Next Article in Journal
Antiparasitic Activity of Hedera helix Extract-Loaded Chitosan Nanoparticles in Experimentally Induced Giardiasis
Previous Article in Journal
Evaluation of Different Benzimidazole Formulations Against Sheep Naturally Infected with Fasciola hepatica and Anthelmintic Resistance Analysis
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Veterinary Sciences
Volume 13
Issue 2
10.3390/vetsci13020206
vetsci-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Establishment of a One-Step Rapid Visual Detection Method for Pigeon Circovirus Based on the RAA-CRISPR/Cas12a Assay

by
Chunxia Wang
†,
Mengle Tang
†,
Lina Liu
,
Erkai Feng
,
Guoliang Luo
,
Danni Wu
,
Yaxi Zhou
,
Shun Wu
,
Yuening Cheng
* and
Zhenjun Wang
*
Institute of Special Animal and Plant Science, Chinese Academy of Agriculture Science, Changchun 130112, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Vet. Sci. 2026, 13(2), 206; https://doi.org/10.3390/vetsci13020206
Submission received: 23 January 2026 / Revised: 14 February 2026 / Accepted: 20 February 2026 / Published: 22 February 2026
(This article belongs to the Section Veterinary Biomedical Sciences)
Browse Figures
Versions Notes

Simple Summary

Pigeon circovirus is one of the important pathogens that threaten the development of the pigeon industry. Rapid and accurate detection is crucial for preventing the outbreak of this disease. In this study, we combined the efficient recombinase-aided amplification (RAA) isothermal amplification technology with the precise recognition and strong signal amplification capabilities of the CRISPR/Cas12a assay, then developed a rapid and accurate diagnostic method for pigeon circovirus. This method is easy to operate and supports on-site rapid detection, with results available within 30 min. Meanwhile, it has high specificity and shows no cross-reactions with other viruses, and can detect extremely low viral loads. More innovatively, the entire detection process is completed in a closed system, which significantly reduces the risk of aerosol contamination caused by lid-opening operations and effectively lowering the risk of false positives. This method provides an important technical means for then on-site rapid diagnosis of Pigeon circovirus and demonstrates broad prospects for clinical application.

Abstract

Pigeon circovirus (PiCV) is an important pathogen that infects pigeons, which can induce multiple disorders such as immunosuppression and respiratory symptoms, posing a serious threat to the pigeon industry. In this study, we combined the RAA and CRISPR/Cas12a assay to establish a highly sensitive and accurate detection method for PiCV. This detection method amplifies the target nucleic acids through RAA; and the resultant dsDNA is specifically recognized by crRNA, the trans-cleavage activity of Cas12a is activated, which further cleaves the fluorescent reporter group to generate a fluorescent signal that can be visually observed under blue light. The method established in this study exhibited high sensitivity, with a minimum detection limit of 6.08 copies/µL. It showed no cross-reactivity with non-PiCV samples, demonstrating high specificity. When 40 clinical samples were tested by this method and quantitative polymerase chain reaction (qPCR) respectively, the coincidence rate was 92.5%, and the method developed herein achieved a higher positive detection rate. In conclusion, we successfully developed a rapid, on-site operable, one-step visual detection method for PiCV, which holds promising application prospects.

1. Introduction

Pigeon circovirus (PiCV), belonging to the genus Circovirus within the family Circoviridae, is recognized as one of the important pathogenic agents threatening pigeon health. The virus has a single-stranded circular DNA genome and primarily infects young pigeons with immature immune systems, inducing lymphocyte apoptosis and immune organ damage, thereby leading to severe immunosuppression [1]. Post-infection clinical symptoms are mostly nonspecific, including anorexia, lethargy, growth retardation, feather dysplasia, respiratory signs, and diarrhea. The condition is frequently complicated by secondary bacterial, fungal, or other viral infections, with the overall morbidity and mortality rates ranging from 30% to 70% [2]. Hence, PiCV infection is regarded as a typical and complex immunosuppressive syndrome [3,4].
PiCV exhibits extremely strong transmissibility and can spread rapidly among pigeon populations via two routes: horizontal transmission (e.g., direct contact with infected pigeons, ingestion of contaminated feed and water, inhalation of virus-containing aerosols) and vertical transmission (from parent to offspring through hatching eggs) [5]. This highly efficient transmission mode, combined with the virus’s strong resistance to environmental stressors, renders its eradication difficult in intensively farmed pigeon flocks. Current research generally acknowledges that PiCV serves as the core pathogen or key predisposing factor for Young Pigeon Disease Syndrome (YPDS) [6]. YPDS is a clinical syndrome characterized by multifactorial etiology and multisystem failure, and the immunodeficiency caused by PiCV infection constitutes a critical underlying mechanism that renders pigeons susceptible to secondary infections and subsequent progression to the syndrome.
The first official report of this virus dates back to 1993 in the United States [7]. With the vigorous development of global racing pigeon sports and the increasing frequency of the international exchange of breeding pigeons and trade in avian products, the virus has spread worldwide. To date, PiCV infection has been reported to prevail in at least 16 countries and regions across the globe [8], emerging as a cosmopolitan pigeon disease. In China, the first laboratory-confirmed Case of PiCV infection was diagnosed and reported in Zhejiang Province in 2009 [9], which filled the gap in the epidemiological records of this disease in the country. Continuous surveillance and research in recent years have indicated that the infection rate of PiCV in pigeon flocks across multiple regions of China has shown a marked upward trend, with its epidemic range expanding progressively [10,11]. This poses a severe challenge to the large-scale racing pigeon industry and intensive meat pigeon farming sector, not only causing direct economic losses but also imposing higher requirements on the biosafety prevention and control system of the entire industry.
To date, PiCV has not been successfully propagated in in vitro cell culture systems, which has resulted in all relevant research on this virus currently focusing on the analysis of its genomic structure [12]. This technical bottleneck poses a persistent challenge to the effective prevention, control, and clinical management of PiCV, and also highlights the urgency and significance of establishing timely and reliable early diagnostic techniques. At present, the mainstream detection methods for PiCV mainly include polymerase chain reaction (PCR) [13], quantitative real-time PCR (qPCR) [14], loop-mediated isothermal amplification (LAMP) [15], and enzyme-linked immunosorbent assay (ELISA) [16]. Although these techniques have their respective advantages in terms of sensitivity and specificity, they generally rely on sophisticated instrumentation, standardized laboratory conditions, and professionally trained operators, making it difficult to rapidly promote and apply them in grassroots field settings or under resource-limited conditions. Therefore, to meet the practical needs of clinical on-site detection and grassroots monitoring, there is an urgent need to develop a novel PiCV detection method that is simple to operate, rapid in reaction, and characterized by high sensitivity and high specificity simultaneously. Such a technique is expected to significantly improve the capacity for early diagnosis of this virus, providing an effective tool for the health management of pigeon flocks and the prevention and control of related diseases.
At present, the CRISPR-Cas system has become the tool of choice for genome editing. First discovered in the 1980s, this system consists of clustered, regularly interspaced short palindromic repeats. Through the synergistic action of Cas proteins and guide RNAs, it can precisely recognize and cleave specific nucleic acid sequences, thus bringing revolutionary breakthroughs to gene function research, disease treatment, and detection technologies [17]. Meanwhile, recombinase-aided amplification (RAA), as an emerging in vitro nucleic acid amplification method, has attracted widespread attention due to its unique advantages. By utilizing recombinase, single-stranded DNA-binding protein, and strand-displacing DNA polymerase, RAA enables the exponential amplification of target sequences under isothermal conditions (typically 37–42 °C). This technique completely eliminates the reliance on temperature cycling equipment of conventional PCR instruments, significantly reducing operational complexity and time costs (within 20 min), and is therefore particularly suitable for on-site rapid detection and resource-limited settings [18]. In recent years, researchers have keenly recognized the enormous potential of combining RAA with the CRISPR/Cas system. Integrating the high-efficiency amplification capability of RAA with the high-specificity recognition and signal amplification properties of Cas12a allows for the construction of a nucleic acid detection platform with both high sensitivity and high specificity. This combined strategy has been successfully applied in multiple fields including infectious pathogen detection [19,20,21,22], mutation screening [23], and even food safety monitoring [24], demonstrating broad prospects in point-of-care diagnostics and precision medicine.
Therefore, this study aimed to develop an RAA-CRISPR/Cas12a detection system for PiCV, thereby overcoming the limitations of the existing detection methods and improving the diagnostic level of PiCV.

2. Materials and Methods

2.1. Virus Strains and Clinical Samples

The positive plasmid of PiCV Rep (400 ng/µL) was constructed in our laboratory. Pigeon paramyxovirus type 1 (PPMV), pigeon herpesvirus (PiHV), fowl adenovirus (FAdV), avian rotavirus (ARV), and pigeon pox virus (PPV) were all preserved in our laboratory at −80 °C. From April 2023 to July 2025, a total of 40 tissue samples (each sample consists of a pooled homogenate of the spleen, liver and lung from a single pigeon) with visceral lesions suspected of PiCV infection were collected from live poultry markets and two pigeon farms in Jilin Province, China, for clinical detection through the use of the nucleic acids above-mentioned, which were extracted in accordance with the operating protocol of the Viral Genomic DNA/RNA Rapid Extraction Kit (Tiangen, Beijing, China) and stored at −80 °C until further use.

2.2. Primer and Probe Design and Synthesis

Given the high conservation of the PiCV Rep gene [25], based on the alignment of different genomic sequences, we designed five types of specific crRNA primers targeting this gene. These primers were incorporated with the T7 promoter, the scaffold sequence of Cas12a, and the 20 bp sequence adjacent to the PAM sequence as essential reference elements. To inhibit the non-specific cleavage activity of Cas12a, the ssDNA probes used in this study were specially modified at their terminals to ensure the specificity of fluorescence signal output and enable their application in on-site detection. For the amplification of target fragments, two pairs of RAA primers were designed in accordance with the RAA primer design principles (Table 1). All oligonucleotides were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China).

2.3. crRNA Synthesis and Screening

The synthesis of crRNA was performed through multiple steps. First, double-stranded DNA (dsDNA) were obtained and purified via PCR amplification, followed by transcription of the dsDNA into RNA using a HiScribe T7 Quick High Yield RNA Synthesis Kit (BioLabs, Ipswich, NE, USA). Subsequently, high-purity crRNA was further obtained by following the instructions of the Monarch RNA Cleanup Kit (BioLabs, Ipswich, New England). To screen for the optimal crRNA, a reaction system with a total volume of 20 µL was prepared, containing 0.5 µL of Cas12a protein (10 µM) (Huich, Shanghai, China), 1.0 µL of fluorescent probe (10 µM), 2.0 µL of crRNA (50 ng/µL), 2.0 µL of recombinant plasmid harboring the PiCV Rep gene, 2.0 µL of Cas12a 10 × buffer reaction buffer (Huich, Shanghai, China), and 12.5 µL of nuclease-free H2O. Fluorescence detection was performed using a qPCR instrument to screen for the crRNA with the strongest fluorescence intensity. The reaction conditions were set as follows: 37 °C for 20 cycles, with fluorescence signals collected every 2 min. Subsequently, the optimal crRNA was subjected to serial dilution to prepare a series of concentrations ranging from 300 ng/µL to 50 ng/µL. qPCR instrument was employed again to screen for the crRNA concentration that yielded the maximum fluorescence intensity.

2.4. RAA Primer Screening

The two designed primer sets were cross-combined into four primer pairs: F1R1, F1R2, F2R1, and F2R2. The RAA reaction was performed following the instructions of the RAA Nucleic Acid Amplification Kit (ZC Bioscience, Zhejiang, China). A 25-μL reaction system was prepared, containing 25 µL of Buffer A, 2 µL each of forward and reverse primers (10 µM), and 13.5 µL of ddH2O. The mixture was thoroughly combined and transferred to a detection tube containing the reaction lyophilized powder. Subsequently, the PiCV positive plasmid and 2.5 µL of Buffer B were added to the tube. After mixing, the reaction was incubated at 39 °C for 30 min. Upon completion of the reaction, 50 µL of phenol:chloroform:isoamyl alcohol (25:24:1) DNA extraction solution was added into the detection unit tube. Following centrifugation, the supernatant was collected and analyzed by agarose gel electrophoresis. The primer pair that produced the brightest target band with no non-specific amplification was selected as optimal.

2.5. Optimization of RAA Reaction Conditions

To systematically optimize the RAA amplification conditions, we sequentially evaluated two key parameters: reaction temperature and reaction time. The 10-fold serially diluted PiCV Rep plasmids (range from 6.08 × 103 to 6.08 × 100 copies/µL) were used as the detection templates. The amplification reactions were performed at 37 °C, 39 °C and 42 °C, respectively, using the pre-optimized RAA primers. The amplification products were then subjected to CRISPR/Cas12a-mediated fluorescence detection, and the optimal reaction temperature was determined by comparing the fluorescence intensities. Subsequently, at this optimal temperature, the effects of different amplification durations (10, 20 and 30 min) were further investigated. The optimal reaction time was also determined according to the fluorescence signal intensity using the CRISPR/Cas12a fluorescence detection assay.

2.6. One-Tube Assay for RAA-CRISPR/Cas12a

The one-tube detection assay was performed as follows. First, 20 µL of the Cas12a reaction mixture was added to a microcentrifuge tube. This tube was then inverted and suspended over a larger tube containing the RAA reaction mixture, ensuring that the liquids did not make contact. The RAA reaction was first incubated in a water bath at 39 °C for 10 min to allow amplification. After incubation, the assembly was briefly centrifuged to combine the Cas12a mixture with the RAA amplification products. The combined reaction was then further incubated at 42 °C for 20 min. Finally, the presence of a fluorescent signal was observed under blue light irradiation.

2.7. Sensitivity Analysis of RAA-CRISPR/Cas12a Assay

To further verify the sensitivity of the RAA-CRISPR/Cas12a assay, this experiment was applied the optimal reaction conditions optimized above. The 10-fold serially diluted PiCV Rep plasmids (range from 6.08 × 103 to 6.08 × 10−1 copies/µL) were used as the detection templates and directly added to the one-tube RAA-CRISPR/Cas12a assay. By comparing the intensity of fluorescence signals corresponding to plasmid templates with different copy numbers, the limit of detection (LOD) of this assay for the target sequence was determined, thereby clarifying its sensitivity level.

2.8. Specificity Analysis of RAA-CRISPR/Cas12a Assay

To systematically evaluate the specificity of this detection assay and avoid non-specific reactions induced by nucleic acids of other pathogens in complex sample matrices, we selected nucleic acids of various common viruses in pigeon populations as the detection targets. These viruses included PPMV, PiHV, FAdV, ARV, and PPV. Meanwhile, to explicitly verify the method’s capability for accurate identification of the target pathogen, PiCV nucleic acids and its positive plasmid were also included as positive controls. All samples were subjected to the RAA-CRISPR/Cas12a assay following the optimized reaction system and procedure, and the specificity of the method was determined by comparing the fluorescence signal intensities generated by different samples during the reaction.

2.9. Clinical Sample Test

To evaluate the clinical applicability of this method, 40 clinically collected pigeon samples were selected for verification. All samples were simultaneously subjected to parallel detection using the RAA-CRISPR/Cas12a assay established in this study and the reported qPCR method [12], followed by a comparative analysis of the results obtained from the two methods. The reliability, sensitivity, and specificity of the newly established method for detecting actual clinical samples were evaluated by calculating the agreement rate of the detection results of the two methods, including the positive coincidence rate and negative coincidence rate.

3. Results

3.1. Synthesis and Screening of crRNA

Five crRNAs (crRNA1–crRNA5) were synthesized following the method described above. Fluorescence intensity was measured via qPCR instrument. The results showed that crRNA3 exhibited the highest fluorescence intensity (Figure 1A), and the fluorescence intensity reached its peak when the concentration of crRNA3 was 100 ng/µL (Figure 1B). Therefore, in this study, 100 ng/µL of crRNA3 was selected for the RAA-CRISPR/Cas12a assay.

3.2. Determination of the Optimal RAA Primers

To screen out the optimal amplification primers, we compared the amplification efficiencies of four designed and synthesized sets of RAA primers, respectively. The gel electrophoresis results showed that under the same reaction conditions, when the F1/R2 primer pair was used for amplification, the obtained target band was clear and its brightness was significantly higher than those of the other primer sets. This result indicated that this primer pair had excellent amplification efficiency (Figure 2). Therefore, the F1/R2 primer pair was selected for RAA amplification in all subsequent experiments of this study.

3.3. Determination of RAA Reaction Conditions

Using PiCV positive plasmids with different concentrations as templates, we optimized the reaction temperature of RAA. The results showed that the highest amplification efficiency and the strongest fluorescence intensity were achieved at 39 °C (Figure 3A,B). Further time-gradient experiments demonstrated that the maximum fluorescence intensity could be reached within 10 min of reaction (Figure 3C,D). Based on the above results, the optimal RAA reaction conditions determined in this study were as follows: incubation at 39 °C for 10 min.

3.4. Sensitivity Result of the RAA-CRISPR/Cas12a Assay

In this study, a 10-fold serial dilution of the PiCV Rep gene plasmid was used as the template to evaluate the sensitivity of the RAA-CRISPR/Cas12a detection assay. The results showed that the limit of detection (LOD) of this method could reach 6.08 copies/µL (Figure 4A,B), demonstrating its high sensitivity and capability for the highly sensitive detection of PiCV.

3.5. Specificity Results of the RAA-CRISPR/Cas12a Assay

To evaluate the specificity of this method, the genomic DNA and positive plasmid of PiCV were used as positive controls, while the nucleic acids of several other common avian pathogens in pigeons served as non-target controls; parallel detection was performed under identical conditions. The experimental results showed that this method could accurately distinguish between target and non-target nucleic acids. After the reaction, strong specific fluorescent signals were only observed in the groups containing PiCV genomic DNA and positive plasmid. No obvious fluorescence enhancement was detected in all non-target viral nucleic acid samples (Figure 5A,B).

3.6. Clinical Sample Detection

To evaluate the effectiveness and reliability of the RAA-CRISPR/Cas12a assay in clinical practice, 40 clinical samples were detected using this assay and qPCR respectively. The results demonstrated that 34 samples were positive and 6 were negative by RAA-CRISPR/Cas12a, whereas 31 samples were positive by qPCR, all of which were included in the positive samples identified by the former. Calculations revealed that the positive agreement rate was approximately 91.8%, the negative agreement rate was 66.7%, and the overall agreement rate was 92.5%. The two methods exhibited good detection consistency, with RAA-CRISPR/Cas12a demonstrating a higher positive detection rate (Table 2).

4. Discussion

CRISPR/Cas12a is an RNA-guided class V endonuclease. As a versatile biotechnology platform, it not only serves as a highly efficient genome editing tool, but its trans-cleavage activity triggered by targeted DNA cleavage also renders it a pivotal tool in fields such as high-sensitivity molecular diagnostics and live-cell DNA imaging [26]. It exhibits promising application potential in the point-of-care testing of viruses, gene mutations, and pathogenic bacteria.
PiCV is an important pathogen that infects domestic and wild pigeons, with a worldwide distribution. Approximately 40% of infected pigeons show no obvious clinical symptoms [4], but the virus can continuously damage multiple organs of the host and induce lymphocyte apoptosis [27]. As an immunosuppressive disease, PiCV is prone to synergistic interaction with other pathogens, often resulting in mixed infections and causing severe economic losses to the pigeon farming industry [28]. Over the three decades since PiCV was first discovered, the virus has proven consistently difficult to propagate in laboratory cultures. This has posed considerable challenges to scientific research and impeded both in-depth investigations into the virus and the development of effective prevention and control strategies. Given the high prevalence of asymptomatic infections in pigeon populations, PiCV can spread covertly—facilitating its rapid dissemination and exacerbating the difficulties of epidemic prevention and control. In the early 2000s, Manertz became the first to characterize and publish the complete genome sequence of PiCV, providing a critical molecular foundation for more accurate detection in pigeon hosts [29]. Building on this breakthrough, detection methods such as PCR and qPCR were successively established. However, PiCV has been confirmed to exhibit high genetic diversity and a propensity for genetic recombination [30], which imposes inherent limitations on PCR-based techniques: even primer sets designed to target conserved genomic regions may fail to detect all variant strains.
Pigeon circovirus (PiCV) mainly infects birds of the order Columbiformes. However, recent studies have confirmed that the virus exhibits host generalization and can cross order-level taxonomic barriers to naturally infect distantly related bird species. In one study, PCR detection revealed that the capsid (cap) gene of PiCV was detected in 16 bird species belonging to 7 other orders, in addition to columbiform hosts such as domestic pigeons, wild pigeons, and turtle doves. These included species from Anseriformes (Aix galericulata), Galliformes (Pavo cristatus), and Phoenicopteriformes (Phoenicopterus ruber), among others [31]. This suggests that the potential host range of PiCV in nature may be broader than traditionally recognized, and its epidemiological surveillance should not be restricted only to Columbiformes birds.
Furthermore, considering that most pigeon farms are small-scale and lack adequate testing infrastructure, the development and application of a rapid, simple, highly specific, and sensitive PiCV detection method have become particularly urgent. Against this backdrop, the RAA-CRISPR/Cas12a assay employed in the present study integrates efficient isothermal amplification with the precise target recognition and robust signal amplification capabilities of the CRISPR system, thereby establishing a rapid, accurate, and sensitive diagnostic method. Unlike traditional detection technologies such as PCR, LAMP, and ELISA that rely on thermal cycling and complex equipment, this method does not require high-temperature conditions or expensive instruments and is suitable for on-site and point-of-care testing. Compared with the SHERLOCK and DETECTR systems, which also belong to the CRISPR detection platform, RAA technology shows more significant advantages: simpler operation procedures, lower detection costs, and the ability to complete visual result interpretation within 30 min [32]. Additionally, we integrated these technologies into a closed single-tube system, which prevents false positives caused by aerosol contamination and enhances the overall accuracy of the detection method.
During the study, it was found that when the positive plasmid was used as the template to verify the RAA-CRISPR/Cas12a detection system, the fluorescence intensity of the experimental groups tended to be consistent when the template concentration reached or exceeded 102 copies/µL, and did not further increase with the rise of plasmid concentration. We speculate that under this concentration condition, the fluorescent probes might have been completely cleaved by the system and the reaction reached a saturated state, thus leading to the stabilization of the fluorescence signal. It should be clarified that this study aimed to establish a highly sensitive qualitative detection method, and its primary goal was to achieve detection at the single-copy level. Therefore, the fluorescence signal saturation observed at high template concentrations does not affect the excellent performance of this method in the low-concentration range; on the contrary, its strong signal output ensures the clarity and reliability of positive results. To address this phenomenon, in subsequent studies, we will conduct fine gradient experiments in the near-saturation interval to broaden the linear range of the detection system, avoid premature signal saturation, and thereby improve the accuracy and dynamic range of quantitative detection.

5. Conclusions

We successfully established a novel molecular diagnostic technology based on the RAA and CRISPR/Cas12a system, which enables one-step, on-site, and visual rapid detection of PiCV infection. This method integrates nucleic acid amplification and CRISPR-based detection reactions into a single closed tube, eliminating the need for tube opening during the operation. As a result, it significantly reduces the risk of false-positive results caused by aerosol contamination and effectively improves the reliability of detection. In terms of performance, this assay exhibits excellent sensitivity and high specificity, along with the advantages of simple operation, rapid detection (completed within 30 min), low equipment dependence, and direct visual interpretation of results by the naked eye. These characteristics render it particularly suitable for pathogen screening at grassroots field settings and resource-limited environments, thus demonstrating broad clinical application potential and popularization value.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/vetsci13020206/s1, Figures S1–S3: Fluorescence intensities of PiCV Rep gene plasmids at different concentrations after reaction for different durations (10, 20, 30 min) at the optimal temperature; Figures S4–S6: Optimization of RAA reaction conditions. Fluorescence intensities of PiCV Rep gene plasmids at different concentrations (6.08 × 103 to 100 copies/µL) incubated at 37 °C, 39 °C and 42 °C; Figure S7: Sensitivity analysis of the RAA-CRISPR/Cas12a assay. Fluorescence intensities detected by the RAA-CRISPR/Cas12a reaction for PiCV Rep gene plasmids at different concentrations (6.08 × 103 to 10−1 copies/µL); Figure S8: Specificity analysis of the RAA-CRISPR/Cas12a Assay. Fluorescence intensities of nucleic acids from positive plasmid control, PiCV, PPMV, PiHV, FAdV, ARV, and PPV detected by the assay.

Author Contributions

Conceptualization, C.W.; methodology, C.W. and M.T.; software, E.F.; validation, L.L.; formal analysis, C.W. and Y.C.; investigation, M.T.; resources, Z.W.; data curation, D.W.; writing—original draft preparation, C.W.; writing—review and editing, Y.C. and Z.W.; visualization, Y.Z.; supervision, S.W.; project administration, G.L.; funding acquisition, Z.W. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Department of Science and Technology of Jilin Province, grant number YDZI202501ZYTS559, and the Science and Technology Innovation Project of the Chinese Academy of Agricultural Sciences (CAAS-ASTIP-2021-ISAPS).

Institutional Review Board Statement

The animal study was approved by the Animal Ethics Committee of Institute of Special Animal and Plant Sciences, Chinese Academy of Agricultural Sciences (NO. ISAPSAEC-2023-036PC; 17 March 2023). The study was conducted in accordance with the local legislation and institutional requirements.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as potential conflicts of interest.

