Next Article in Journal
Use of Autologous Leucocyte- and Platelet-Rich Plasma (L-PRP) in the Treatment of Aural Hematoma in Dogs
Previous Article in Journal
Establishment of a Newborn Lamb Gut-Loop Model to Evaluate New Methods of Enteric Disease Control and Reduce Experimental Animal Use
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Survey on the Presence of Bacterial and Parasitic Zoonotic Agents in the Feces of Wild Birds

by
Valentina Virginia Ebani
1,2,*,
Lisa Guardone
1,
Fabrizio Bertelloni
1,
Stefania Perrucci
1,
Alessandro Poli
1 and
Francesca Mancianti
1
1
Department of Veterinary Sciences, University of Pisa, Viale delle Piagge 2, 56124 Pisa, Italy
2
Centre for Climate Change Impact, University of Pisa, Via del Borghetto 80, 56124 Pisa, Italy
*
Author to whom correspondence should be addressed.
Vet. Sci. 2021, 8(9), 171; https://doi.org/10.3390/vetsci8090171
Submission received: 20 July 2021 / Revised: 20 August 2021 / Accepted: 23 August 2021 / Published: 25 August 2021

Abstract

Wild avifauna may act as fecal source of bacterial and parasitic pathogens for other birds and mammals. Most of these pathogens have a relevant impact on human and livestock health which may cause severe disease and economic loss. In the present study, the fecal samples collected from 121 wild birds belonging to 15 species of the genera Anas, Tadorna, Fulica, Arddea, Larus, Falco, Athene, Accipiter, and Columba were submitted to bacteriological and molecular analyses to detect Brucella spp., Coxiella burnetii, Mycobacterium spp., Salmonella spp., Cryptosporidium spp., Giardia spp., and microsporidia. Four (3.3%) animals were positive for one pathogen: one Anas penelope for C. burnetii, one Larus michahellis for S. enterica serovar Coeln, and two Columba livia for Encephalitozoon hellem. Although the prevalence rates found in the present survey were quite low, the obtained results confirm that wild birds would be the a potential fecal source of bacterial and parasitic zoonotic pathogens which sometimes can also represent a severe threat for farm animals.

1. Introduction

Wild avifauna includes several bird species with different features related to behaviors, habitats, feeding. All wild birds can harbor pathogens in their intestinal tract and consequently excrete these agents in their feces, thus they may be a source of infection for other birds. Furthermore, wild birds can excrete agents responsible for infectious and/or parasitic diseases in mammals, including humans. Considering that these animals often reach and live in farm areas, they may act as source of pathogens for livestock too, and cause relevant economic loss. The role of birds as vectors of disease transmission to domestic livestock has been attributed to environmental contamination of, amongst others, water supplies, pastureland, and feed by avian feces [1,2,3,4,5].
Among bacterial agents, Brucella spp., Mycobacterium spp., Coxiella burnetii, and Salmonella enterica are the most relevant zoonotic pathogens able to cause serious diseases in livestock, mainly ruminants, even though other bacterial agents (e.g., Campylobacter spp., Staphylococcus spp, Chlamydia spp., and Escherichia coli) may compromise the animal health status. Members of genus Brucella are Gram-negative, facultative intracellular bacteria which infect several mammal domestic and wild species; brucellosis is a relevant concern for livestock health in which the pathogen, mainly B. abortus and B. melitensis, causes abortion and infertility [6]. Brucella spp. have not been isolated from birds, but anti-Brucella antibodies have been detected in some avian species in South Africa and Asia [7,8,9,10,11,12].
Genus Mycobacterium includes acid-fast bacilli classified into the group of mycobacteria causing tuberculosis, such as M. tuberculosis and M. bovis, and the non-tuberculous mycobacteria (NTM) group. Among NTM, members of the M avium complex represent a serious threat in veterinary medicine. In particular, M. avium avium causes avian tuberculosis, but it is often involved in mammal infections, mainly in human, cattle, and swine [13]. Moreover, M. genavense, a well-known human pathogen, has been frequently found in avian population [14].
C. burnetii is a Gram-negative, intracellular obligate bacterium which may infect several avian and mammal species. It is the etiologic agent of the zoonotic disease Q Fever, which causes reproductive disorders mainly in farm ruminants [15].
S. enterica, a Gram-negative bacterium of the family Enterobacteriaceae, infects domestic and wild birds in which it causes different forms in relation to the involved serovar. S. enterica serovars, Gallinarum and Pullorum, cause systemic disease mainly in poultry and are not pathogen for mammals [16]. The non-specific-host serovars may infect avian populations without inducing disease, whereas they are responsible for enteric, septicemic, and reproductive diseases in several mammal species including human and farm animals [17].
Among parasites, protozoans, including Giardia spp. and Cryptosporidium spp., are known to be possibly excreted in birds’ feces [4]. Giardia spp. and Cryptosporidium spp. are usually zoonotic enteric protozoan parasites that can infect a wide range of vertebrate hosts, including humans, mammals, and domestic and wild animals worldwide. They are both widespread in wild birds too [18].
Two species of Giardia, G. ardeae and G. psittaci, have been identified in birds based on the morphology of trophozoites and cysts [19]. Beside them, other species/assemblages have also been reported from avian hosts, including the zoonotic assemblages A and B [19]. In more detail, G. duodenalis assemblage A was found in Brazil [20] while G. duodenalis assemblage B, D, and F in northwest Spain [21].
Presently, four Cryptosporidium species, distinguished on the basis of biological and genetic differences, have been reported to cause infection in birds: C. meleagridis, C. baileyi, C. avium, and C. galli. In addition, the presence of other species, including C. andersoni, C. parvum, C. hominis, C. muris, and several genotypes, such as Cryptosporidium goose genotypes I–IV, a Cryptosporidium duck genotype, and Cryptosporidium avian genotypes I–IV, has also been described [18,22]. In general, many of these Cryptosporidium species and genotypes are host-specific and, thus, are usually not considered a public health concern. However, some birds may carry and disseminate zoonotic species [23] and, in addition, C. meleagridis is considered the third most prevalent species known to infect humans after C. hominis and C. parvum [12,23,24].
Beside Cryptosporidium spp. and Giardia spp. several microsporidia, such as Enterocytozoon bieneusi, Encephalitozoon intestinalis, and Encephalitozoon hellem, are zoonotic pathogens affecting primarily immunocompromised persons [25,26,27], which have been repeatedly reported from birds [4,28,29,30,31].
Data about the potential role of wild avifauna as a fecal source of bacteria and parasites for humans and other mammals are not numerous, and in particular those concerning Italy are very scanty [32,33,34,35,36].
The aim of the present survey was to specifically verify the occurrence of some among the most important zoonotic bacterial and parasitic pathogens, which can also affect ruminant livestock, in feces collected from wild birds belonging to different orders and species. In particular, molecular analyses were carried out to detect Mycobacterium spp., Brucella spp., Coxiella burnetii, Cryptosporidium spp., Giardia spp., and microsporidia. Furthermore, bacteriological analyses were executed to isolate Salmonella spp.

2. Materials and Methods

2.1. Animals

Intestinal samples were collected from 121 free-roaming wild birds from January to December 2016. Fifty-six samples were collected from animals hunted during the hunting season in different wet areas of Central Italy. The evisceration was performed by hunters who collaborated with the authors for a previous research [34]. The remaining 65 samples were collected from birds dead at an avian recovery center located in Central Italy. No lesions ascribable to infectious and/or parasitic diseases were observed, whereas fatal traumatic lesions were considered as the cause of death. During the necropsies, a portion of terminal intestine, approximatively from caeca to cloaca, were collected from each bird and stored at 4 °C for 24–48 h until the end of the investigations.
All samples were collected from the following avian species: common teal Anas crecca (n = 22), mallard Anas platyrhynchos (n = 15), Eurasian wigeon Anas penelope (n = 11), Northern shoveler Anas clypeata (n = 3), pintail Anas acuta (n = 1), grey heron Ardea cinerea (n = 2), yellow-legged gull Larus michahellis (n = 35), common shelduck Tadorna tadorna (n = 3), Eurasian coot Fulica atra (n = 1), common kestrel Falco tinninculus (n = 3), peregrine falcon Falco peregrinus (n = 1), little owl Athene noctua (n = 1), Eurasian sparrowhawk Accipiter nisus (n = 1), common pigeon Columba livia (n = 21), common wood pigeon Columba palumbus (n = 1).

2.2. Ethical Statement

Regularly hunted and naturally dead birds were used in the study. No birds were sacrificed for the study.

2.3. Bacteriological Analyses

Salmonella spp. isolation was executed from each fecal sample following the procedures previously described [37]. Briefly, about 3 gr of feces was incubated in 10 mL of buffered peptone water at 37 °C for 24 h. One ml of this culture was transferred into ten mL of Selenite Cystine Broth (Oxoid Ltd., Basingstoke, UK) and one ml into ten mL of Rappaport Vassiliadis Broth. The tubes were incubated at 37 °C for 24 h and at 42 °C for 24 h, respectively. One loopful from each broth culture was streaked onto Salmonella-Shigella Agar (Oxoid) and Brilliant Green Agar (Oxoid) plates. After incubation of the plates at 37 °C for 24 h, suspected colonies were submitted to biochemical characterization and serotyping.
DNA was extracted from about 25 mg of each fecal sample using the commercial kit Tissue Genomic DNA Extraction Kit (Fisher Molecular Biology, Trevose, PA, USA) and following the procedures reported by the producer. DNA samples were kept at 4 °C, for 10 days, until used in the different PCR (Polymerase Chain Reaction) assays.
Target genes, primers sequences and PCR conditions are reported in Table 1.
All PCR amplifications were executed using the EconoTaq PLUS 2x Master Mix (Lucigen Corporation, Middleton, WI, USA) and the automated thermal cycler Gene-Amp PCR System 2700 (Perkin Elmer, Norwalk, CT, USA).
PCR products were analysed by electrophoresis on 1.5% agarose gel stained with GelRed® Nucleic Acid Gel Stain (Biotium, Fremont, CA). SharpMass™ 100 Plus Ladder (Euroclone, Milano, Italy) was used as a DNA marker.
PCR products of the expected length for microsporidia and with a sufficient concentration were forward and reverse Sanger sequenced by an external company (Eurofins Genomics, Ebersberg bei München, Germany). Nucleotide sequences were analysed using Bioedit version 7.0.9 [38]. Adjustments were made after visual checking and consensus sequences were compared against those deposited in GenBank by using the National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST).
Table 1. PCR primers and conditions employed in the assays for the detection of each pathogen. The PCR conditions refers to the cycling phase which was anticipated by 5 min at 95 °C and followed by 10 min at 72 °C. A nested PCR was used from Cryptosporidium spp. and a semi-nested (different forward primers and same reverse) for Giardia spp.
Table 1. PCR primers and conditions employed in the assays for the detection of each pathogen. The PCR conditions refers to the cycling phase which was anticipated by 5 min at 95 °C and followed by 10 min at 72 °C. A nested PCR was used from Cryptosporidium spp. and a semi-nested (different forward primers and same reverse) for Giardia spp.
PathogensAmplicons
(Target Gene)
Primers Sequence (5′—3′)PCR ConditionsReferences
Brucella spp.905 bp
(16SrRNA)
F4 (TCGAGCGCCCGCAAGGGG)
R2 (AACCATAGTGTCTCCACTAA)
95 °C—30 s
54 °C—90 s
72 °C—90 s
For 50 cycles
[39]
Coxiella burnetii687 bp
(IS1111a)
Trans-1 (TATGTATCCACCGTAGCCAGT)
Trans-2 (CCCAACAACACCTCCTTATTC)
95 °C—30 s
64 °C—1 min
72 °C—1 min
For 40 cycles
[40]
Mycobacterium spp.1030 bp
(16SrDNA)
MycogenF (AGAGTTTGATCCTGGCTCAG)
MycogenR (TGCACACAGGCCACAAGGGA)
95 °C—1 min
62 °C—2 min
72 °C—1 min
For 40 cycles
[41]
Cryptosporidium spp.1325 bp (1st step)
826-864 bp (2nd step)
(16SrDNA)
outcryF (TTCTAGAGCTAATACATGCG)
outcryR (CCCATTTCCTTCGAAACAGGA)
incryF (GGAAGGGTTGTATTTATTAGATAAAG)
incryR (AAGGAGTAAGGAACAACCTCCA)
94 °C—45 s
55 °C—45 s
72 °C—1 min
For 35 cycles
(1st and 2nd step)
[42]
Giardia spp.432 bp (2nd step)
(gdh)
GDHeF (TCAACGTYAAYCGYGGYTTCCGT)
GDHiR (GTTRTCCTTGCACATCTCC)
GDHiF (CAGTACAACTCYGCTCTCGG)
94 °C—1 min
56 °C—20 s
72 °C—45 s
For 45 cycles
[43]
Microsporidia
(Encephalitozoon spp.
and Enterocitozoon spp.)
250–280 pb
(18SrRNA)
V1 (CACCAGGTTGATTCTGCCTGAC)
PMP2 (CCTCTCCGGAACCAAACCCTG)
94 °C—30 s
60 °C—30 s
72 °C—30 s
For 35 cycles
[44]

3. Results

Among the analysed samples, 4 (3.3%) resulted positive for at least one pathogen (Table 2). No animals were positive for Mycobacterium spp., Giardia spp. and Cryptosporidium spp. One hunted A. penelope was positive for C. burnetii, one L. michahellis, from the recovery center, for S. enterica serovar Coeln and two C. livia, both from the recovery center, were positive for Encephalitozoon hellem.

4. Discussion

Even though the investigation was carried out on a small number of birds and very few individuals of some species, the results obtained in the present survey suggested that wild birds are not frequently important fecal spreaders of the investigated bacterial and parasitic pathogens responsible for livestock infections.
All birds were PCR negative for Brucella spp. and this finding is in agreement to other previous surveys. In facts, even though some investigations found serological positive reactions in chickens, pigeons and ducks in some areas of Asia and South Africa, Brucella spp. was never detected so far [7,8,9,10,11,12]. Only Najadenski et al. [45] found in Bulgaria one (0.15%) Acrocephalus arundinaceus PCR positive for Brucella spp. among 706 examined wild birds migrating along the Mediterranean-Black Sea Flyway. The role of birds in the epidemiology of brucellosis is kept under control, because, even if they do not develop disease, they could act as vectors of brucellae mainly in geographic areas where this infection is largely widespread [46].
No birds were positive for Mycobacterium genus. All avian species are susceptible to M. avium avium, but the disease is rarely observed in poultry. Avian tuberculosis is most frequently observed in particular cases: birds kept in zoological gardens and cage birds that, moreover, are susceptible to M. bovis and M. tuberculosis, too [47]. Wild avian species may contract mycobacteria from the environment and they can excrete these pathogens in their feces becoming source of infection for other birds and/or mammals [14]. However, data about Mycobacterium infections in wild birds are limited to the description of some cases, mainly due to M. avium avium, M. intracellulare and M. genavense, but prevalence values in different geographic areas are not available.
One A. penelope was positive to C. burnetii. This pathogen can infect mammals, in which it may cause disease, as well as birds that are asymptomatic. Data about the spreading of C. burnetii in avian populations are very scanty [48,49,50,51,52,53]. Previous surveys carried out in Italy detected C. bunetii in wild avifauna with prevalence rates ranging from 3% in water fowl [54] to 5.95% in pigeons [55]. In both cases, spleen specimens were analyzed, thus the findings suggested that birds were potential source of infections, but they did not show that the tested animals were shedders of the pathogen. The present survey shows that birds, even though not frequently, may excrete C. burnetii in their droppings and consequently contaminate the environment.
Wild birds have been suggested to be involved in the epidemiology of bacterial enteropathogens worldwide [56,57] as well as in Italy [35]. Different Salmonella serovars have been isolated, thus it seems that there is no correlation between wild birds and a given serovar. In our survey S. enterica serovar Coeln was isolated from a gull (L. michaellis); this serovar resulted present in Italian wild fauna in a quite recent study that found it in wild boars [58]. However, S. Coeln is a rarely notified non-typhoid serovar of Salmonella [59,60]. Our findings confirm that gulls are involved in the epidemiology of enteropathogen bacteria [34]; in fact, they are scavenger birds largely present in different environments where they can acquire and/or excrete pathogens.
As regards parasites, no birds were positive for Giardia spp. nor for Cryptosporidium spp. This could be explained considering that low prevalence rates had already been observed for these protozoans in birds [20,22,61] and the relatively low number of samples for some avian species in the present survey. These two parasites, which are prevalent in livestock and wild animals, have also attracted attention in domestic, caged, ornamental, companion, and wild birds [18]. Cryptosporidiosis and giardiasis in economic poultry (laying and meat chickens, ducks, and geese) may lead to extensive economic losses [61,62]. A prevalence of 13.1% of Cryptosporidium spp. was found from 47 quail farms in China, where the predominant species was C. baileyi, generally associated with the respiratory form of cryptosporidiosis in birds and capable of infecting a variety of avian hosts [63]. As regards public health concerns, the zoonotic species C. parvum was detected on a large turkey farm and post slaughter [64]. Several studies also investigated wild birds’ infection with Cryptosporidium [20,21,22,61,65]. Some of them demonstrated the presence of C. parvum in wild birds, suggesting a potential important role of infected birds in its spreading and transmission [21,65]. Experimental as well as field evidences of mechanical transmission of Cryptosporidium parvum and C. hominis to water by birds’ feces exist [4].
Similarly, birds can act as reservoir hosts as well as mechanical vectors of Giardia [4]. This parasite has an extensive zoonotic reservoir and the cysts of assemblages virulent to humans are common in water, where they can retain infectivity for two months [66], and can be acquired by birds from this environment [4]. The zoonotic G. duodenalis assemblages, A and B have been reported in birds [20,22,65].
Beside cryptosporidiosis and giardiasis, also microsporidiosis is a serious human disease, mainly of waterborne origin. The transmissive stages (spores) are environmentally robust and therefore ubiquitous in aquatic habitats [67]. Microsporidia can enter surface, drinking and recreational water resources from aquatic birds [4]. The most relevant zoonotic species are Enterocytozoon bieneusi, Encephalitozoon intestinalis, Encephalitozoon hellem and Encephalitozoon cuniculi [4]. In particular, E. bieneusi and E. intestinalis are the most common zoonotic species worldwide, mainly found as responsible for chronic diarrhea in HIV-infected patients, but also of acute, self-limiting diarrhea in immunocompetent persons. Encephalitozoon cuniculi and Encephalitozoon hellem have been mainly described in immunocompromised patients as agents of local (e.g., ocular) or disseminated infections [25].
The zoonotic species which was found in this study in two pigeons, E. hellem, is known to be able to infect birds, and it was found in Anas platyrhynchos, Anser anser, Cygnus olor, Cygnus atratus, Cygnus malanocoryphus, Corvus corone, Melopsittacus undulates, Coscoroba coscoroba, Balearica pavonina in Poland [28], as well as in C. livia from hurban parks in Spain [29] To the best of our knowledge, this microsporidian species had not been reported in pigeons from Italy before. The presence of human-virulent microsporidia species, particularly E. bieneusi but also E. hellem, in urban pigeons has been reported worldwide, highlighting a potential public health risk [29,30,31,68,69].
Cases of E. hellem infections in birds are frequently asymptomatic, but non-specific clinical symptoms may appear, often following immunosuppressive infection, inadequate husbandry, or immaturity [70,71]. The clinical picture as well as the necropsy findings in different types of birds were described in details in Snowden and Phalen [71]: depression, decreased appetite, and weight loss are most commonly reported, while stunting and increased mortality were described in nestlings. Cases of keratoconjunctivitis were also reported in companion birds [72,73]. At necropsy, significant muscle wasting, a loss of body fat and lesions mainly in the kidney, liver, intestines, and eye are found [71].

5. Conclusions

Although the prevalence rates found in the present survey were quite low, wild birds, with their feces, are potential source of bacterial and parasitic pathogens which can represent a threat for humans and other animals. Stantial and migratory birds may harbor some of these microorganisms in their intestinal tract without developing a disease, so they can contaminate different environments and become source of infection for mammals and other birds. On the other hand, wild birds contract bacteria and parasites from the environment, thus the spreading of pathogens among wild avifauna is also related to the diffusion of the microorganisms in other animal populations.

Author Contributions

Conceptualization, V.V.E. and F.M.; methodology, V.V.E., L.G., F.B., S.P., A.P.; data curation, V.V.E., L.G., F.B.; writing—original draft preparation, V.V.E., L.G.; writing—review and editing, V.V.E., F.M. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by University of Pisa, grant number PRA_2020_88.

Institutional Review Board Statement

Ethical review and approval were waived for this study, because no samples were collected from animals exclusively for this study.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study is contained within the article.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Johnston, W.S.; MacLachlan, G.K.; Hopkins, G.F. The possible involvement of seagulls (Larus sp.) in the transmission of Salmonella in dairy cattle. Vet. Rec. 1979, 105, 526–527. [Google Scholar] [PubMed]
  2. Coulson, J.C.; Butterfield, J.; Thomas, C. The herring gull Larus argentatus as a likely transmitting agent of Salmonella Montevideo to sheep and cattle. J. Hyg. 1983, 91, 437–443. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Fenlon, D.R. Wild birds and silage as reservoirs of Listeria in the agricultural environment. J. Appl. Bacteriol. 1985, 59, 537–543. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Graczyk, T.K.; Majewska, A.C.; Schwab, K.J. The role of birds in dissemination of human waterborne enteropathogens. Trends Parasitol. 2008, 24, 55–59. [Google Scholar] [CrossRef] [Scilit]
  5. Benskin, C.M.; Wilson, K.; Jones, K.; Hartley, I.R. Bacterial pathogens in wild birds: A review of the frequency and effects of infection. Biol. Rev. Camb. Philos. Soc. 2009, 84, 349–373. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Poester, F.; Samartino, L.; Santos, R. Pathogenesis and pathobiology of brucellosis in livestock. Rev. Sci. Tech. L’OIE 2013, 32, 105–115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Ali, S.; Saleem, S.; Imran, M.; Rizwan, M.; Iqbal, K.; Qadir, G.; Ahmad, H.; Umar, S.; Khan, W.A.; Khan, I.; et al. Detection of Brucella antibodies in selected wild animals and avian species in Pakistan. Indian J. Anim. Res. 2018, 54, 478–481. [Google Scholar] [CrossRef] [Scilit]
  8. Alaga, A.A.; Ogah, D.M.; Attah, J. Seroprevalence of Brucellosis in Some Poultry Species in Nasarawa State, Nigeria. Egypt. Poult. Sci. 2012, 32, 705–709. [Google Scholar]
  9. Junaidu, A.U.; Salihu, M.D.; Ahmed, F.; Ambursa, M.A.; Gulumbe, M.L. Brucellosis in local chickens in North Western Nigeria. Int. J. Poult. Sci. 2006, 5, 547–549. [Google Scholar]
  10. Mushi, E.Z.; Binta, M.G.; Basupang, K.; Samakabadi, E.K. Brucella abortus antibodies in the sera of indigenous chickens around Gaborone, Botswana. J. Anim. Vet. Adv. 2008, 7, 1610–1612. [Google Scholar]
  11. Adamu, N.; Adamu, S.; Jajere, M.; Atsanda, N.; Mustapha, F.; Maina, M. Serological Survey of Brucellosis in Slaughtered Local Chickens, Guinea Fowls, Ducks and Turkey in North-Eastern Nigeria. Int. J. Poult. Sci. 2014, 13, 340–342. [Google Scholar] [CrossRef] [Scilit]
  12. Gugon, V.T.; Maurice, N.A.; Ngbede, E.O.; Hambolu, S.E.; Ajogi, I. Serological Evidence of Brucellosis in Local Chickens in Kaduna State, Nigeria. J. Anim. Vet. Adv. 2012, 11, 418–420. [Google Scholar]
  13. Shin, J.I.; Shin, S.J.; Shin, M.K. Differential Genotyping of Mycobacterium avium Complex and Its Implications in Clinical and Environmental Epidemiology. Microorganisms 2020, 8, 98. [Google Scholar] [CrossRef] [Scilit]
  14. Tell, L.A.; Woods, L.; Cromie, R.L. Mycobacteriosis in birds. Rev. Sci. Tech. 2001, 20, 180–203. [Google Scholar] [CrossRef] [Scilit]
  15. Eldin, C.; Mélenotte, C.; Mediannikov, O.; Ghigo, E.; Million, M.; Edouard, S.; Mege, J.L.; Maurin, M.; Raoult, D. From Q fever to Coxiella burnetii infection: A paradigm change. Clin. Microbiol. Rev. 2017, 30, 115–190. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Revolledo, L.; Ferreira, A.J.P. Current perspectives in avian salmonellosis: Vaccines and immune mechanisms of protection. J. Appl. Poult. Res. 2012, 21, 418–431. [Google Scholar] [CrossRef] [Scilit]
  17. Holschbach, C.L.; Peek, S.F. Salmonella in Dairy Cattle. Vet. Clin. N. Am. Food Anim. Pract. 2018, 34, 133–154. [Google Scholar] [CrossRef] [Scilit]
  18. Jian, Y.; Zhang, X.; Li, X.; Schou, C.; Charalambidou, I.; Ma, L.; Karanis, P. Occurrence of Cryptosporidium and Giardia in wild birds from Qinghai Lake on the Qinghai-Tibetan Plateau, China. Parasitol. Res. 2021, 120, 615–628. [Google Scholar] [CrossRef] [Scilit]
  19. Ryan, U.; Cacciò, S.M. Zoonotic potential of Giardia. Int. J. Parasitol. 2013, 43, 943–956. [Google Scholar] [CrossRef] [Scilit]
  20. da Cunha, M.J.R.; Cury, M.C.; Santin, M. Molecular identification of Enterocytozoon bieneusi, Cryptosporidium, and Giardia in Brazilian captive birds. Parasitol. Res. 2017, 116, 487–493. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  21. Reboredo-Fernandez, A.; Ares-Mazas, E.; Caccio, S.M.; Gomez-Couso, H. Occurrence of Giardia and Cryptosporidium in wild birds in Galicia (Northwest Spain). Parasitology 2015, 142, 917–925. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Cano, L.; de Lucio, A.; Bailo, B.; Cardona, G.A.; Muadica, A.S.; Lobo, L.; Carmena, D. Identification and genotyping of Giardia spp. and Cryptosporidium spp. isolates in aquatic birds in the Salburua wetlands, Alava, Northern Spain. Vet. Parasitol. 2016, 221, 144–148. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Braima, K.; Zahedi, A.; Oskam, C.; Reid, S.; Pingault, N.; Xiao, L.; Ryan, U. Retrospective analysis of Cryptosporidium species in Western Australian human populations (2015–2018), and emergence of the C. hominis IfA12G1R5 subtype. Infect. Genet. Evol. 2019, 73, 306–313. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Morgan, U.M.; Monis, P.T.; Xiao, L.; Limor, J.; Sulaiman, I.; Raidal, S.; O’Donoghue, P.; Gasser, R.; Murray, A.; Fayer, R.; et al. Molecular and phylogenetic characterisation of Cryptosporidium from birds. Int. J. Parasitol. 2001, 31, 289–296. [Google Scholar] [CrossRef] [Scilit]
  25. Mathis, A.; Weber, R.; Deplazes, P. Zoonotic potential of the microsporidia. Clin. Microbiol. Rev. 2005, 18, 423–445. [Google Scholar] [CrossRef] [Scilit]
  26. Sak, B.; Brady, D.; Pelikánová, M.; Květoňová, D.; Rost, M.; Kostka, M.; Pelikánová, M.; Tolarová, V.; Hůzová, Z.; Kváč, M. Unapparent microsporidial infection among immunocompetent humans in the Czech Republic. J. Clin. Microbiol. 2011, 49, 1064–1070. [Google Scholar] [CrossRef] [Scilit]
  27. Weber, R.; Bryan, R.T. Microsporidial infections in immunodeficient and immunocompetent patients. Clin. Infect. Dis. 1994, 19, 517–521. [Google Scholar] [CrossRef] [Scilit]
  28. Slodkowicz-Kowalska, A.; Graczyk, T.K.; Tamang, L.; Jedrzejewski, S.; Nowosad, A.; Zduniak, P.; Solarczyk, P.; Girouard, A.S.; Majewska, A.C. Microsporidian species known to infect humans are present in aquatic birds: Implications for transmission via water? Appl. Environ. Microbiol. 2006, 72, 4540–4544. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  29. Haro, M.; Izquierdo, F.; Henriques-Gil, N.; Andrés, I.; Alonso, F.; Fenoy, S.; Del Aguila, C. First detection and genotyping of human-associated microsporidia in pigeons from urban parks. Appl. Environ. Microbiol. 2005, 71, 3153–3157. [Google Scholar] [CrossRef] [Scilit]
  30. Haro, M.; Henriques-Gil, N.; Fenoy, S.; Izquierdo, F.; Alonso, F.; Del Aguila, C. Detection and genotyping of Enterocytozoon bieneusi in pigeons. J. Eukaryot. Microbiol. 2006, 53, S58–S60. [Google Scholar] [CrossRef] [Scilit]
  31. Graczyk, T.K.; Sunderland, D.; Rule, A.M.; Da Silva, A.J.; Moura, I.N.; Tamang, L.; Girouard, A.S.; Schwab, K.J.; Breysse, P.N. Urban feral pigeons (Columba livia) as a source for air-and waterborne contamination with Enterocytozoon bieneusi spores. Appl. Environ. Microbiol. 2007, 73, 4357–4358. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Giacopello, C.; Foti, M.; Mascetti, A.; Grosso, F.; Ricciardi, D.; Fisichella, V.; Lo Piccolo, F. Antimicrobial resistance patterns of Enterobacteriaceae in European wild bird species admitted in a wildlife rescue centre. Vet. Ital. 2016, 52, 139–144. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Foti, M.; Mascetti, A.; Fisichella, V.; Fulco, E.; Orlandella, B.M.; Lo Piccolo, F. Antibiotic resistance assessment in bacteria isolated in migratory Passeriformes transiting through the Metaponto territory (Basilicata, Italy). Avian Res. 2017, 8, 26. [Google Scholar] [CrossRef] [Scilit]
  34. Bertelloni, F.; Lunardo, E.; Rocchigiani, G.; Ceccherelli, R.; Ebani, V.V. Occurrence of Escherichia coli virulence genes in feces of wild birds from Central Italy. Asian Pac. J. Trop Med. 2019, 12, 142–146. [Google Scholar]
  35. Mancini, L.; Marcheggiani, S.; D’angelo, A.M.; Chiudioni, F.; Delibato, E.; Dionisi, A.M.; Owczarek, S.; De Medici, D.; Ida Luzzi, A. Case Study on Wild Birds: A Human Enteric Pathogens Transmission. J. Environ. Sci. Public Health 2020, 4, 267–281. [Google Scholar]
  36. Marotta, F.; Janowicz, A.; Di Marcantonio, L.; Ercole, C.; Di Donato, G.; Garofolo, G.; Di Giannatale, E. Molecular Characterization and Antimicrobial Susceptibility of C. jejuni Isolates from Italian Wild Bird Populations. Pathogens 2020, 9, 304. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Bertelloni, F.; Chemaly, M.; Cerri, D.; Gall, F.L.; Ebani, V.V. Salmonella infection in healthy pet reptiles: Bacteriological isolation and study of some pathogenic characters. Acta Microbiol. Immunol. Hungarica. 2016, 63, 203–216. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Hall, T.A. BioEdit: A User-Friendly Biological Sequence Alignment Editor and Analysis Program for Windows 95/98/NT; Nucleic Acids Symposium Series; Oxford Academic: London, UK, 1999; Volume 41, No. 41; pp. 95–98. [Google Scholar]
  39. Romero, C.; Gamazo, C.; Pardo, M.; Lopez-Goni, I. Specific detection of Brucella DNA by PCR. J. Clin. Microbiol. 1995, 33, 615–617. [Google Scholar] [CrossRef] [Scilit]
  40. Berri, M.; Rekiki, A.; Boumedine, A.; Rodolakis, A. Simultaneous differential detection of Chlamydophila abortus, Chlamydophila pecorum, and Coxiella burnetiid from aborted ruminant’s clinical samples using multiplex PCR. BMC Microbiol. 2009, 9, 130. [Google Scholar] [CrossRef] [Scilit]
  41. Moravkova, M.; Hlozek, P.; Beran, V.; Pavlik, I.; Preziuso, S.; Cuteri, V.; Bartos, M. Strategy for the detection and differentiation of Mycobacterium avium species in isolates and heavily infected tissues. Res. Vet. Sci. 2008, 85, 257–264. [Google Scholar] [CrossRef] [Scilit]
  42. Xiao, L.; Singh, A.; Limor, J.; Graczyk, T.K.; Gradus, S.; Lal, A. Molecular characterization of Cryptosporidium oocysts in samples of raw surface water and wastewater. Appl. Environ. Microbiol. 2001, 67, 1097–1101. [Google Scholar] [CrossRef] [Scilit]
  43. Read, C.M.; Monis, P.T.; Thompson, R.C.A. Discrimination of all genotypes of Giardia duodenalis at the glutamate dehydrogenase locus using PCR-RFLP. Infect. Genet. Evol. 2004, 4, 125–130. [Google Scholar] [CrossRef] [PubMed]
  44. Fedorko, D.P.; Nelson, N.A.; Cartwright, C.P. Identification of Microsporidia in stool specimens by using PCR and restriction endonucleases. J. Clin. Microbiol. 1995, 33, 1739–1741. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Najdenski, H.; Dimova, T.; Zaharieva, M.M.; Nikolov, B.P.; Petrova-Dinkova, G.; Dalakchieva, S.; Popov, K.S.; Hristova-Nikolova, I.P.; Zehtindjiev, P.; Peev, S.G.; et al. Migratory birds along the Mediterranean—Black Sea Flyway as carriers of zoonotic pathogens. Can. J. Microbiol. 2018, 64, 915–924. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Wareth, G.; Kheimar, A.; Neubauer, H.; Melzer, F. Susceptibility of Avian Species to Brucella Infection: A Hypothesis-Driven Study. Pathogens 2020, 9, 77. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Jordan, F.T.W.; Hampson, D.J. Some other bacterial diseases (cap 22). In Poultry Diseases, 6th ed.; Pattison, M., McMullin, P.F., Bradbury, J.M., Alexander, D.J., Eds.; Elsevier: Edinburgh, UK, 2008. [Google Scholar]
  48. To, H.; Sakai, R.; Shirota, K.; Kano, C.; Abe, S.; Sugimoto, T.; Takahara, K.; Morita, C.; Takashima, I.; Maruyama, T.; et al. Coxiellosis in domestic and wild birds from Japan. J. Wildl. Dis. 1995, 34, 310–316. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  49. Ioannou, I.; Chochlakis, D.; Kasinis, N.; Anayiotis, P.; Lyssandrou, A.; Papadopoulos, B.; Tselentis, Y.; Psaroulaki, A. Carriage of Rickettsia spp., Coxiella burnetii and Anaplasma spp. By endemic and migratory wild birds and their ectoparasites in Cyprus. Clin. Microbiol. Infect. Dis. 2009, 15, 158–160. [Google Scholar] [CrossRef] [Scilit]
  50. Astobiza, I.; Barral, M.; Ruiz-Fons, F.; Barandika, J.F.; Gerrikagoitia, X.; Hurtado, A.; Garcia-Perez, A.L. Molecular investigation of the occurrence of Coxiella burnetii in wildlife and ticks in an endemic area. Vet. Microbiol. 2011, 147, 190–194. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  51. Das, D.P.; Malik, S.V.S.; Mohan, V.; Rawool, D.B.; Barbudhe, S.B. Screening of fecal droppings of wild birds for coxiellosis by a duplex PCR targeting com1 and IS1111 genes of Coxiella burnetii. J. Foodborne. Zoonotic. Dis. 2013, 1, 14–20. [Google Scholar]
  52. Berthová, L.; Slobodník, V.; Slobodník, R.; Olekšák, M.; Sekeyová, Z.; Svitálková, Z.; Kazimírová, M.; Špitalská, E. The natural infection of birds and ticks feeding on birds with Rickettsia spp. and Coxiella burnetii in Slovakia. Exp. Appl. Acarol. 2016, 68, 299–314. [Google Scholar] [CrossRef] [Scilit]
  53. Tokarevich, N.K.; Panferova, Y.A.; Freylikhman, O.A.; Blinova, O.V.; Medvedev, S.G.; Mironov, S.V.; Grigoryeva, L.A.; Tretyakov, K.A.; Dimova, T.; Zaharieva, M.M.; et al. Coxiella burnetii in ticks and wild birds. Ticks Tick-Borne Dis. 2019, 10, 377–385. [Google Scholar] [CrossRef] [Scilit]
  54. Ebani, V.V.; Nardoni, S.; Giani, M.; Rocchigiani, G.; Archin, T.; Altomonte, I.; Poli, A.; Mancianti, F. Molecular survey on the occurrence of avian haemosporidia, Coxiella burnetii and Francisellatularensis in waterfowl from central Italy. Int. J. Parasitol. Parasit. Wildl. 2019, 10, 87–92. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  55. Ebani, V.V.; Bertelloni, F.; Mani, P. Molecular survey on zoonotic tick-borne bacteria and chlamydiae in feral pigeons (Columba livia domestica). Asian Pac. J. Trop. Med. 2016, 9, 324–327. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  56. Reed, K.D.; Meece, J.K.; Henkel, J.S.; Shukla, S.K. Birds, migration and emerging zoonoses: West nile virus, lyme disease, influenza A and enteropathogens. Clin. Med. Res. 2003, 1, 5–12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  57. Smith, O.M.; Snyder, W.E.; Owen, J.P. Are we overestimating risk of enteric pathogen spillover from wild birds to humans? Biol. Rev. Camb. Philos. Soc. 2020, 95, 652–679. [Google Scholar] [CrossRef] [Scilit]
  58. Bonardi, S.; Bolzoni, L.; Zanoni, R.G.; Morgnati, M.; Corradi, M.; Gilioli, S.; Pongolini, S. Limited Exchange of Salmonella Among Domestic Pigs and Wild Boars in Italy. EcoHealth 2019, 16, 420–428. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  59. Haeghebaert, S.; Duché, L.; Gilles, C.; Masini, B.; Dubreuil, M.; Minet, J.C.; Bouvet, P.; Grimont, F.; Delarocque Astagneau, E.; Vaillant, V. Minced beef and human salmonellosis: Review of the investigation of three outbreaks in France. Eurosurveillance 2001, 6, 21–26. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  60. Vestrheim, D.; Lange, H.; Nygard, K.; Borgen, K.; Wester, A.; Kvarme, M.; Vold, L. Are ready-to-eat salads ready to eat? An outbreak of Salmonella Coeln linked to imported, mixed, pre-washed and bagged salad, Norway, November 2013. Epidemiol. Infect. 2016, 144, 1756–1760. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  61. Majewska, A.C.; Graczyk, T.K.; Slodkowicz-Kowalska, A.; Tamang, L.; Jedrzejewski, S.; Zduniak, P.; Solarczyk, P.; Nowosad, A.; Nowosad, P. The role of free-ranging, captive, and domestic birds of Western Poland in environmental contamination with Cryptosporidium parvum oocysts and Giardia lamblia cysts. Parasitol. Res. 2009, 104, 1093–1099. [Google Scholar] [CrossRef] [Scilit]
  62. Holubova, N.; Sak, B.; Hlaskova, L.; Kvetonova, D.; Hanzal, V.; Rajsky, D.; Rost, M.; McEvoy, J.; Kvac, M. Host specificity and agedependent resistance to Cryptosporidium avium infection in chickens, ducks and pheasants. Exp. Parasitol. 2018, 191, 62–65. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  63. Wang, R.; Wang, F.; Zhao, J.; Qi, M.; Ning, C.; Zhang, L.; Xiao, L. Cryptosporidium spp. in quails (Coturnix coturnix japonica) in Henan, China: Molecular characterization and public health significance. Vet. Parasitol. 2012, 187, 534–537. [Google Scholar] [CrossRef] [Scilit]
  64. McEvoy, J.M.; Giddings, C.W. Cryptosporidium in commercially produced turkeys on-farm and post slaughter. Lett. Appl. Microbiol. 2009, 48, 302–306. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  65. Plutzer, J.; Tomor, B. The role of aquatic birds in the environmental dissemination of human pathogenic Giardia duodenalis cysts and Cryptosporidium oocysts in Hungary. Parasitol. Int. 2009, 58, 227–231. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  66. Rose, J.B.; Haas, C.N.; Regli, S. Risk assessment and control of waterborne giardiasis. Am. J. Public Health 1991, 81, 709–713. [Google Scholar] [CrossRef] [Scilit]
  67. Kucerova-Pospisilova, Z.; Carr, D.; Leitch, G.; Scanlon, M.; Visvesvara, G.S. Environmental resistance of Encephalitozoon spores. J. Eukaryot. Microbiol. 1999, 46, 11S–13S. [Google Scholar] [PubMed]
  68. Tavalla, M.; Mardani-Kateki, M.; Kazemi, F. Molecular identification of Enterocytozoon bieneusi and Encephalitozoon species in pigeons of southwest of Iran. Asian Pac. J. Trop Dis. 2017, 7, 536–538. [Google Scholar] [CrossRef] [Scilit]
  69. Pekmezci, D.; Yetismis, G.; Colak, Z.N.; Duzlu, O.; Ozkilic, G.N.; Inci, A.; Pekmezci, G.Z.; Yildirim, A. First report and molecular prevalence of potential zoonotic Enterocytozoon bieneusi in Turkish tumbler pigeons (Columba livia domestica). Med. Mycol. 2021, myab013. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  70. Barton, C.E.; Phalen, D.N.; Snowden, K.F. Prevalence of microsporidian spores shed by asymptomatic lovebirds: Evidence for a potential emerging zoonosis. J. Avian Med. Surg. 2003, 17, 197–202. [Google Scholar] [CrossRef] [Scilit]
  71. Snowden, K.; Phalen, D.N. Encephalitozoon infection in birds. Semin. Avian Exot. Pet Med. 2004, 13, 94–99. [Google Scholar] [CrossRef] [Scilit]
  72. Canny, C.J.; Ward, D.A.; Patton, S.; Orosz, S.E. Microsporidian keratoconjunctivitis in a double yellow-headed Amazon parrot (Amazona ochrocephala oratrix). J. Avian Med. Surg. 1999, 13, 279–286. [Google Scholar]
  73. Nakamura, A.A.; Homem, C.G.; Garcia, S.D.; Meireles, M.V. Keratoconjunctivitis by Encephalitozoon hellem in lovebirds (Agapornis spp.) in Brazil: Case report. Arq. Bras. Med. Vet. Zootec. 2010, 62, 816–820. [Google Scholar] [CrossRef] [Scilit]
Table 2. Positive results for at least one pathogen.
Table 2. Positive results for at least one pathogen.
Scheme IDBird SpeciesDetected PathogenMethod
I_52Larus michahellisS. enterica serovar CoelnIsolation and typing
I_77Anas penelopeCoxiella burnetiiPCR
I_107Columba liviaEncephalitozoon hellemPCR and sequencing
I_117Columba liviaEncephalitozoon hellemPCR and sequencing
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Ebani, V.V.; Guardone, L.; Bertelloni, F.; Perrucci, S.; Poli, A.; Mancianti, F. Survey on the Presence of Bacterial and Parasitic Zoonotic Agents in the Feces of Wild Birds. Vet. Sci. 2021, 8, 171. https://doi.org/10.3390/vetsci8090171

AMA Style

Ebani VV, Guardone L, Bertelloni F, Perrucci S, Poli A, Mancianti F. Survey on the Presence of Bacterial and Parasitic Zoonotic Agents in the Feces of Wild Birds. Veterinary Sciences. 2021; 8(9):171. https://doi.org/10.3390/vetsci8090171

Chicago/Turabian Style

Ebani, Valentina Virginia, Lisa Guardone, Fabrizio Bertelloni, Stefania Perrucci, Alessandro Poli, and Francesca Mancianti. 2021. "Survey on the Presence of Bacterial and Parasitic Zoonotic Agents in the Feces of Wild Birds" Veterinary Sciences 8, no. 9: 171. https://doi.org/10.3390/vetsci8090171

APA Style

Ebani, V. V., Guardone, L., Bertelloni, F., Perrucci, S., Poli, A., & Mancianti, F. (2021). Survey on the Presence of Bacterial and Parasitic Zoonotic Agents in the Feces of Wild Birds. Veterinary Sciences, 8(9), 171. https://doi.org/10.3390/vetsci8090171

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop