossRef]
- Sharma, A.; Mitchell, A.P. Strain variation in gene expression impact of hyphal cyclin Hgc1 in Candida albicans. G3 2023, 13, jkad151. [Google Scholar] [CrossRef] [PubMed]
- Carlisle, P.L.; Kadosh, D. Candida albicans Ume6, a filament-specific transcriptional regulator, directs hyphal growth via a pathway involving Hgc1 cyclin-related protein. Eukaryot. Cell 2010, 9, 1320–1328. [Google Scholar] [CrossRef]
- McCall, A.D.; Pathirana, R.U.; Prabhakar, A.; Cullen, P.J.; Edgerton, M. Candida albicans biofilm development is governed by cooperative attachment and adhesion maintenance proteins. NPJ Biofilms Microbiomes 2019, 5, 21. [Google Scholar] [CrossRef]
- Garbe, E.; Thielemann, N.; Hohner, S.; Kumar, A.; Vylkova, S.; Kurzai, O.; Martin, R. Functional analysis of the Candida albicans ECE1 Promoter. Microbiol. Spectr. 2023, 11, e0025323. [Google Scholar] [CrossRef] [PubMed]
Genes | Primer | Sequence (5′→3′) |
---|---|---|
HWP1 | Forward | GCTCCTGCTCCTGAAATGAC |
Reverse | CTGGAGCAATTGGTGAGGTT | |
CYR1 | Forward | CCAACAAACGACCAAAAGGT |
Reverse | TCTTGAACTGCCAGACGATG | |
HGC1 | Forward | GCTTCCTGCACCTCATCAAT |
Reverse | AGCACGAGAACCAGCGATAC | |
EFG1 | Forward | GCCTCGAGCACTTCCACTGT |
Reverse | TTTTTTCATCTTCCCACATGGTAGT | |
UME6 | Forward | ACCACCACTACCACCACCAC |
Reverse | TATCCCCATTTCCAAGTCCA | |
ECE1 | Forward | TTGCTAATGCCGTCGTCAGA |
Reverse | GAACGACCATCTCTCTTGGCAT | |
RAS1 | Forward | TGGATGTTGTGTTATTGTTTGAGC |
Reverse | GTCTTGAATTGTTCATCTTCTCCCA | |
ALS3 | Forward | TCGTCCTCATTACACCAACCA |
Reverse | TGAAGTTGCAGATGGGGCTT | |
18S rRNA | Forward | AGAAACGGCTACCACATCCA |
Reverse | AGCCCAAGGTTCAACTACGA |
Species (Number) | MIC50 Range of FLC (μg/mL) | MIC50 Range of RA (μg/mL) |
---|---|---|
C. albicans [4] | 1–4 | 640–1280 |
C. lusitaniae [4] | 2–64 | 640–1280 |
C. glabrata [4] | 16–32 | 160–320 |
C. krusei [4] | 32 | 1280 |
C. kefyr [4] | 1–4 | 160–1280 |
C. parapsilosis [4] | 2–64 | 640–1280 |
C. albicans ATCC 10231 | 1 | 640 |
C. glabrata ATCC 90030 | 16 | 160 |
C. krusei ATCC 6258 | 64 | 320 |
C. parapsilosis ATCC 22019 | 2 | 640 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Aydin, M.; Unusan, N.; Sumlu, E.; Korucu, E.N. Rosmarinic Acid Exhibits Antifungal and Antibiofilm Activities Against Candida albicans: Insights into Gene Expression and Morphological Changes. J. Fungi 2024, 10, 751. https://doi.org/10.3390/jof10110751
Aydin M, Unusan N, Sumlu E, Korucu EN. Rosmarinic Acid Exhibits Antifungal and Antibiofilm Activities Against Candida albicans: Insights into Gene Expression and Morphological Changes. Journal of Fungi. 2024; 10(11):751. https://doi.org/10.3390/jof10110751
Chicago/Turabian StyleAydin, Merve, Nurhan Unusan, Esra Sumlu, and Emine Nedime Korucu. 2024. "Rosmarinic Acid Exhibits Antifungal and Antibiofilm Activities Against Candida albicans: Insights into Gene Expression and Morphological Changes" Journal of Fungi 10, no. 11: 751. https://doi.org/10.3390/jof10110751
APA StyleAydin, M., Unusan, N., Sumlu, E., & Korucu, E. N. (2024). Rosmarinic Acid Exhibits Antifungal and Antibiofilm Activities Against Candida albicans: Insights into Gene Expression and Morphological Changes. Journal of Fungi, 10(11), 751. https://doi.org/10.3390/jof10110751