References

  1. Stenzel, T.; Dziewulska, D.; Tykałowski, B.; Śmiałek, M.; Kowalczyk, J.; Koncicki, A. Immunogenicity of pigeon circovirus recombinant capsid protein in pigeons. Viruses 2018, 10, 596. [Google Scholar] [CrossRef]
  2. Stenzel, T.A.; Pestka, D.; Tykałowski, B.; Śmiałek, M.; Koncicki, A. Epidemiological investigation of selected pigeon viral infections in Poland. Vet. Rec. 2012, 171, 562. [Google Scholar] [CrossRef] [PubMed]
  3. Stenzel, T.; Pestka, D.; Choszcz, D. The prevalence and genetic characterization of chlamydia psittaci from domestic and feral pigeons in Poland and the correlation between infection rate and incidence of pigeon circovirus. Poult. Sci. 2014, 93, 3009–3016. [Google Scholar] [CrossRef]
  4. Zhang, Z.; Dai, W.; Wang, S.; Dai, D. Epidemiology and genetic characteristics of pigeon circovirus (PiCV) in eastern China. Arch. Virol. 2015, 160, 199–206. [Google Scholar] [CrossRef]
  5. Nath, B.K.; Das, T.; Peters, A.; Gupta, S.D.; Sarker, S.; Forwood, J.K.; Raidal, S.R.; Das, S. Australasian pigeon circoviruses demonstrate natural spillover infection. Viruses 2023, 15, 2025. [Google Scholar] [CrossRef]
  6. Stenzel, T.; Dziewulska, D.; Śmiałek, M.; Tykałowski, B.; Kowalczyk, J.; Koncicki, A. Comparison of the immune response to vaccination with pigeon circovirus recombinant capsid protein (PiCV rCP) in pigeons uninfected and subclinically infected with PiCV. PLoS ONE 2019, 14, e0219175. [Google Scholar] [CrossRef]
  7. Woods, L.W.; Latimer, K.S.; Barr, B.C.; Niagro, F.D.; Campagnoli, R.P.; Nordhausen, R.W.; Castro, A.E. Circovirus-like infection in a pigeon. J. Vet. Diagn. Investig. 1993, 5, 609–612. [Google Scholar] [CrossRef]
  8. Li, X.; Wang, S.; Li, W.; Wang, S.; Qin, X.; Wang, J.; Fu, R. Investigating pigeon circovirus infection in a pigeon farm: Molecular detection, phylogenetic analysis and complete genome analysis. BMC Genom. 2024, 16, 369. [Google Scholar] [CrossRef] [PubMed]
  9. Yu, X.P.; Zhu, C.; Zheng, X.T.; Mu, A.X.; Yu, H.T. Cloning and analysis of the complete genomes of pigeon circovirus from Zhejiang Province. Bing Du Xue Bao 2009, 25, 355–361. [Google Scholar] [PubMed]
  10. Zhang, Z.; Lu, C.; Wang, Y.; Wang, S.; Dai, D.; Chen, Z.; Fan, H. Molecular characterization and epidemiological investigation of Pigeon circovirus isolated in eastern China. J. Vet. Diagn. Investig. 2011, 23, 665–672. [Google Scholar] [CrossRef]
  11. Wang, H.; Gao, H.; Jiang, Z.; Shi, L.; Zhao, P.; Zhang, Y.; Wang, C. Molecular detection and phylogenetic analysis of pigeon circovirus from racing pigeons in Northern China. BMC Genom. 2022, 11, 290. [Google Scholar] [CrossRef] [PubMed]
  12. Loiko, M.R.; Junqueira, D.M.; Varela, A.P.; Tochetto, C.; Scheffer, C.M.; Lima, D.A.; Morel, A.P.; Cerva, C.; Paim, W.P.; Mayer, F.Q.; et al. Columbid circoviruses detected in free ranging pigeons from Southern Brazil: Insights on PiCV evolution. Arch. Virol. 2018, 163, 3083–3090. [Google Scholar] [CrossRef] [PubMed]
  13. Freick, M.; Müller, H.; Raue, R. Rapid detection of pigeon herpesvirus, fowl adenovirus and pigeon circovirus in young racing pigeons by multiplex PCR. J. Virol. Methods 2008, 148, 226–231. [Google Scholar] [CrossRef] [PubMed]
  14. Nath, B.K.; Das, S.; Das, T.; Forwood, J.K.; Raidal, S.R. Development and applications of a TaqMan based quantitative real-time PCR for the rapid detection of Pigeon circovirus (PiCV). J. Virol. Methods 2022, 308, 114588. [Google Scholar] [CrossRef]
  15. Tsai, S.S.; Chang, Y.L.; Huang, Y.L.; Liu, H.J.; Ke, G.M.; Chiou, C.J.; Hsieh, Y.C.; Chang, T.C.; Cheng, L.T.; Chuang, K.P. Development of a loop-mediated isothermal amplification method for rapid detection of pigeon circovirus. Arch. Virol. 2014, 159, 921–926. [Google Scholar] [CrossRef]
  16. Wang, W.; Xiao, S.; Zhang, M.; Liu, J.; Tian, J.; Chang, C.; Li, Y.; Zhang, Y.; Zhang, F.; Li, G.; et al. A pan-genotypic indirect competitive ELISA for serological detection of pigeon circovirus antibodies. Front. Microbiol. 2025, 30, 1612715. [Google Scholar] [CrossRef]
  17. Jackson, S.A.; McKenzie, R.E.; Fagerlund, R.D.; Kieper, S.N.; Fineran, P.C.; Brouns, S.J. CRISPR-Cas: Adapting to change. Science 2017, 356, eaal5056. [Google Scholar] [CrossRef]
  18. Dong, Y.; Zhou, D.; Zhang, B.; Xu, X.; Zhang, J. Development of a real-time recombinase-aided amplification assay for rapid and sensitive detection of Edwardsiella piscicida. Front. Cell. Infect. Microbiol. 2024, 14, 1355056. [Google Scholar] [CrossRef]
  19. Huang, S.; Du, L.; Liu, S.; Yang, Q.; Lei, C.; Wang, H.; Yang, L.; Yang, X. Development and validation of RAA-CRISPR/Cas12a-based assay for detecting porcine rotavirus. Animals 2024, 14, 3387. [Google Scholar] [CrossRef]
  20. Zhou, Y.; Chen, Y.; Song, X.; Zhong, Z.; Guo, Q.; Jing, S.; Ayanniyi, O.O.; Lu, Z.; Zhang, Q.; Yang, C. Rapid and sensitive detection of Trichomonas gallinae using RAA-CRISPR-Cas12a. Vet. Parasitol. 2025, 334, 110412. [Google Scholar] [CrossRef]
  21. Liang, L.; Wang, D.; Gao, Z.; Tang, J.; Li, X.; Ren, P.; Wang, Y.; Gao, S.; Wu, X.; Guo, Y.; et al. RAA-CRISPR/Cas12a-mediated rapid, sensitive, and onsite detection of newCastle disease in pigeons. Vet. Sci. 2024, 11, 473. [Google Scholar] [CrossRef]
  22. Wang, X.; Zhong, M.; Liu, Y.; Ma, P.; Dang, L.; Meng, Q.; Wan, W.; Ma, X.; Liu, J.; Yang, G.; et al. Rapid and sensitive detection of COVID-19 using CRISPR/Cas12a-based detection with naked eye readout, CRISPR/Cas12a-NER. Sci. Bull. 2020, 65, 1436–1439. [Google Scholar] [CrossRef] [PubMed]
  23. Zhu, H.; Zhu, D.; Li, Y.; Li, Y.; Song, X.; Mo, J.; Liu, L.; Liu, Z.; Wang, S.; Yao, Y.; et al. Rapid detection of mutations in the suspected piperaquine resistance gene E415G-exo in Plasmodium falciparum exonuclease via AS-PCR and RAA with CRISPR/Cas12a. Int. J. Parasitol. Drugs Drug Resist. 2024, 26, 100568. [Google Scholar] [CrossRef]
  24. Zhi, S.; Shen, J.; Li, X.; Jiang, Y.; Xue, J.; Fang, T.; Xu, J.; Wang, X.; Cao, Y.; Yang, D.; et al. Development of recombinase-aided amplification (RAA)-exo-probe and RAA-CRISPR/Cas12a assays for rapid detection of campylobacter jejuni in Food Samples. J. Agric. Food Chem. 2022, 70, 9557–9566. [Google Scholar] [CrossRef]
  25. Yang, Z.; Zhou, Y.; Lin, J.; Wang, X.; Huang, C.; Gao, J.; Wang, G.; Yang, B.; Liu, G.; Duan, H.; et al. Identification and characterization of pigeon adenovirus 1 as an emerging pathogen in pigeons from Northern and Northwest China. BMC Vet. Res. 2025, 21, 266. [Google Scholar] [CrossRef] [PubMed]
  26. Paul, B.; Montoya, G. CRISPR-Cas12a: Functional overview and applications. Biomed. J. 2020, 43, 8–17. [Google Scholar] [CrossRef] [PubMed]
  27. Stenzel, T.; Dziewulska, D.; Tykałowski, B.; Koncicki, A. The clinical infection with pigeon circovirus (PiCV) leads to lymphocyte B apoptosis but has no effect on lymphocyte T subpopulation. Pathogens 2020, 9, 632. [Google Scholar] [CrossRef]
  28. Zhu, R.; Luo, L.; Shi, Z.; Chen, Y.; Xu, J.; Li, G.; Yu, L.; Cui, J. Epidemiology, genetic diversity and evolution of pigeon circovirus. Poult. Sci. 2025, 104, 104928. [Google Scholar] [CrossRef]
  29. Mankertz, A.; Hattermann, K.; Ehlers, B.; Soike, D. Cloning and sequencing of columbid circovirus (coCV), a new circovirus from pigeons. Arch. Virol. 2000, 145, 2469–2479. [Google Scholar] [CrossRef]
  30. Stenzel, T.; Dziewulska, D.; Łukaszuk, E.; Custer, J.M.; DeKoch, M.D.; Kraberger, S.; Varsani, A. The pigeon circovirus evolution, epidemiology and interaction with the host immune system under One Loft Race rearing conditions. Sci. Rep. 2024, 14, 13815. [Google Scholar] [CrossRef]
  31. Chen, W.; Teng, C.; Shi, C.; Huang, W.; Jiang, Y.; Chang, H.; Jeng, C.; Lai, Y.; Guo, J.; Wang, P. Investigation of lethal concurrent outbreak of chlamydiosis and pigeon circovirus in a zoo. Animals 2021, 11, 1654. [Google Scholar] [CrossRef] [PubMed]
  32. Mao, X.; Xu, M.; Luo, S.; Yang, Y.; Zhong, J.; Zhou, J.; Fan, H.; Li, X.; Chen, Z. Advancements in the synergy of isothermal amplification and CRISPR-Cas technologies for pathogen detection. Front. Bioeng. Biotechnol. 2023, 11, 1273988. [Google Scholar] [CrossRef] [PubMed]
Vetsci 13 00206 g001
Figure 1. Screening of five crRNAs targeting the PiCV Rep gene and the optimal concentrations based on qPCR instrument fluorescence intensity. (A) Screening of the optimal crRNA, showing the fluorescence intensities of crRNA1, crRNA2, crRNA3, crRNA4, and crRNA5, respectively; (B) Screening of the optimal concentration of crRNA3, showing the fluorescence intensities at 50 ng/µL, 100 ng/µL, 150 ng/µL, 200 ng/µL, 250 ng/µL, and 300 ng/µL, respectively.
Figure 1. Screening of five crRNAs targeting the PiCV Rep gene and the optimal concentrations based on qPCR instrument fluorescence intensity. (A) Screening of the optimal crRNA, showing the fluorescence intensities of crRNA1, crRNA2, crRNA3, crRNA4, and crRNA5, respectively; (B) Screening of the optimal concentration of crRNA3, showing the fluorescence intensities at 50 ng/µL, 100 ng/µL, 150 ng/µL, 200 ng/µL, 250 ng/µL, and 300 ng/µL, respectively.
Vetsci 13 00206 g001
Vetsci 13 00206 g002
Figure 2. Primers agarose gel electrophoresis profile of RAA primer screening. M: DL2000 DNA Marker; Lanes 1, 3, 5, and 7 represent the amplification products using primer pairs F1R1, F1R2, F2R1, and F2R2, respectively; Lanes 2, 4, 6, and 8 are the negative controls for the corresponding primer pairs.
Figure 2. Primers agarose gel electrophoresis profile of RAA primer screening. M: DL2000 DNA Marker; Lanes 1, 3, 5, and 7 represent the amplification products using primer pairs F1R1, F1R2, F2R1, and F2R2, respectively; Lanes 2, 4, 6, and 8 are the negative controls for the corresponding primer pairs.
Vetsci 13 00206 g002
Vetsci 13 00206 g003
Figure 3. Optimization of RAA reaction conditions. (A) Fluorescence intensities of PiCV Rep gene plasmids at different concentrations (6.08 × 103 to 100 copies/µL) incubated at 37 °C, 39 °C and 42 °C. (see Supplementary Figure S1) (B) Corresponding pixel value of fluorescence intensities shown in (A) (quantified by ImageJ software: version 1.54P). (C) Fluorescence intensities of PiCV Rep gene plasmids at different concentrations (6.08 × 103 to 100 copies/µL) reacted for different durations (10, 20, 30 min) at the optimal temperature (39 °C) (see Supplementary Figure S4). (D) Corresponding pixel value of fluorescence intensities shown in (C) (quantified by ImageJ software: version 1.54P).
Figure 3. Optimization of RAA reaction conditions. (A) Fluorescence intensities of PiCV Rep gene plasmids at different concentrations (6.08 × 103 to 100 copies/µL) incubated at 37 °C, 39 °C and 42 °C. (see Supplementary Figure S1) (B) Corresponding pixel value of fluorescence intensities shown in (A) (quantified by ImageJ software: version 1.54P). (C) Fluorescence intensities of PiCV Rep gene plasmids at different concentrations (6.08 × 103 to 100 copies/µL) reacted for different durations (10, 20, 30 min) at the optimal temperature (39 °C) (see Supplementary Figure S4). (D) Corresponding pixel value of fluorescence intensities shown in (C) (quantified by ImageJ software: version 1.54P).
Vetsci 13 00206 g003
Vetsci 13 00206 g004
Figure 4. Sensitivity analysis of the RAA-CRISPR/Cas12a assay. (A) Fluorescence intensities detected by the RAA-CRISPR/Cas12a reaction for PiCV Rep gene plasmids at different concentrations (6.08 × 103 to 10−1 copies/µL) (see Supplementary Figure S7). (B) Corresponding pixel value of fluorescence intensities (quantified by ImageJ software: version 1.54P).
Figure 4. Sensitivity analysis of the RAA-CRISPR/Cas12a assay. (A) Fluorescence intensities detected by the RAA-CRISPR/Cas12a reaction for PiCV Rep gene plasmids at different concentrations (6.08 × 103 to 10−1 copies/µL) (see Supplementary Figure S7). (B) Corresponding pixel value of fluorescence intensities (quantified by ImageJ software: version 1.54P).
Vetsci 13 00206 g004
Vetsci 13 00206 g005
Figure 5. Specificity analysis of the RAA-CRISPR/Cas12a Assay. (A) Fluorescence intensities of nucleic acids from positive plasmid control, PiCV, PPMV, PiHV, FAdV, ARV, and PPV detected by the assay (see Supplementary Figure S8). (B) Corresponding pixel value of fluorescence intensities (quantified by ImageJ software: version 1.54P).
Figure 5. Specificity analysis of the RAA-CRISPR/Cas12a Assay. (A) Fluorescence intensities of nucleic acids from positive plasmid control, PiCV, PPMV, PiHV, FAdV, ARV, and PPV detected by the assay (see Supplementary Figure S8). (B) Corresponding pixel value of fluorescence intensities (quantified by ImageJ software: version 1.54P).
Vetsci 13 00206 g005
Table 1. Primer and probe sequences.
Table 1. Primer and probe sequences.
NameSequence (5′–3′)
crRNA-FGAAATTAATACGACTCACTATAGGGTAATTTCTACTAAGTGTAGAT
crRNA-R1GACAATGAGAAGTATTGCTCATCTACACTTAGTAGAAATTA
crRNA-R2GCAGCTGAGTTCCCCGGAAGATCTACACTTAGTAGAAATTA
crRNA-R3TCGTCTTCGGTAGGGTTGTTATCTACACTTAGTAGAAATTA
crRNA-R4GCAGCTGCCTACCCCGGAAGATCTACACTTAGTAGAAATTA
crRNA-R5CTTCTTCTGCTTTAAATGCAATCTACACTTAGTAGAAATTA
ssDNA reporterFAM-TTATT-BHQ1
RAA-F1CAGCTCCGCTCAGATCGCTCCGGTTTCCCTT
RAA-R1CAGAAGAAGCGGCTTTCTCAACTGAAGCAGC
RAA-F2CTTCGCAGGAATGCCCAGGGTAAGTAGCACA
RAA-R2GGATACGTGGCTGCTGAGTGAGTTCCACTAT
Table 2. Comparison of clinical sample detection results between RAA-CRISPR/Cas12 and qPCR.
Table 2. Comparison of clinical sample detection results between RAA-CRISPR/Cas12 and qPCR.
Detection ResultCRISPR/Cas12aqPCR
Number of positive346
Number of negative319
Positive coincidence rate91.8%
Negative coincidence rate66.7%
Overall coincidence rate92.5%
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, C.; Tang, M.; Liu, L.; Feng, E.; Luo, G.; Wu, D.; Zhou, Y.; Wu, S.; Cheng, Y.; Wang, Z. Establishment of a One-Step Rapid Visual Detection Method for Pigeon Circovirus Based on the RAA-CRISPR/Cas12a Assay. Vet. Sci. 2026, 13, 206. https://doi.org/10.3390/vetsci13020206

AMA Style

Wang C, Tang M, Liu L, Feng E, Luo G, Wu D, Zhou Y, Wu S, Cheng Y, Wang Z. Establishment of a One-Step Rapid Visual Detection Method for Pigeon Circovirus Based on the RAA-CRISPR/Cas12a Assay. Veterinary Sciences. 2026; 13(2):206. https://doi.org/10.3390/vetsci13020206

Chicago/Turabian Style

Wang, Chunxia, Mengle Tang, Lina Liu, Erkai Feng, Guoliang Luo, Danni Wu, Yaxi Zhou, Shun Wu, Yuening Cheng, and Zhenjun Wang. 2026. "Establishment of a One-Step Rapid Visual Detection Method for Pigeon Circovirus Based on the RAA-CRISPR/Cas12a Assay" Veterinary Sciences 13, no. 2: 206. https://doi.org/10.3390/vetsci13020206

APA Style

Wang, C., Tang, M., Liu, L., Feng, E., Luo, G., Wu, D., Zhou, Y., Wu, S., Cheng, Y., & Wang, Z. (2026). Establishment of a One-Step Rapid Visual Detection Method for Pigeon Circovirus Based on the RAA-CRISPR/Cas12a Assay. Veterinary Sciences, 13(2), 206. https://doi.org/10.3390/vetsci13020206

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop