Helminth Infections in Cattle and Goats in Kanchanaburi, Thailand, with Focus on Strongyle Nematode Infections
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample and Data Collection
2.2. Microscopic Examination
2.3. Fecal Sample Preparation and DNA Extraction
2.4. Semi-Nested PCR for Detection and Differentiation of Strongyles
2.5. Nucleotide Sequencing and Phylogenetic Analysis
2.6. Statistical Analysis
3. Results
3.1. Detection of Gastrointestinal Helminth Eggs in Cattle and Goat Feces by Microscopic Examination
3.2. Infection Rate, Egg Burden and Risk Factors of Strongyle Infection among Cattle and Goats in Kanchanaburi Province
3.3. Molecular Identification of Gastrointestinal Strongyle in Cattle and Goat Feces
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lefevre, P.-C.; Blancou, J.; Chermette, R. Infectious and Parasitic Diseases of Livestock; Lavoisier: Paris, France, 2010. [Google Scholar]
- Roeber, F.; Jex, A.R.; Gasser, R.B. Next-generation molecular-diagnostic tools for gastrointestinal nematodes of livestock, with an emphasis on small ruminants. Adv. Parasitol. 2013, 83, 267–333. [Google Scholar] [CrossRef] [Scilit]
- Sato, M.O.; Sato, M.; Chaisiri, K.; Maipanich, W.; Yoonuan, T.; Sanguankiat, S.; Pongvongsa, T.; Boupha, B.; Moji, K.; Waikagul, J. Nematode infection among ruminants in monsoon climate (Ban-Lahanam, Lao PDR) and its role as food-borne zoonosis. Rev. Bras. Parasitol. Vet. 2014, 23, 80–84. [Google Scholar] [CrossRef] [Scilit]
- Tan, T.K.; Panchadcharam, C.; Low, V.L.; Lee, S.C.; Ngui, R.; Sharma, R.S.; AL Lim, Y. Co-infection of Haemonchus contortus and Trichostrongylus spp. among livestock in Malaysia as revealed by amplification and sequencing of the internal transcribed spacer II DNA region. BMC Vet. Res. 2014, 10, 38. [Google Scholar] [CrossRef] [Scilit]
- Puspitasari, S.; Farajallah, A.; Sulistiawati, E.; Muladno. Effectiveness of ivermectin and albendazole against Haemonchus contortus in sheep in West Java, Indonesia. Trop. Life Sci. Res. 2016, 27, 135–144. [Google Scholar]
- Kaewthamasorn, M.; Wongsamee, S. A preliminary survey of gastrointestinal and haemoparasites of beef cattle in the tropical livestock farming system in Nan Province, northern Thailand. Parasitol. Res. 2006, 99, 306–308. [Google Scholar] [CrossRef] [Scilit]
- Ratanapob, N.; Arunvipas, P.; Kasemsuwan, S.; Phimpraphai, W.; Panneum, S. Prevalence and risk factors for intestinal parasite infection in goats raised in Nakhon Pathom Province, Thailand. Trop. Anim. Health Prod. 2011, 44, 741–745. [Google Scholar] [CrossRef] [Scilit]
- Rupa, A.P.M.; Portugaliza, H.P. Prevalence and risk factors associated with gastrointestinal nematode infection in goats raised in Baybay city, Leyte, Philippines. Vet. World 2016, 9, 728–734. [Google Scholar] [CrossRef] [Scilit]
- Khan, M.N.; Sajid, M.S.; Iqbal, Z.; Hussain, A. Gastrointestinal helminthiasis: Prevalence and associated determinants in domestic ruminants of district Toba Tek Singh, Punjab, Pakistan. Parasitol. Res. 2010, 107, 787–794. [Google Scholar] [CrossRef] [Scilit]
- Raue, K.; Heuer, L.; Böhm, C.; Wolken, S.; Epe, C.; Strube, C. 10-year parasitological examination results (2003 to 2012) of faecal samples from horses, ruminants, pigs, dogs, cats, rabbits and hedgehogs. Parasitol. Res. 2017, 116, 3315–3330. [Google Scholar] [CrossRef] [Scilit]
- Sun, P.; Wronski, T.; Bariyanga, J.D.; Apio, A. Gastro-intestinal parasite infections of Ankole cattle in an unhealthy landscape: An assessment of ecological predictors. Vet. Parasitol. 2018, 252, 107–116. [Google Scholar] [CrossRef] [Scilit]
- Mohammedsalih, K.M.; Khalafalla, A.; Bashar, A.; Abakar, A.; Hessain, A.; Juma, F.-R.; Coles, G.; Krücken, J.; Von Samson-Himmelstjerna, G. Epidemiology of strongyle nematode infections and first report of benzimidazole resistance in Haemonchus contortus in goats in South Darfur State, Sudan. BMC Vet. Res. 2019, 15, 184. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dey, A.R.; Begum, N.; Anisuzzaman; Alim, A.; Alam, M.Z. Multiple anthelmintic resistance in gastrointestinal nematodes of small ruminants in Bangladesh. Parasitol. Int. 2020, 77, 102105. [Google Scholar] [CrossRef] [Scilit]
- Selemon, M. Review on control of Haemonchus contortus in sheep and goat. J. Vet. Med. Res. 2018, 5, 1139. [Google Scholar]
- Babják, M.; Königová, A.; Dolinská, M.U.; Vadlejch, J.; Várady, M. Anthelmintic resistance in goat herds—In vivo versus in vitro detection methods. Vet. Parasitol. 2018, 254, 10–14. [Google Scholar] [CrossRef] [Scilit]
- Torres-Acosta, J.; Hoste, H. Alternative or improved methods to limit gastro-intestinal parasitism in grazing sheep and goats. Small Rumin. Res. 2008, 77, 159–173. [Google Scholar] [CrossRef] [Scilit]
- Nguyen, T.; Le, Q.; Huynh, V.; Nguyen, S.; Vu-Khac, H.; Nguyen, T. The development of PCR methodology for the identification of species of the tapeworm Moniezia from cattle, goats and sheep in central Vietnam. J. Helminthol. 2011, 86, 426–429. [Google Scholar] [CrossRef] [Scilit]
- Shu, F.-F.; Lv, R.-Q.; Zhang, Y.-F.; Duan, G.; Wu, D.-Y.; Li, B.-F.; Yang, J.-F.; Zou, F.-C. Characterization of Fasciola samples by ITS of rDNA sequences revealed the existence of Fasciola hepatica and Fasciola gigantica in Yunnan Province, China. J. Parasitol. 2012, 98, 889–890. [Google Scholar] [CrossRef] [Scilit]
- Jackson, P.; Cockcroft, P. Clinical Examination of Farm Animals; Blackwell Science Ltd.: Oxford, UK, 2002. [Google Scholar]
- Edmonson, A.J.; Lean, I.J.; Weaver, L.D.; Farver, T.; Webster, G. A body condition scoring chart for Holstein dairy cows. J. Dairy Sci. 1989, 72, 68–78. [Google Scholar] [CrossRef] [Scilit]
- Ghosh, C.; Datta, S.; Mandal, D.; Das, A.; Roy, D.; Roy, A.; Tudu, N. Body condition scoring in goat: Impact and significance. J. Entomol. Zool. Stud. 2019, 7, 554–560. [Google Scholar]
- Chompoochan, T.; Prasitiratana, P.; Nakamura, Y. Preliminary study of nematode infections of cattle in the six provinces of Thailand in the dry season. J. Vet. Med. Sci. 1998, 60, 527–529. [Google Scholar] [CrossRef] [Scilit]
- Japa, O.; Siriwechviriya, P.; Prakhammin, K. Occurrence of fluke infection in beef cattle around Phayao Lake, Phayao, Thailand. Vet. World 2020, 13, 334–337. [Google Scholar] [CrossRef] [Scilit]
- Murthy, G.S.S.; Rao, P.V. Prevalence of gastro intestinal parasites in ruminants and poultry in Telangana region of Andhra Pradesh. J. Parasit. Dis. 2012, 38, 190–192. [Google Scholar] [CrossRef] [Scilit]
- Paul, B.T.; Jesse, F.F.A.; Chung, E.L.T.; Che’Amat, A.; Mohd Lila, M.A. Risk factors and severity of gastrointestinal parasites in selected small ruminants from Malaysia. Vet. Sci. 2020, 7, 208. [Google Scholar] [CrossRef] [Scilit]
- Hastutiek, P.; Yuniarti, W.M.; Djaeri, M.; Lastuti, N.D.R.; Suprihati, E.; Suwanti, L.T. Prevalence and diversity of gastrointestinal protozoa in Madura cattle at Bangkalan Regency, East Java, Indonesia. Vet. World 2019, 12, 198–204. [Google Scholar] [CrossRef] [Scilit]
- Hassan, N.M.F.; Farag, T.K.; Abu El Ezz, N.M.T.; Abou-Zeina, H.A.A. Prevalence assessment of gastrointestinal parasitic infections among goats in Giza Governorate, Egypt. Bull. Natl. Res. Cent. 2019, 43, 127. [Google Scholar] [CrossRef] [Scilit]
- Yanola, J.; Nachaiwieng, W.; Duangmano, S.; Prasannarong, M.; Somboon, P.; Pornprasert, S. Current prevalence of intestinal parasitic infections and their impact on hematological and nutritional status among Karen hill tribe children in Omkoi District, Chiang Mai Province, Thailand. Acta Trop. 2018, 180, 1–6. [Google Scholar] [CrossRef] [Scilit]
- Gulland, F.M.; Fox, M. Epidemiology of nematode infections of Soay sheep (Ovis aries L.) on St Kilda. Parasitology 1992, 105, 481–492. [Google Scholar] [CrossRef] [Scilit]
- Raza, M.A.; Iqbal, Z.; Jabbar, A.; Yaseen, M. Point prevalence of gastrointestinal helminthiasis in ruminants in southern Punjab, Pakistan. J. Helminthol. 2007, 81, 323–328. [Google Scholar] [CrossRef] [Scilit]
- Van Wyk, J.A.; Bath, G.F. The FAMACHA system for managing haemonchosis in sheep and goats by clinically identifying individual animals for treatment. Vet. Res. 2002, 33, 509–529. [Google Scholar] [CrossRef] [Scilit]
- Akkari, H.; Jebali, J.; Gharbi, M.; Mhadhbi, M.; Awadi, S.; Darghouth, M.A. Epidemiological study of sympatric Haemonchus species and genetic characterization of Haemonchus contortus in domestic ruminants in Tunisia. Vet. Parasitol. 2013, 193, 118–125. [Google Scholar] [CrossRef] [Scilit]
- Ntonifor, H.; Shei, S.; Ndaleh, N.; Mbunkur, G. Epidemiological studies of gastrointestinal parasitic infections in ruminants in Jakiri, Bui Division, North West Region of Cameroon. J. Vet. Med. Anim. Health 2013, 5, 344–352. [Google Scholar]
- Das, M.; Laha, R.; Goswami, A. Gastrointestinal parasitism of goats in hilly region of Meghalaya, India. Vet. World 2017, 10, 81–85. [Google Scholar] [CrossRef] [Scilit]
- Steel, J.; Jones, W.; Symons, L. Effects of a concurrent infection of Trichostrongylus colubriformis on the productivity and physiological and metabolic responses of lambs infected with Ostertagia circumcincta. Aust. J. Agric. Res. 1982, 33, 131–140. [Google Scholar] [CrossRef] [Scilit]
- Abakar, A.; Amin, E.; Osman, A. The interaction of coccidian and Haemonchus contortus infections in desert lambs. Sudan J. Vet. Res. 2001, 17, 15–26. [Google Scholar]
- Delano, M.L.; Mischler, S.A.; Underwood, W.J. Biology and Diseases of Ruminants: Sheep, Goats, and Cattle. In Laboratory Animal Medicine; Elsevier: Amsterdam, The Netherlands, 2002; p. 519. [Google Scholar]
- Besier, R.B.; Kahn, L.P.; Sargison, N.D.; Van Wyk, J.A. The Pathophysiology, Ecology and Epidemiology of Haemonchus contortus Infection in Small Ruminants. In Advances in Parasitology; Academic Press: San Diego, CA, USA, 2016; Volume 93, pp. 95–143. [Google Scholar]




| Primer | Sequence (5′-3′) | Region | Product Size (bp) 1 |
|---|---|---|---|
| Strongyle F2 | TGGTGAAATTTTGAACGCATAG | 5.8S rRNA | - |
| Strongyle R3 | ATGCTTAAGTTCAGCGGGTA | 28S rRNA | 324–349 |
| Cooper R | CGAATACTACTATCTCCAACATG | ITS2 | 293 |
| Haemo R | GTACACTCAAATAGWGGCAACAT | ITS2 | 227 |
| Oeso R | CTCATCTAGAACGAGGATCACA | ITS2 | 143 |
| Tricho R | CAATATTTGAYAATGACCATTCG | ITS2 | 128 |
| Helminth Species | No. of Helminth Egg Positive Samples (%) | |
|---|---|---|
| Cattle (n = 157) | Goat (n = 117) | |
| Strongyle nematodes | 45 (28.7) | 101 (86.3) |
| Strongyloides spp. | 1 (0.6) | 18 (15.4) |
| Trichuris spp. | 0 (0) | 7 (6) |
| Capillaria spp. | 1 (0.6) | 5 (4.3) |
| Paramphistomum spp. | 16 (10.2) | 9 (7.7) |
| Moniezia spp. | 1 (0.6) | 5 (4.3) |
| Total 1 | 56 (35.7) | 103 (88) |
| Factor | Number | Infection Rate (%) | 95% CI | χ2 | p-Value |
|---|---|---|---|---|---|
| Gender | |||||
| Male | 4 | 1 (25.0) | 4.55–69.93 | 0.0269 | 0.8697 |
| Female | 153 | 44 (28.8) | 22.17–36.38 | - | - |
| Age | |||||
| Young | 0 | 0 (0) | - | - | - |
| Adult | 157 | 45 (28.7) | 22.16–36.17 | - | - |
| Body condition score | |||||
| Fat | 22 | 7 (31.8) | 16.36–52.68 | 0.481 | 0.786 |
| Average | 117 | 34 (29.1) | 21.60–37.84 | - | - |
| Thin | 18 | 4 (22.2) | 9.01–45.21 | - | - |
| Oral mucosa color | |||||
| Pink | 85 | 29 (34.1) | 24.92–44.68 | 2.886 | 0.2361 |
| Pale pink | 69 | 15 (21.7) | 13.64–32.81 | - | - |
| Pale | 3 | 1 (33.3) | 6.14–79.23 | - | - |
| PCV categories | |||||
| Non-anemic | 131 | 40 (30.5) | 23.29–38.88 | 1.356 | 0.244 |
| Anemic | 26 | 5 (19.2) | 8.51–37.87 | - | - |
| Production purpose | |||||
| Dairy | 125 | 43 (34.4) | 26.64–43.08 | 9.873 | 0.002 * |
| Meat | 32 | 2 (6.3) | 1.73–20.14 | - | - |
| Management | |||||
| Intensive | 141 | 44 (31.2) | 24.14–39.26 | 4.377 | 0.036 * |
| Extensive | 16 | 1 (6.3) | 0.28–8.71 | - | - |
| Deworming interval | |||||
| ≤6 months | 30 | 0 (0) | 0.00–11.35 | 14.901 | <0.001 * |
| >6 months | 127 | 45 (35.4) | 27.65–44.06 | - | - |
| a Flocks | |||||
| A | 16 | 1 (6.3) | 1.11–28.32 | 34.499 | <0.001 * |
| B | 1 | 1 (100) | 20.65–100.00 | - | - |
| C | 14 | 6 (42.9) | 21.38–67.41 | - | - |
| D | 15 | 7 (46.7) | 24.81–69.88 | - | - |
| E | 15 | 2 (13.3) | 3.73–37.88 | - | - |
| F | 13 | 8 (61.5) | 35.52–82.29 | - | - |
| G | 13 | 6 (46.2) | 23.21–70.86 | - | - |
| H | 15 | 0 (0) | 0.00–20.39 | - | - |
| I | 20 | 6 (30) | 14.55–51.89 | - | - |
| J | 20 | 8 (40) | 21.88–61.34 | - | - |
| K | 15 | 0 (0) | 0.00–20.39 | - | - |
| Overall | 157 | 45 (28.7) | 22.16–36.18 | - | - |
| Factor | Number | Infection Rate (%) | 95% CI | χ2 | p-Value |
|---|---|---|---|---|---|
| Gender | |||||
| Male | 18 | 11 (61.1) | 38.61–79.69 | 11.456 | <0.001 * |
| Female | 99 | 90 (90.9) | 83.61–95.14 | - | - |
| Age | |||||
| Young | 5 | 4 (80) | 37.55–96.37 | 0.177 | 0.674 |
| Adult | 112 | 97 (86.6) | 79.07–91.71 | - | - |
| Body condition score | |||||
| Fat | 15 | 12 (80) | 54.81–92.95 | 4.006 | 0.134 |
| Average | 82 | 69 (84.1) | 74.74–90.49 | - | - |
| Thin | 20 | 20 (100) | 83.88–100.00 | - | - |
| Oral mucosa color | |||||
| Pink | 37 | 26 (70.3) | 54.21–82.51 | 11.848 | 0.003 * |
| Pale pink | 79 | 74 (93.7) | 86.02–97.26 | - | - |
| Pale | 1 | 1 (100) | 20.65–100.00 | - | - |
| PCV categories | |||||
| Non-anemic | 98 | 83 (84.7) | 76.27–90.49 | 1.3597 | 0.243 |
| Anemic | 19 | 18 (94.7) | 75.36–99.06 | - | - |
| Production purpose | - | - | |||
| Dairy | 20 | 11 (55) | 34.20–74.18 | 20.052 | <0.001 * |
| Meat | 97 | 90 (92.8) | 85.84–96.46 | - | - |
| Management | |||||
| Intensive | 18 | 11 (61.1) | 38.61–79.69 | 11.456 | <0.001 * |
| Extensive | 99 | 90 (90.9) | 83.61–95.14 | - | - |
| Deworming interval | |||||
| ≤6 months | 18 | 11 (61.1) | 38.61–79.69 | 11.456 | <0.001 * |
| >6 months | 99 | 90 (90.9) | 83.61–95.14 | - | - |
| a Flocks | |||||
| a | 18 | 11 (61.1) | 38.61–79.69 | 32.197 | <0.001 * |
| b | 15 | 14 (93.3) | 70.18–98.81 | - | - |
| c | 15 | 14 (93.3) | 70.18–98.81 | - | - |
| d | 15 | 11 (73.3) | 48.04–89.10 | - | - |
| e | 19 | 19 (100) | 83.18–100.00 | - | - |
| f | 2 | 0 (0) | 0.00–65.76 | - | - |
| g | 15 | 14 (93.3) | 70.18–98.81 | - | - |
| h | 3 | 3 (100) | 43.85–100.00 | - | - |
| i | 15 | 15 (100) | 79.61–100.00 | - | - |
| Overall | 117 | 101 (86.3) | 78.93–91.40 | - | - |
| Risk Factor | Coefficient | SE | z-Score | p-Value | AOR | 95% CI |
|---|---|---|---|---|---|---|
| Cattle | ||||||
| Production purpose | 1.6232 | 0.6349 | 2.556 | 0.011 | 5.069 | 1.461–17.595 |
| Goat | ||||||
| Gender | −1.6625 | 0.6679 | −2.489 | 0.013 | 0.189 | 0.051–0.702 |
| Production purpose | −2.2241 | 0.6286 | −3.538 | <0.001 | 0.108 | 0.032–0.371 |
| Strongyle Infection | No. of Strongyle Detected (%) | |
|---|---|---|
| Cattle (n = 24) | Goat (n = 24) | |
| Strongyle detection by PCR | 19 (79.2) | 24 (100) |
| Cooperia spp. | 17 (70.8) | 9 (37.5) |
| Haemonchus spp. | 4 (16.7) | 24 (100) |
| Oesophagostomum spp. | 7 (29.2) | 9 (37.5) |
| Trichostrongylus spp. | 11 (45.8) | 22 (91.7) |
| Single infection | 5 (20.8) | 1 (4.2) |
| Cooperia spp. | 4 (16.7) | - |
| Haemonchus spp. | - | 1 (4.2) |
| Oesophagostomum spp. | 1 (4.2) | - |
| Coinfection | 14 (58.3) | 23 (95.8) |
| C + H | 2 (8.3) | 1 (4.2) |
| C + O | 1 (4.2) | - |
| C + T | 4 (16.7) | - |
| H + T | - | 9 (37.5) |
| O + T | 1 (4.2) | - |
| C + H + T | 2 (8.3) | 4 (16.7) |
| C + O + T | 4 (16.7) | - |
| H + O + T | - | 5 (20.8) |
| C + H + O + T | - | 4 (16.7) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Income, N.; Tongshoob, J.; Taksinoros, S.; Adisakwattana, P.; Rotejanaprasert, C.; Maneekan, P.; Kosoltanapiwat, N. Helminth Infections in Cattle and Goats in Kanchanaburi, Thailand, with Focus on Strongyle Nematode Infections. Vet. Sci. 2021, 8, 324. https://doi.org/10.3390/vetsci8120324
Income N, Tongshoob J, Taksinoros S, Adisakwattana P, Rotejanaprasert C, Maneekan P, Kosoltanapiwat N. Helminth Infections in Cattle and Goats in Kanchanaburi, Thailand, with Focus on Strongyle Nematode Infections. Veterinary Sciences. 2021; 8(12):324. https://doi.org/10.3390/vetsci8120324
Chicago/Turabian StyleIncome, Nicharee, Jarinee Tongshoob, Sarawut Taksinoros, Poom Adisakwattana, Chawarat Rotejanaprasert, Pannamas Maneekan, and Nathamon Kosoltanapiwat. 2021. "Helminth Infections in Cattle and Goats in Kanchanaburi, Thailand, with Focus on Strongyle Nematode Infections" Veterinary Sciences 8, no. 12: 324. https://doi.org/10.3390/vetsci8120324
APA StyleIncome, N., Tongshoob, J., Taksinoros, S., Adisakwattana, P., Rotejanaprasert, C., Maneekan, P., & Kosoltanapiwat, N. (2021). Helminth Infections in Cattle and Goats in Kanchanaburi, Thailand, with Focus on Strongyle Nematode Infections. Veterinary Sciences, 8(12), 324. https://doi.org/10.3390/vetsci8120324

