Survey on the Presence of Bacterial and Parasitic Zoonotic Agents in the Feces of Wild Birds
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Ethical Statement
2.3. Bacteriological Analyses
| Pathogens | Amplicons (Target Gene) | Primers Sequence (5′—3′) | PCR Conditions | References |
|---|---|---|---|---|
| Brucella spp. | 905 bp (16SrRNA) | F4 (TCGAGCGCCCGCAAGGGG) R2 (AACCATAGTGTCTCCACTAA) | 95 °C—30 s 54 °C—90 s 72 °C—90 s For 50 cycles | [39] |
| Coxiella burnetii | 687 bp (IS1111a) | Trans-1 (TATGTATCCACCGTAGCCAGT) Trans-2 (CCCAACAACACCTCCTTATTC) | 95 °C—30 s 64 °C—1 min 72 °C—1 min For 40 cycles | [40] |
| Mycobacterium spp. | 1030 bp (16SrDNA) | MycogenF (AGAGTTTGATCCTGGCTCAG) MycogenR (TGCACACAGGCCACAAGGGA) | 95 °C—1 min 62 °C—2 min 72 °C—1 min For 40 cycles | [41] |
| Cryptosporidium spp. | 1325 bp (1st step) 826-864 bp (2nd step) (16SrDNA) | outcryF (TTCTAGAGCTAATACATGCG) outcryR (CCCATTTCCTTCGAAACAGGA) incryF (GGAAGGGTTGTATTTATTAGATAAAG) incryR (AAGGAGTAAGGAACAACCTCCA) | 94 °C—45 s 55 °C—45 s 72 °C—1 min For 35 cycles (1st and 2nd step) | [42] |
| Giardia spp. | 432 bp (2nd step) (gdh) | GDHeF (TCAACGTYAAYCGYGGYTTCCGT) GDHiR (GTTRTCCTTGCACATCTCC) GDHiF (CAGTACAACTCYGCTCTCGG) | 94 °C—1 min 56 °C—20 s 72 °C—45 s For 45 cycles | [43] |
| Microsporidia (Encephalitozoon spp. and Enterocitozoon spp.) | 250–280 pb (18SrRNA) | V1 (CACCAGGTTGATTCTGCCTGAC) PMP2 (CCTCTCCGGAACCAAACCCTG) | 94 °C—30 s 60 °C—30 s 72 °C—30 s For 35 cycles | [44] |
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Johnston, W.S.; MacLachlan, G.K.; Hopkins, G.F. The possible involvement of seagulls (Larus sp.) in the transmission of Salmonella in dairy cattle. Vet. Rec. 1979, 105, 526–527. [Google Scholar] [PubMed]
- Coulson, J.C.; Butterfield, J.; Thomas, C. The herring gull Larus argentatus as a likely transmitting agent of Salmonella Montevideo to sheep and cattle. J. Hyg. 1983, 91, 437–443. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fenlon, D.R. Wild birds and silage as reservoirs of Listeria in the agricultural environment. J. Appl. Bacteriol. 1985, 59, 537–543. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Graczyk, T.K.; Majewska, A.C.; Schwab, K.J. The role of birds in dissemination of human waterborne enteropathogens. Trends Parasitol. 2008, 24, 55–59. [Google Scholar] [CrossRef] [Scilit]
- Benskin, C.M.; Wilson, K.; Jones, K.; Hartley, I.R. Bacterial pathogens in wild birds: A review of the frequency and effects of infection. Biol. Rev. Camb. Philos. Soc. 2009, 84, 349–373. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Poester, F.; Samartino, L.; Santos, R. Pathogenesis and pathobiology of brucellosis in livestock. Rev. Sci. Tech. L’OIE 2013, 32, 105–115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ali, S.; Saleem, S.; Imran, M.; Rizwan, M.; Iqbal, K.; Qadir, G.; Ahmad, H.; Umar, S.; Khan, W.A.; Khan, I.; et al. Detection of Brucella antibodies in selected wild animals and avian species in Pakistan. Indian J. Anim. Res. 2018, 54, 478–481. [Google Scholar] [CrossRef] [Scilit]
- Alaga, A.A.; Ogah, D.M.; Attah, J. Seroprevalence of Brucellosis in Some Poultry Species in Nasarawa State, Nigeria. Egypt. Poult. Sci. 2012, 32, 705–709. [Google Scholar]
- Junaidu, A.U.; Salihu, M.D.; Ahmed, F.; Ambursa, M.A.; Gulumbe, M.L. Brucellosis in local chickens in North Western Nigeria. Int. J. Poult. Sci. 2006, 5, 547–549. [Google Scholar]
- Mushi, E.Z.; Binta, M.G.; Basupang, K.; Samakabadi, E.K. Brucella abortus antibodies in the sera of indigenous chickens around Gaborone, Botswana. J. Anim. Vet. Adv. 2008, 7, 1610–1612. [Google Scholar]
- Adamu, N.; Adamu, S.; Jajere, M.; Atsanda, N.; Mustapha, F.; Maina, M. Serological Survey of Brucellosis in Slaughtered Local Chickens, Guinea Fowls, Ducks and Turkey in North-Eastern Nigeria. Int. J. Poult. Sci. 2014, 13, 340–342. [Google Scholar] [CrossRef] [Scilit]
- Gugon, V.T.; Maurice, N.A.; Ngbede, E.O.; Hambolu, S.E.; Ajogi, I. Serological Evidence of Brucellosis in Local Chickens in Kaduna State, Nigeria. J. Anim. Vet. Adv. 2012, 11, 418–420. [Google Scholar]
- Shin, J.I.; Shin, S.J.; Shin, M.K. Differential Genotyping of Mycobacterium avium Complex and Its Implications in Clinical and Environmental Epidemiology. Microorganisms 2020, 8, 98. [Google Scholar] [CrossRef] [Scilit]
- Tell, L.A.; Woods, L.; Cromie, R.L. Mycobacteriosis in birds. Rev. Sci. Tech. 2001, 20, 180–203. [Google Scholar] [CrossRef] [Scilit]
- Eldin, C.; Mélenotte, C.; Mediannikov, O.; Ghigo, E.; Million, M.; Edouard, S.; Mege, J.L.; Maurin, M.; Raoult, D. From Q fever to Coxiella burnetii infection: A paradigm change. Clin. Microbiol. Rev. 2017, 30, 115–190. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Revolledo, L.; Ferreira, A.J.P. Current perspectives in avian salmonellosis: Vaccines and immune mechanisms of protection. J. Appl. Poult. Res. 2012, 21, 418–431. [Google Scholar] [CrossRef] [Scilit]
- Holschbach, C.L.; Peek, S.F. Salmonella in Dairy Cattle. Vet. Clin. N. Am. Food Anim. Pract. 2018, 34, 133–154. [Google Scholar] [CrossRef] [Scilit]
- Jian, Y.; Zhang, X.; Li, X.; Schou, C.; Charalambidou, I.; Ma, L.; Karanis, P. Occurrence of Cryptosporidium and Giardia in wild birds from Qinghai Lake on the Qinghai-Tibetan Plateau, China. Parasitol. Res. 2021, 120, 615–628. [Google Scholar] [CrossRef] [Scilit]
- Ryan, U.; Cacciò, S.M. Zoonotic potential of Giardia. Int. J. Parasitol. 2013, 43, 943–956. [Google Scholar] [CrossRef] [Scilit]
- da Cunha, M.J.R.; Cury, M.C.; Santin, M. Molecular identification of Enterocytozoon bieneusi, Cryptosporidium, and Giardia in Brazilian captive birds. Parasitol. Res. 2017, 116, 487–493. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reboredo-Fernandez, A.; Ares-Mazas, E.; Caccio, S.M.; Gomez-Couso, H. Occurrence of Giardia and Cryptosporidium in wild birds in Galicia (Northwest Spain). Parasitology 2015, 142, 917–925. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cano, L.; de Lucio, A.; Bailo, B.; Cardona, G.A.; Muadica, A.S.; Lobo, L.; Carmena, D. Identification and genotyping of Giardia spp. and Cryptosporidium spp. isolates in aquatic birds in the Salburua wetlands, Alava, Northern Spain. Vet. Parasitol. 2016, 221, 144–148. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Braima, K.; Zahedi, A.; Oskam, C.; Reid, S.; Pingault, N.; Xiao, L.; Ryan, U. Retrospective analysis of Cryptosporidium species in Western Australian human populations (2015–2018), and emergence of the C. hominis IfA12G1R5 subtype. Infect. Genet. Evol. 2019, 73, 306–313. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Morgan, U.M.; Monis, P.T.; Xiao, L.; Limor, J.; Sulaiman, I.; Raidal, S.; O’Donoghue, P.; Gasser, R.; Murray, A.; Fayer, R.; et al. Molecular and phylogenetic characterisation of Cryptosporidium from birds. Int. J. Parasitol. 2001, 31, 289–296. [Google Scholar] [CrossRef] [Scilit]
- Mathis, A.; Weber, R.; Deplazes, P. Zoonotic potential of the microsporidia. Clin. Microbiol. Rev. 2005, 18, 423–445. [Google Scholar] [CrossRef] [Scilit]
- Sak, B.; Brady, D.; Pelikánová, M.; Květoňová, D.; Rost, M.; Kostka, M.; Pelikánová, M.; Tolarová, V.; Hůzová, Z.; Kváč, M. Unapparent microsporidial infection among immunocompetent humans in the Czech Republic. J. Clin. Microbiol. 2011, 49, 1064–1070. [Google Scholar] [CrossRef] [Scilit]
- Weber, R.; Bryan, R.T. Microsporidial infections in immunodeficient and immunocompetent patients. Clin. Infect. Dis. 1994, 19, 517–521. [Google Scholar] [CrossRef] [Scilit]
- Slodkowicz-Kowalska, A.; Graczyk, T.K.; Tamang, L.; Jedrzejewski, S.; Nowosad, A.; Zduniak, P.; Solarczyk, P.; Girouard, A.S.; Majewska, A.C. Microsporidian species known to infect humans are present in aquatic birds: Implications for transmission via water? Appl. Environ. Microbiol. 2006, 72, 4540–4544. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Haro, M.; Izquierdo, F.; Henriques-Gil, N.; Andrés, I.; Alonso, F.; Fenoy, S.; Del Aguila, C. First detection and genotyping of human-associated microsporidia in pigeons from urban parks. Appl. Environ. Microbiol. 2005, 71, 3153–3157. [Google Scholar] [CrossRef] [Scilit]
- Haro, M.; Henriques-Gil, N.; Fenoy, S.; Izquierdo, F.; Alonso, F.; Del Aguila, C. Detection and genotyping of Enterocytozoon bieneusi in pigeons. J. Eukaryot. Microbiol. 2006, 53, S58–S60. [Google Scholar] [CrossRef] [Scilit]
- Graczyk, T.K.; Sunderland, D.; Rule, A.M.; Da Silva, A.J.; Moura, I.N.; Tamang, L.; Girouard, A.S.; Schwab, K.J.; Breysse, P.N. Urban feral pigeons (Columba livia) as a source for air-and waterborne contamination with Enterocytozoon bieneusi spores. Appl. Environ. Microbiol. 2007, 73, 4357–4358. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Giacopello, C.; Foti, M.; Mascetti, A.; Grosso, F.; Ricciardi, D.; Fisichella, V.; Lo Piccolo, F. Antimicrobial resistance patterns of Enterobacteriaceae in European wild bird species admitted in a wildlife rescue centre. Vet. Ital. 2016, 52, 139–144. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Foti, M.; Mascetti, A.; Fisichella, V.; Fulco, E.; Orlandella, B.M.; Lo Piccolo, F. Antibiotic resistance assessment in bacteria isolated in migratory Passeriformes transiting through the Metaponto territory (Basilicata, Italy). Avian Res. 2017, 8, 26. [Google Scholar] [CrossRef] [Scilit]
- Bertelloni, F.; Lunardo, E.; Rocchigiani, G.; Ceccherelli, R.; Ebani, V.V. Occurrence of Escherichia coli virulence genes in feces of wild birds from Central Italy. Asian Pac. J. Trop Med. 2019, 12, 142–146. [Google Scholar]
- Mancini, L.; Marcheggiani, S.; D’angelo, A.M.; Chiudioni, F.; Delibato, E.; Dionisi, A.M.; Owczarek, S.; De Medici, D.; Ida Luzzi, A. Case Study on Wild Birds: A Human Enteric Pathogens Transmission. J. Environ. Sci. Public Health 2020, 4, 267–281. [Google Scholar]
- Marotta, F.; Janowicz, A.; Di Marcantonio, L.; Ercole, C.; Di Donato, G.; Garofolo, G.; Di Giannatale, E. Molecular Characterization and Antimicrobial Susceptibility of C. jejuni Isolates from Italian Wild Bird Populations. Pathogens 2020, 9, 304. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bertelloni, F.; Chemaly, M.; Cerri, D.; Gall, F.L.; Ebani, V.V. Salmonella infection in healthy pet reptiles: Bacteriological isolation and study of some pathogenic characters. Acta Microbiol. Immunol. Hungarica. 2016, 63, 203–216. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hall, T.A. BioEdit: A User-Friendly Biological Sequence Alignment Editor and Analysis Program for Windows 95/98/NT; Nucleic Acids Symposium Series; Oxford Academic: London, UK, 1999; Volume 41, No. 41; pp. 95–98. [Google Scholar]
- Romero, C.; Gamazo, C.; Pardo, M.; Lopez-Goni, I. Specific detection of Brucella DNA by PCR. J. Clin. Microbiol. 1995, 33, 615–617. [Google Scholar] [CrossRef] [Scilit]
- Berri, M.; Rekiki, A.; Boumedine, A.; Rodolakis, A. Simultaneous differential detection of Chlamydophila abortus, Chlamydophila pecorum, and Coxiella burnetiid from aborted ruminant’s clinical samples using multiplex PCR. BMC Microbiol. 2009, 9, 130. [Google Scholar] [CrossRef] [Scilit]
- Moravkova, M.; Hlozek, P.; Beran, V.; Pavlik, I.; Preziuso, S.; Cuteri, V.; Bartos, M. Strategy for the detection and differentiation of Mycobacterium avium species in isolates and heavily infected tissues. Res. Vet. Sci. 2008, 85, 257–264. [Google Scholar] [CrossRef] [Scilit]
- Xiao, L.; Singh, A.; Limor, J.; Graczyk, T.K.; Gradus, S.; Lal, A. Molecular characterization of Cryptosporidium oocysts in samples of raw surface water and wastewater. Appl. Environ. Microbiol. 2001, 67, 1097–1101. [Google Scholar] [CrossRef] [Scilit]
- Read, C.M.; Monis, P.T.; Thompson, R.C.A. Discrimination of all genotypes of Giardia duodenalis at the glutamate dehydrogenase locus using PCR-RFLP. Infect. Genet. Evol. 2004, 4, 125–130. [Google Scholar] [CrossRef] [PubMed]
- Fedorko, D.P.; Nelson, N.A.; Cartwright, C.P. Identification of Microsporidia in stool specimens by using PCR and restriction endonucleases. J. Clin. Microbiol. 1995, 33, 1739–1741. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Najdenski, H.; Dimova, T.; Zaharieva, M.M.; Nikolov, B.P.; Petrova-Dinkova, G.; Dalakchieva, S.; Popov, K.S.; Hristova-Nikolova, I.P.; Zehtindjiev, P.; Peev, S.G.; et al. Migratory birds along the Mediterranean—Black Sea Flyway as carriers of zoonotic pathogens. Can. J. Microbiol. 2018, 64, 915–924. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wareth, G.; Kheimar, A.; Neubauer, H.; Melzer, F. Susceptibility of Avian Species to Brucella Infection: A Hypothesis-Driven Study. Pathogens 2020, 9, 77. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jordan, F.T.W.; Hampson, D.J. Some other bacterial diseases (cap 22). In Poultry Diseases, 6th ed.; Pattison, M., McMullin, P.F., Bradbury, J.M., Alexander, D.J., Eds.; Elsevier: Edinburgh, UK, 2008. [Google Scholar]
- To, H.; Sakai, R.; Shirota, K.; Kano, C.; Abe, S.; Sugimoto, T.; Takahara, K.; Morita, C.; Takashima, I.; Maruyama, T.; et al. Coxiellosis in domestic and wild birds from Japan. J. Wildl. Dis. 1995, 34, 310–316. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ioannou, I.; Chochlakis, D.; Kasinis, N.; Anayiotis, P.; Lyssandrou, A.; Papadopoulos, B.; Tselentis, Y.; Psaroulaki, A. Carriage of Rickettsia spp., Coxiella burnetii and Anaplasma spp. By endemic and migratory wild birds and their ectoparasites in Cyprus. Clin. Microbiol. Infect. Dis. 2009, 15, 158–160. [Google Scholar] [CrossRef] [Scilit]
- Astobiza, I.; Barral, M.; Ruiz-Fons, F.; Barandika, J.F.; Gerrikagoitia, X.; Hurtado, A.; Garcia-Perez, A.L. Molecular investigation of the occurrence of Coxiella burnetii in wildlife and ticks in an endemic area. Vet. Microbiol. 2011, 147, 190–194. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Das, D.P.; Malik, S.V.S.; Mohan, V.; Rawool, D.B.; Barbudhe, S.B. Screening of fecal droppings of wild birds for coxiellosis by a duplex PCR targeting com1 and IS1111 genes of Coxiella burnetii. J. Foodborne. Zoonotic. Dis. 2013, 1, 14–20. [Google Scholar]
- Berthová, L.; Slobodník, V.; Slobodník, R.; Olekšák, M.; Sekeyová, Z.; Svitálková, Z.; Kazimírová, M.; Špitalská, E. The natural infection of birds and ticks feeding on birds with Rickettsia spp. and Coxiella burnetii in Slovakia. Exp. Appl. Acarol. 2016, 68, 299–314. [Google Scholar] [CrossRef] [Scilit]
- Tokarevich, N.K.; Panferova, Y.A.; Freylikhman, O.A.; Blinova, O.V.; Medvedev, S.G.; Mironov, S.V.; Grigoryeva, L.A.; Tretyakov, K.A.; Dimova, T.; Zaharieva, M.M.; et al. Coxiella burnetii in ticks and wild birds. Ticks Tick-Borne Dis. 2019, 10, 377–385. [Google Scholar] [CrossRef] [Scilit]
- Ebani, V.V.; Nardoni, S.; Giani, M.; Rocchigiani, G.; Archin, T.; Altomonte, I.; Poli, A.; Mancianti, F. Molecular survey on the occurrence of avian haemosporidia, Coxiella burnetii and Francisellatularensis in waterfowl from central Italy. Int. J. Parasitol. Parasit. Wildl. 2019, 10, 87–92. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ebani, V.V.; Bertelloni, F.; Mani, P. Molecular survey on zoonotic tick-borne bacteria and chlamydiae in feral pigeons (Columba livia domestica). Asian Pac. J. Trop. Med. 2016, 9, 324–327. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reed, K.D.; Meece, J.K.; Henkel, J.S.; Shukla, S.K. Birds, migration and emerging zoonoses: West nile virus, lyme disease, influenza A and enteropathogens. Clin. Med. Res. 2003, 1, 5–12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Smith, O.M.; Snyder, W.E.; Owen, J.P. Are we overestimating risk of enteric pathogen spillover from wild birds to humans? Biol. Rev. Camb. Philos. Soc. 2020, 95, 652–679. [Google Scholar] [CrossRef] [Scilit]
- Bonardi, S.; Bolzoni, L.; Zanoni, R.G.; Morgnati, M.; Corradi, M.; Gilioli, S.; Pongolini, S. Limited Exchange of Salmonella Among Domestic Pigs and Wild Boars in Italy. EcoHealth 2019, 16, 420–428. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Haeghebaert, S.; Duché, L.; Gilles, C.; Masini, B.; Dubreuil, M.; Minet, J.C.; Bouvet, P.; Grimont, F.; Delarocque Astagneau, E.; Vaillant, V. Minced beef and human salmonellosis: Review of the investigation of three outbreaks in France. Eurosurveillance 2001, 6, 21–26. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vestrheim, D.; Lange, H.; Nygard, K.; Borgen, K.; Wester, A.; Kvarme, M.; Vold, L. Are ready-to-eat salads ready to eat? An outbreak of Salmonella Coeln linked to imported, mixed, pre-washed and bagged salad, Norway, November 2013. Epidemiol. Infect. 2016, 144, 1756–1760. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Majewska, A.C.; Graczyk, T.K.; Slodkowicz-Kowalska, A.; Tamang, L.; Jedrzejewski, S.; Zduniak, P.; Solarczyk, P.; Nowosad, A.; Nowosad, P. The role of free-ranging, captive, and domestic birds of Western Poland in environmental contamination with Cryptosporidium parvum oocysts and Giardia lamblia cysts. Parasitol. Res. 2009, 104, 1093–1099. [Google Scholar] [CrossRef] [Scilit]
- Holubova, N.; Sak, B.; Hlaskova, L.; Kvetonova, D.; Hanzal, V.; Rajsky, D.; Rost, M.; McEvoy, J.; Kvac, M. Host specificity and agedependent resistance to Cryptosporidium avium infection in chickens, ducks and pheasants. Exp. Parasitol. 2018, 191, 62–65. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, R.; Wang, F.; Zhao, J.; Qi, M.; Ning, C.; Zhang, L.; Xiao, L. Cryptosporidium spp. in quails (Coturnix coturnix japonica) in Henan, China: Molecular characterization and public health significance. Vet. Parasitol. 2012, 187, 534–537. [Google Scholar] [CrossRef] [Scilit]
- McEvoy, J.M.; Giddings, C.W. Cryptosporidium in commercially produced turkeys on-farm and post slaughter. Lett. Appl. Microbiol. 2009, 48, 302–306. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Plutzer, J.; Tomor, B. The role of aquatic birds in the environmental dissemination of human pathogenic Giardia duodenalis cysts and Cryptosporidium oocysts in Hungary. Parasitol. Int. 2009, 58, 227–231. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rose, J.B.; Haas, C.N.; Regli, S. Risk assessment and control of waterborne giardiasis. Am. J. Public Health 1991, 81, 709–713. [Google Scholar] [CrossRef] [Scilit]
- Kucerova-Pospisilova, Z.; Carr, D.; Leitch, G.; Scanlon, M.; Visvesvara, G.S. Environmental resistance of Encephalitozoon spores. J. Eukaryot. Microbiol. 1999, 46, 11S–13S. [Google Scholar] [PubMed]
- Tavalla, M.; Mardani-Kateki, M.; Kazemi, F. Molecular identification of Enterocytozoon bieneusi and Encephalitozoon species in pigeons of southwest of Iran. Asian Pac. J. Trop Dis. 2017, 7, 536–538. [Google Scholar] [CrossRef] [Scilit]
- Pekmezci, D.; Yetismis, G.; Colak, Z.N.; Duzlu, O.; Ozkilic, G.N.; Inci, A.; Pekmezci, G.Z.; Yildirim, A. First report and molecular prevalence of potential zoonotic Enterocytozoon bieneusi in Turkish tumbler pigeons (Columba livia domestica). Med. Mycol. 2021, myab013. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barton, C.E.; Phalen, D.N.; Snowden, K.F. Prevalence of microsporidian spores shed by asymptomatic lovebirds: Evidence for a potential emerging zoonosis. J. Avian Med. Surg. 2003, 17, 197–202. [Google Scholar] [CrossRef] [Scilit]
- Snowden, K.; Phalen, D.N. Encephalitozoon infection in birds. Semin. Avian Exot. Pet Med. 2004, 13, 94–99. [Google Scholar] [CrossRef] [Scilit]
- Canny, C.J.; Ward, D.A.; Patton, S.; Orosz, S.E. Microsporidian keratoconjunctivitis in a double yellow-headed Amazon parrot (Amazona ochrocephala oratrix). J. Avian Med. Surg. 1999, 13, 279–286. [Google Scholar]
- Nakamura, A.A.; Homem, C.G.; Garcia, S.D.; Meireles, M.V. Keratoconjunctivitis by Encephalitozoon hellem in lovebirds (Agapornis spp.) in Brazil: Case report. Arq. Bras. Med. Vet. Zootec. 2010, 62, 816–820. [Google Scholar] [CrossRef] [Scilit]
| Scheme ID | Bird Species | Detected Pathogen | Method |
|---|---|---|---|
| I_52 | Larus michahellis | S. enterica serovar Coeln | Isolation and typing |
| I_77 | Anas penelope | Coxiella burnetii | PCR |
| I_107 | Columba livia | Encephalitozoon hellem | PCR and sequencing |
| I_117 | Columba livia | Encephalitozoon hellem | PCR and sequencing |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ebani, V.V.; Guardone, L.; Bertelloni, F.; Perrucci, S.; Poli, A.; Mancianti, F. Survey on the Presence of Bacterial and Parasitic Zoonotic Agents in the Feces of Wild Birds. Vet. Sci. 2021, 8, 171. https://doi.org/10.3390/vetsci8090171
Ebani VV, Guardone L, Bertelloni F, Perrucci S, Poli A, Mancianti F. Survey on the Presence of Bacterial and Parasitic Zoonotic Agents in the Feces of Wild Birds. Veterinary Sciences. 2021; 8(9):171. https://doi.org/10.3390/vetsci8090171
Chicago/Turabian StyleEbani, Valentina Virginia, Lisa Guardone, Fabrizio Bertelloni, Stefania Perrucci, Alessandro Poli, and Francesca Mancianti. 2021. "Survey on the Presence of Bacterial and Parasitic Zoonotic Agents in the Feces of Wild Birds" Veterinary Sciences 8, no. 9: 171. https://doi.org/10.3390/vetsci8090171
APA StyleEbani, V. V., Guardone, L., Bertelloni, F., Perrucci, S., Poli, A., & Mancianti, F. (2021). Survey on the Presence of Bacterial and Parasitic Zoonotic Agents in the Feces of Wild Birds. Veterinary Sciences, 8(9), 171. https://doi.org/10.3390/vetsci8090171

