Fowl Adenovirus Serotype 1: From Gizzard Erosion to Comprehensive Insights into Genome Organization, Epidemiology, Pathogenesis, Diagnosis, and Prevention
Simple Summary
Abstract
1. Introduction
2. Classification, Structure, and Physicochemical Properties of FAdV-1
3. Genome Organization of FAdV-1
4. Epidemiology of Adenoviral Gizzard Erosion
| Country | Year | Production Type | Age | Organ | Clinical Symptoms/Pathological Findings | Co-Infection | Diagnosis | Isolated Strain Name | Genome Size | Access Number | Reference |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Japan | 1998–1999 | Broiler | 51 days | Gizzard mucosa | -No clinical signs. -2% to 3% mortality rate. | None | AGE | 99ZH | NR | LC504224.1 | [1] |
| 2000 | Broilers | NR | NR | -Gizzard erosion. | None | AGE | JM1/1 | 43,809 | MF168407 | [23] | |
| Korea | 2010 | Layer | 150 days | Gizzard | -Dullness, anorexia, and emaciation. -0.2% mortality rate per week. | None | AGE | K181 | NR | JN181575 Hg | [33] |
| Hungary | 2010 | Layer | 25 weeks | Gizzard | -Gizzard ulcer and clotted blood in esophagus, proventriculus, and gizzard. | None | AGE | D1504/2/10/HU | 43,726 | OP985604 | [26] |
| 2010 | Layer | 22 days | Gizzard | -Clotted blood, gizzard ulcer and erosion. | None | AGE | D1552/10/HU | 43,801 | OP985605 | [26] | |
| 2014 | Breeder | 6 weeks | Proventriculus | -Gizzard ulcer, pancreas necrosis, enlarged liver. | None | AGE | D2604/2/14/HU | 43,841 | OP985621 | [26] | |
| 2019 | Broiler | 4 weeks | Gizzard | -Gizzard erosion and ulcer. | MDV-1 | AGE | D4622/2/19/HU | 43,840 | OP985634 | [26] | |
| Brunei | 2010 | Layer | 27 weeks | Gizzard | -Black vomit (clotted blood), gizzard erosion, severe congestion at proventriculum–gizzard junction. | None | AGE | D1499/3/10/BN | 43,817 | OP985603 | [26] |
| Malaysia | 2011 | Broiler | 35 days | Cecal tonsil | -Swollen head, enlarged liver, ascites. -8% mortality rate. | Reovirus | AGE | D1726/1/2/11/MY | 43,794 | OP985608 | [26] |
| 2018 | Broiler | 23 days | Proventriculus | -Flabby proventriculus, gizzard erosion, high mortality. | None | AGE | D4182/18/MY | 43,882 | OP985630 | [26] | |
| China | 2019 | NR | NR | Gizzard | -No clinical signs. -No mortality. | None | AGE | CH/HNWC/1905 | NR | MZ435837 | [34] |
| Poland | 2011 | Laying hens | 38 weeks | Gizzard | -Decreased egg weight and production. -2.3% mortality rate. | None | AGE | Wroclaw-15 (W-15). | 43,849 | KX247011 | [2] |
| 2008 | Broilers | NR | Proventriculus, gizzards, and intestines | -Uneven growth, depression, and dull feathers. -No mortality. | None | AGE | PL/068/08 | NR | GU952109 Hg | [24] | |
| 2013 | Layer | 25 weeks | Gizzards, duodenum, and livers | -No clinical signs. -0.4% mortality per week. | None | AGE | PL/G018/13, | NR | KY027457 Hg | [47] | |
| 2013 | Layer | 25 weeks | Gizzards, duodenum, and livers | -No clinical signs. -0.25% mortality per week. | None | AGE | PL/G026/12 | NR | KY027456 | [47] | |
| Great Britain | 2009–2016 | Replacement pullets and layers | 41 days | Gizzard | -No clinical signs. -0.12–0.30% mortality per week. | None | AGE | NR | NR | NR | [7] |
| Greece | 2014 | Broiler | NR | Gizzard | -No specific symptoms. | None | AGE | D2563/4/14/GR | 43,787 | OP985620 | [26] |
| Germany | 2011 | Broilers | 19 weeks | Gizzard | -Uneven growth. -No mortality. | None | AGE | 11/7127 | 43,795 | MK572848 | [43] |
| 2011 | Broilers | 15 to 36 days | Gastric mucosa | -Reduced daily weight gain. -Reduced feed intake, and lack of uniformity in flocks. -8% mortality. | None | AGE | G11-1588 | NR | NR | [46] | |
| India | 2013–2014 | Commercial layer | 4 to 12 weeks | Gizzard proventriculus, liver, and pancreas | -Dullness, uneven growth, and decreased feed and water intake. -10 to 30% mortality rate. | CAV | AGE | PDRC-NZ-145-2013 | NR | NR | [36] |
| Belgium | 2014 | Commercial broiler | 21 days 25 days | Gizzard, liver, and pancreas. | -Depression, reduced feed intake, reduced weight gain, and lack of uniformity in flocks. -No mortality. | None | AGE | NR | NR | NR | [40] |
| Denmark | 2016 | Broiler | 24 days | Gizzard | -Gizzard erosion. | None | AGE | D3678/2/16/DK | 43,788 | OP985628 | [26] |
| Sweden | 2016 | Broiler | 16–19 days | Gizzard, liver, and caecal tonsils. | -Loss of appetite, decreased growth, uneven size. | None | AGE | SVA16ALD002867 | 43,856 | MW054563 MW054564 MW054566 MW054565 MT133691 | [8] |
| Egypt (Beheira) | 2020 | Broiler | NR | Cloacal swabs | -Gastrointestinal disorders. -Loss of weight.-Depression. -No mortality. | None | AGE | AD17 | NR | MW689188 Hg | [38] |
| Slovakia | 2023 | Broiler | 15 days | Liver and gizzard | -Depression, apathy, somnolence, crouched position with droopy head, fuzzy feathers, anemic combs and wattles, sporadic nervous signs, and reduced weight gain. | None | AGE | NR | NR | NR | [41] |
| Iran | 2019 | Broiler | 16 days | Gizzard | -Depression, weight loss, and lack of flock uniformity. -6% mortality rate. | None | AGE | IRMGH019 | NR | MN165288 Hg | [35] |
| Italy | 1995 to 2006 | Broiler Layers | 42 to 63 days | Gizzard | -No clinical signs. | None | AGE | NR | NR | U46933 | [37] |
5. Clinical Manifestations and Predisposing Factors
6. Mechanism of Infection
7. Diagnosis
7.1. Clinicopathological Features
7.2. Histopathological Diagnosis
7.3. Virus Isolation
7.4. Serological Techniques
7.5. Molecular-Based Assay
8. Prevention
9. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ono, M.; Okuda, Y.; Yazawa, S.; Shibata, I.; Tanimura, N.; Kimura, K.; Haritani, M.; Mase, M.; Sato, S. Epizootic Outbreaks of Gizzard Erosion Associated with Adenovirus Infection in Chickens. Avian Dis. 2001, 45, 268. [Google Scholar] [CrossRef] [Scilit]
- Matczuk, A.K.; Niczyporuk, J.S.; Kuczkowski, M.; Woźniakowski, G.; Nowak, M.; Wieliczko, A. Whole genome sequencing of Fowl aviadenovirus A—A causative agent of gizzard erosion and ulceration, in adult laying hens. Infect. Genet. Evol. 2017, 48, 47–53. [Google Scholar] [CrossRef] [Scilit]
- King, A.M.Q.; Adams, M.J.; Carstens, E.B.; Lefkowitz, E.J. (Eds.) Family—Adenoviridae. In Virus Taxonomy; Elsevier: San Diego, CA, USA, 2012; pp. 125–141. [Google Scholar] [CrossRef] [Scilit]
- Benkő, M.; Aoki, K.; Arnberg, N.; Davison, A.J.; Echavarría, M.; Hess, M.; Jones, M.S.; Kaján, G.L.; Kajon, A.E.; Mittal, S.K.; et al. ICTV Virus Taxonomy Profile: Adenoviridae 2022: This article is part of the ICTV Virus Taxonomy Profiles collection. J. Gen. Virol. 2022, 103, 001721. [Google Scholar] [CrossRef] [Scilit]
- Zsák, L.; Kisary, J. Grouping of Fowl Adenoviruses Based upon the Restriction Patterns of DNA Generated by Bam HI and Hin dIII: Restriction Patterns of DNA Generated by Bam HI and Hind III. Intervirology 2008, 22, 110–114. [Google Scholar] [CrossRef] [Scilit]
- Hess, M. Detection and differentiation of avian adenoviruses: A review. Avian Pathol. 2000, 29, 195–206. [Google Scholar] [CrossRef] [Scilit]
- Grafl, B.; Garcia-Rueda, C.; Cargill, P.; Wood, A.; Schock, A.; Liebhart, D.; Schachner, A.; Hess, M. Fowl aviadenovirus serotype 1 confirmed as the aetiological agent of gizzard erosions in replacement pullets and layer flocks in Great Britain by laboratory and in vivo studies. Avian Pathol. 2018, 47, 63–72. [Google Scholar] [CrossRef] [Scilit]
- Lindgren, Y.; Banihashem, F.; Berg, M.; Eriksson, H.; Zohari, S.; Jansson, D.S. Gizzard erosions in broiler chickens in Sweden caused by fowl adenovirus serotype 1 (FAdV-1): Investigation of outbreaks, including whole-genome sequencing of an isolate. Avian Pathol. 2022, 51, 257–266. [Google Scholar] [CrossRef] [Scilit]
- Dahiya, S.; Srivastava, R.N.; Hess, M.; Gulati, B.R. Fowl Adenovirus Serotype 4 Associated with Outbreaks of Infectious Hydropericardium in Haryana, India. Avian Dis. 2002, 46, 230–233. [Google Scholar] [CrossRef] [Scilit]
- Zhang, T.; Jin, Q.; Ding, P.; Wang, Y.; Chai, Y.; Li, Y.; Liu, X.; Luo, J.; Zhang, G. Molecular epidemiology of hydropericardium syndrome outbreak-associated serotype 4 fowl adenovirus isolates in central China. Virol. J. 2016, 13, 188. [Google Scholar] [CrossRef] [Scilit]
- Abghour, S.; Zro, K.; Mouahid, M.; Tahiri, F.; Tarta, M.; Berrada, J.; Kichou, F. Isolation and characterization of fowl aviadenovirus serotype 11 from chickens with inclusion body hepatitis in Morocco. PLoS ONE 2019, 14, e0227004. [Google Scholar] [CrossRef] [Scilit]
- Hosseini, H.; Langeroudi, A.G.; FallahMehrabadi, M.H.; Ziafati Kafi, Z.; Dizaji, R.E.; Ghafouri, S.A.; Hamadan, A.M.; Aghaiyan, L.; Hajizamani, N. The fowl adenovirus (Fadv-11) outbreak in Iranian broiler chicken farms: The first full genome characterization and phylogenetic analysis. Comp. Immunol. Microbiol. Infect. Dis. 2020, 70, 101365. [Google Scholar] [CrossRef] [Scilit]
- Laver, W.G.; Younghusband, H.B.; Wrigley, N.G. Purification and properties of chick embryo lethal orphan virus (an avian adenovirus). Virology 1971, 45, 598–614. [Google Scholar] [CrossRef] [Scilit]
- Washietl, S.; Eisenhaber, F. Reannotation of the CELO genome characterizes a set of previously unassigned open reading frames and points to novel modes of host interaction in avian adenoviruses. BMC Bioinform. 2003, 4, 55. [Google Scholar] [CrossRef] [Scilit]
- San Martín, C. Latest Insights on Adenovirus Structure and Assembly. Viruses 2012, 4, 847–877. [Google Scholar] [CrossRef] [Scilit]
- Chiocca, S.; Kurzbauer, R.; Schaffner, G.; Baker, A.; Mautner, V.; Cotten, M. The complete DNA sequence and genomic organization of the avian adenovirus CELO. J. Virol. 1996, 70, 2939–2949. [Google Scholar] [CrossRef] [Scilit]
- Hess, M.; Cuzange, A.; Ruigrok, R.W.; Chroboczek, J.; Jacrot, B. The avian adenovirus penton: Two fibres and one base. J. Mol. Biol. 1995, 252, 379–385. [Google Scholar] [CrossRef] [Scilit]
- Sohaimi, N.M.; Hair-Bejo, M. A recent perspective on fiber and hexon genes proteins analyses of fowl adenovirus toward virus infectivity—A review. Open Vet. J. 2021, 11, 569–580. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Wan, W.; Gao, D.; Li, Y.; Yang, X.; Liu, H.; Yao, H.; Chen, L.; Wang, C.; Zhao, J. Genetic characterization of novel fowl aviadenovirus 4 isolates from outbreaks of hepatitis-hydropericardium syndrome in broiler chickens in China. Emerg. Microbes Infect. 2016, 5, e117. [Google Scholar] [CrossRef] [Scilit]
- François, A.; Eterradossi, N.; Delmas, B.; Payet, V.; Langlois, P. Construction of avian adenovirus CELO recombinants in cosmids. J. Virol. 2001, 75, 5288–5301. [Google Scholar] [CrossRef] [Scilit]
- Akello, J.O.; Kamgang, R.; Barbani, M.T.; Suter-Riniker, F.; Aebi, C.; Beuret, C.; Paris, D.H.; Leib, S.L.; Ramette, A. Genomic analyses of human adenoviruses unravel novel recombinant genotypes associated with severe infections in pediatric patients. Sci. Rep. 2021, 11, 24038. [Google Scholar] [CrossRef] [Scilit]
- Schachner, A.; Gonzalez, G.; Endler, L.; Ito, K.; Hess, M. Fowl Adenovirus (FAdV) Recombination with Intertypic Crossovers in Genomes of FAdV-D and FAdV-E, Displaying Hybrid Serological Phenotypes. Viruses 2019, 11, 1094. [Google Scholar] [CrossRef] [Scilit]
- Thanasut, K.; Fujino, K.; Taharaguchi, M.; Taharaguchi, S.; Shimokawa, F.; Murakami, M.; Takase, K. Genome Sequence of Fowl Aviadenovirus A Strain JM1/1, Which Caused Gizzard Erosions in Japan. Genome Announc. 2017, 5, e00749-17. [Google Scholar] [CrossRef] [Scilit]
- Domanska-Blicharz, K.; Tomczyk, G.; Smietanka, K.; Kozaczynski, W.; Minta, Z. Molecular characterization of fowl adenoviruses isolated from chickens with gizzard erosions. Poult. Sci. 2011, 90, 983–989. [Google Scholar] [CrossRef] [Scilit]
- Davison, A.J.; Benkő, M.; Harrach, B. Genetic content and evolution of adenoviruses. J. Gen. Virol. 2003, 84 Pt 11, 2895–2908. [Google Scholar] [CrossRef] [Scilit]
- Jakab, S.; Bali, K.; Homonnay, Z.; Kaszab, E.; Ihász, K.; Fehér, E.; Mató, T.; Kiss, I.; Palya, V.; Bányai, K. Genomic Epidemiology and Evolution of Fowl Adenovirus 1. Animals 2023, 13, 2819. [Google Scholar] [CrossRef] [Scilit]
- Aleström, P.; Stenlund, A.; Li, P.; Pettersson, U. A common sequence in the inverted terminal repetitions of human and avian adenoviruses. Gene 1982, 18, 193–197. [Google Scholar] [CrossRef] [Scilit]
- Shinagawa, M.; Ishiyama, T.; Padmanabhan, R.; Fujinaga, K.; Kamada, M.; Sato, G. Comparative sequence analysis of the inverted terminal repetition in the genomes of animal and avian adenoviruses. Virology 1983, 125, 491–495. [Google Scholar] [CrossRef] [Scilit]
- Tanimura, N.; Nakamura, K.; Imai, K.; Maeda, M.; Gobo, T.; Nitta, S.; Ishihara, T.; Amano, H. Necrotizing pancreatitis and gizzard erosion associated with adenovirus infection in chickens. Avian Dis. 1993, 37, 606–611. [Google Scholar] [CrossRef] [Scilit]
- Goodwin, M.A.; Hill, D.L.; Dekich, M.A.; Putnam, M.R. Multisystemic adenovirus infection in broiler chicks with hypoglycemia and spiking mortality. Avian Dis. 1993, 37, 625–627. [Google Scholar] [CrossRef] [Scilit]
- Abe, T.; Nakamura, K.; Tojo, T.; Yuasa, N. Gizzard erosion in broiler chicks by group I avian adenovirus. Avian Dis. 2001, 45, 234–239. [Google Scholar] [CrossRef] [Scilit]
- Okuda, Y.; Ono, M.; Shibata, I.; Sato, S. Pathogenicity of serotype 8 fowl adenovirus isolated from gizzard erosions of slaughtered broiler chickens. J. Vet. Med. Sci. 2004, 66, 1561–1566. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lim, T.-H.; Lee, H.-J.; Lee, D.-H.; Lee, Y.-N.; Park, J.-K.; Youn, H.-N.; Kim, M.-S.; Youn, H.-S.; Lee, J.-B.; Park, S.-Y.; et al. Identification and virulence characterization of fowl adenoviruses in Korea. Avian Dis. 2011, 55, 554–560. [Google Scholar] [CrossRef] [Scilit]
- Li, S.; Zhao, R.; Yang, Q.; Wu, M.; Ma, J.; Wei, Y.; Pang, Z.; Wu, C.; Liu, Y.; Gu, Y.; et al. Phylogenetic and pathogenic characterization of current fowl adenoviruses in China. Infect. Genet. Evol. 2022, 105, 105366. [Google Scholar] [CrossRef] [Scilit]
- Mirzazadeh, A.; Grafl, B.; Abbasnia, M.; Emadi-Jamali, S.; Abdi-Hachesoo, B.; Schachner, A.; Hess, M. Reduced Performance Due to Adenoviral Gizzard Erosion in 16-Day-Old Commercial Broiler Chickens in Iran, Confirmed Experimentally. Front. Vet. Sci. 2021, 8, 635186. [Google Scholar] [CrossRef] [Scilit]
- Bulbule, N.R.; Deshmukh, V.V.; Raut, S.D.; Meshram, C.D.; Mm, C. Pathogenicity and Genotyping of Fowl Adenoviruses Associated with Gizzard Erosion in Commerciallayer Grower Chicken in India. Indian J. Comp. Microbiol. Immunol. Infect. Dis. 2016, 37, 84. [Google Scholar] [CrossRef] [Scilit]
- Manarolla, G.; Pisoni, G.; Moroni, P.; Daniele, G.; Sironi, G.; Rampin, T. Adenoviral gizzard erosions in Italian chicken flocks. Vet. Rec. 2009, 164, 754–756. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Adel, A.; Mohamed, A.A.E.; Samir, M.; Hagag, N.M.; Erfan, A.; Said, M.; Arafa, A.E.S.; Hassan, W.M.M.; El Zowalaty, M.E.; Shahien, M.A. Epidemiological and molecular analysis of circulating fowl adenoviruses and emerging of serotypes 1, 3, and 8b in Egypt. Heliyon 2021, 7, e08366. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kaján, G.L.; Kecskeméti, S.; Harrach, B.; Benkő, M. Molecular typing of fowl adenoviruses, isolated in Hungary recently, reveals high diversity. Vet. Microbiol. 2013, 167, 357–363. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Garmyn, A.; Bosseler, L.; Braeckmans, D.; Van Erum, J.; Verlinden, M. Adenoviral Gizzard Erosions in Two Belgian Broiler Farms. Avian Dis. 2018, 62, 322–325. [Google Scholar] [CrossRef] [Scilit]
- Levkutova, M.; Levkut, M.; Herich, R.; Revajova, V.; Seman, V.; Cechova, M.; Levkut, M. Fowl adenovirus-induced different manifestations of the disease in two consecutive chicken breeding flocks in a poultry hall. Vet. Med. 2023, 68, 38–42. [Google Scholar] [CrossRef] [Scilit]
- Ono, M.; Okuda, Y.; Shibata, I.; Sato, S.; Okad, K. Reproduction of Adenoviral Gizzard Erosion by the Horizontal Transmission of Fowl Adenovirus Serotype 1. J. Vet. Med. Sci. 2007, 69, 1005–1008. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Grafl, B.; Aigner, F.; Liebhart, D.; Marek, A.; Prokofieva, I.; Bachmeier, J.; Hess, M. Vertical transmission and clinical signs in broiler breeders and broilers experiencing adenoviral gizzard erosion. Avian Pathol. 2012, 41, 599–604. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yates, V.J.; Fry, D.E. Observations on a chicken embryolethal orphan (CELO) virus. Am. J. Vet. Res. 1957, 18, 657–660. [Google Scholar] [PubMed]
- Du Bose, R.T.; Grumbles, L.C. The Relationship between Quail Bronchitis Virus and Chicken Embryo Lethal Orphan Virus. Avian Dis. 1959, 3, 321–344. [Google Scholar] [CrossRef] [Scilit]
- Schade, B.; Schmitt, F.; Böhm, B.; Alex, M.; Fux, R.; Cattoli, G.; Terregino, C.; Monne, I.; Currie, R.J.W.; Olias, P. Adenoviral Gizzard Erosion in Broiler Chickens in Germany. Avian Dis. 2013, 57, 159–163. [Google Scholar] [CrossRef] [Scilit]
- Domanska-Blicharz, K. Adenoviral Gizzard Erosions in Commercial Layer Chickens. Pak. Vet. J. 2019, 39, 138–141. [Google Scholar] [CrossRef] [Scilit]
- Almquist, H.J. Crystals with vitamin K potency. Nature 1937, 140, 25–26. [Google Scholar] [CrossRef] [Scilit]
- Bird, H.R.; Oleson, J.J.; Elvehjem, C.A.; Hart, E.B.; Halpin, J.G. Relation of Grit to the Development of the Gizzard Lining in Chicks. Poult. Sci. 1937, 16, 238–242. [Google Scholar] [CrossRef] [Scilit]
- Bierer, B.W.; Carll, W.T.; Eleazer, T.H.; Barnett, B.D. Gizzard Erosion and Lower Intestinal Congestion and Ulceration Due to Feed and Water Deprivation in Chickens of Various Ages. Poult. Sci. 1966, 45, 1408–1411. [Google Scholar] [CrossRef] [Scilit]
- Harry, E.G.; Tucker, J.F. The effect of orally administered histamine on the weight gain and development of gizzard lesions in chicks. Vet. Rec. 1976, 99, 206–207. [Google Scholar] [CrossRef] [Scilit]
- Daghir, N.J.; Haddad, K.S. Vitamin B6 in the etiology of gizzard erosion in growing chickens. Poult. Sci. 1981, 60, 988–992. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sharma, R.N.; Pandey, G.S. Début d’érosion et d’ulcération du gésier chez des poulets en Zambie. Rev. D’élevage Médecine Vétérinaire Pays Trop. 1990, 43, 301–304. [Google Scholar] [CrossRef] [Scilit]
- Okazaki, T.; Noguchi, T.; Igarashi, K.; Sakagami, Y.; Seto, H.; Mori, K.; Naito, H.; Masumura, T.; Sugahara, M. Gizzerosine, a New Toxic Substance in Fish Meal, Causes Severe Gizzard Erosion in Chicks. Agric. Biol. Chem. 1983, 47, 2949–2952. [Google Scholar] [CrossRef] [Scilit]
- Hoerr, F.J.; Carlton, W.W.; Tuite, J.; Vesonder, R.F.; Rohwedder, W.K.; Szigeti, G. Experimental trichothecene mycotoxicosis produced in broiler chickens by Fusarium sporotrichiella var. sporotrichioides. Avian Pathol. 1982, 11, 385–405. [Google Scholar] [CrossRef] [Scilit]
- Novoa-Garrido, M.; Larsen, S.; Kaldhusdal, M. Association between gizzard lesions and increased caecal Clostridium perfringens counts in broiler chickens. Avian Pathol. 2006, 35, 367–372. [Google Scholar] [CrossRef] [Scilit]
- Okuda, Y.; Ono, M.; Yazawa, S.; Shibata, I.; Sato, S. Experimental infection of specific-pathogen-free chickens with serotype-1 fowl adenovirus isolated from a broiler chicken with gizzard erosions. Avian Dis. 2001, 45, 19–25. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Grafl, B.; Liebhart, D.; Günes, A.; Wernsdorf, P.; Aigner, F.; Bachmeier, J.; Hess, M. Quantity of virulent fowl adenovirus serotype 1 correlates with clinical signs, macroscopical and pathohistological lesions in gizzards following experimental induction of gizzard erosion in broilers. Vet. Res. 2013, 44, 38. [Google Scholar] [CrossRef] [Scilit]
- Grafl, B.; Prokofieva, I.; Wernsdorf, P.; Dublecz, K.; Hess, M. Clinical signs and progression of lesions in the gizzard are not influenced by inclusion of ground oats or whole wheat in the diet following experimental infection with pathogenic fowl adenovirus serotype 1. Avian Pathol. 2015, 44, 230–236. [Google Scholar] [CrossRef] [Scilit]
- Maletić, J.; Spalević, L.; Kureljušić, B.; Veljović, L.; Maksimović-Zorić, J.; Maletić, M.; Milićević, V. Fowl Adenovirus Infection—Potential Cause of a Suppressed Humoral Immune Response of Broilers to Newcastle Disease Vaccination. Acta Vet. 2023, 73, 133–142. [Google Scholar] [CrossRef] [Scilit]
- Grafl, B.; Prokofieva, I.; Wernsdorf, P.; Steinborn, R.; Hess, M. Infection with an apathogenic fowl adenovirus serotype-1 strain (CELO) prevents adenoviral gizzard erosion in broilers. Vet. Microbiol. 2014, 172, 177–185. [Google Scholar] [CrossRef] [Scilit]
- Tan, P.K.; Michou, A.-I.; Bergelson, J.M.; Cotten, M. Defining CAR as a cellular receptor for the avian adenovirus CELO using a genetic analysis of the two viral fibre proteins. J. Gen. Virol. 2001, 82, 1465–1472. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Taharaguchi, S.; Kono, Y.; Ohta, H.; Takase, K. Putative host cell receptor for fowl adenovirus detected in gizzard. J. Vet. Med. Sci. 2007, 69, 1203–1205. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, W.; Liu, Q.; Li, T.; Geng, T.; Chen, H.; Xie, Q.; Shao, H.; Wan, Z.; Qin, A.; Ye, J. Fiber-1, Not Fiber-2, Directly Mediates the Infection of the Pathogenic Serotype 4 Fowl Adenovirus via Its Shaft and Knob Domains. J. Virol. 2020, 94, e00954-20. [Google Scholar] [CrossRef] [Scilit]
- Song, Y.; Tao, M.; Liu, L.; Wang, Y.; Zhao, Z.; Huang, Z.; Gao, W.; Wei, Q.; Li, X. Variation in the affinity of three representative avian adenoviruses for the cellular coxsackievirus and adenovirus receptor. Vet. Res. 2024, 55, 23. [Google Scholar] [CrossRef] [Scilit]
- Ono, M.; Okuda, Y.; Shibata, I.; Sato, S.; Okada, K. Pathogenicity by Parenteral Injection of Fowl Adenovirus Isolated from Gizzard Erosion and Resistance to Reinfection in Adenoviral Gizzard Erosion in Chickens. Vet. Pathol. 2004, 41, 483–489. [Google Scholar] [CrossRef] [Scilit]
- Verma, K.C.; Malik, B.S.; Kumar, S. preliminary report on the isolation and characterization of chicken embryo-lethal-orphan (CELO) virus from poultry. Indian J Anim. Sci. 1971, 41, 1002–1003. [Google Scholar]
- McFerran, J.B.; Adair, B.; Connor, T.J. Adenoviral antigens (CELO, QBV, GAL). Am. J. Vet. Res. 1975, 36 Pt 2, 527–529. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oberoi, M.S.; Sharma, S.N.; Maiti, N.K. Detection of avian adenovirus by counterimmunoelectrophoresis. Indian J. Anim. Sci. 1990, 60, 1307–1308. [Google Scholar]
- Muroga, N.; Taharaguchi, S.; Ohta, H.; Yamazaki, K.; Takase, K. Pathogenicity of Fowl Adenovirus Isolated from Gizzard Erosions to Immuno-Suppressed Chickens. J. Vet. Med. Sci. 2006, 68, 289–291. [Google Scholar] [CrossRef] [Scilit]
- Adair, B.M.; McFerran, J.B.; Calvert, V.M. Development of a microtitre fluorescent antibody test for serological detection of adenovirus infection in birds. Avian Pathol. 1980, 9, 291–300. [Google Scholar] [CrossRef] [Scilit]
- Saifuddin, M.; Wilks, C.R.; Birtles, M.J. Development of an Immunocytochemical Procedure to Detect Adenoviral Antigens in Chicken Tissues. J. Vet. Diagn. Investig. 1991, 3, 313–318. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Grimes, T.M.; Culver, D.H.; King, D.J. Virus-Neutralizing Antibody Titers against 8 Avian Adenovirus Serotypes in Breeder Hens in Georgia by a Microneutralization Procedure. Avian Dis. 1977, 21, 220–229. [Google Scholar] [CrossRef] [Scilit]
- Thayer, S.G. Serologic Procedures. Isol. Identif. Avian Pathog. 1998. Available online: https://cir.nii.ac.jp/crid/1570291225683400960 (accessed on 6 March 2023).
- Dawson, G.J.; Orsi, L.N.; Yates, V.J.; Chang, P.W.; Pronovost, A.D. An Enzyme-Linked Immunosorbent Assay for Detection of Antibodies to Avian Adenovirus and Avian Adenovirus-Associated Virus in Chickens. Avian Dis. 1980, 24, 393–402. [Google Scholar] [CrossRef] [Scilit]
- Xie, Z.; Luo, S.; Fan, Q.; Xie, L.; Liu, J.; Xie, Z.; Pang, Y.; Deng, X.; Wang, X. Detection of antibodies specific to the non-structural proteins of fowl adenoviruses in infected chickens but not in vaccinated chickens. Avian Pathol. 2013, 42, 491–496. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Feichtner, F.; Schachner, A.; Berger, E.; Hess, M. Development of sensitive indirect enzyme-linked immunosorbent assays for specific detection of antibodies against fowl adenovirus serotypes 1 and 4 in chickens. Avian Pathol. 2018, 47, 73–82. [Google Scholar] [CrossRef] [Scilit]
- Feichtner, F.; Schachner, A.; Berger, E.; Hess, M. Fiber-based fluorescent microsphere immunoassay (FMIA) as a novel multiplex serodiagnostic tool for simultaneous detection and differentiation of all clinically relevant fowl adenovirus (FAdV) serotypes. J. Immunol. Methods 2018, 458, 33–43. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Meulemans, G.; Boschmans, M.; Berg, T.P.; Decaesstecker, M. Polymerase chain reaction combined with restriction enzyme analysis for detection and differentiation of fowl adenoviruses. Avian Pathol. J. WVPA 2001, 30, 655–660. [Google Scholar] [CrossRef] [Scilit]
- Günes, A.; Marek, A.; Grafl, B.; Berger, E.; Hess, M. Real-time PCR assay for universal detection and quantitation of all five species of fowl adenoviruses (FAdV-A to FAdV-E). J. Virol. Methods 2012, 183, 147–153. [Google Scholar] [CrossRef] [Scilit]
- Wellehan, J.F.; Johnson, A.J.; Harrach, B.; Benkö, M.; Pessier, A.P.; Johnson, C.M.; Garner, M.M.; Childress, A.; Jacobson, E.R. Detection and Analysis of Six Lizard Adenoviruses by Consensus Primer PCR Provides Further Evidence of a Reptilian Origin for the Atadenoviruses. J. Virol. 2004, 78, 13366–13369. [Google Scholar] [CrossRef] [Scilit]
- Niczyporuk, J.S. Phylogenetic and geographic analysis of fowl adenovirus field strains isolated from poultry in Poland. Arch. Virol. 2016, 161, 33–42. [Google Scholar] [CrossRef] [Scilit]
- Kaján, G.L.; Sameti, S.; Benko, M. Partial sequence of the DNA-dependent DNA polymerase gene of fowl adenoviruses: A reference panel for a general diagnostic PCR in poultry. Acta Vet. Hung. 2011, 59, 279–285. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mase, M.; Hiramatsu, K.; Nishijima, N.; Iseki, H.; Watanabe, S. Identification of specific serotypes of fowl adenoviruses isolated from diseased chickens by PCR. J. Vet. Med. Sci. 2021, 83, 130–133. [Google Scholar] [CrossRef] [Scilit]
- Niczyporuk, J.; Samorek-Salamonowicz, E.; Czekaj, H. Incidence and detection of aviadenoviruses of serotypes 1 and 5 in poultry by PCR and duplex PCR. Bull. Vet. Inst. Pulawy 2010, 54, 451–455. [Google Scholar]
- Okuda, Y.; Ono, M.; Shibata, I.; Sato, S.; Akashi, H. Comparison of the Polymerase Chain Reaction-Restriction Fragment Length Polymorphism Pattern of the Fiber Gene and Pathogenicity of Serotype-1 Fowl Adenovirus Isolates from Gizzard Erosions and from Feces of Clinically Healthy Chickens in Japan. J. Vet. Diagn. Investig. 2006, 18, 162–167. [Google Scholar] [CrossRef] [Scilit]
- Marek, A.; Schulz, E.; Hess, C.; Hess, M. Comparison of the Fibers of Fowl Adenovirus A Serotype 1 Isolates from Chickens with Gizzard Erosions in Europe and Apathogenic Reference Strains. J. Vet. Diagn. Investig. 2010, 22, 937–941. [Google Scholar] [CrossRef] [Scilit]
- Zhang, J.; Liu, J.; An, D.; Fan, Y.; Cheng, Z.; Tang, Y.; Diao, Y. A novel recombinase polymerase amplification assay for rapid detection of epidemic fowl adenovirus. Poult. Sci. 2020, 99, 6446–6453. [Google Scholar] [CrossRef] [Scilit]
- Steer, P.A.; Kirkpatrick, N.C.; O’Rourke, D.; Noormohammadi, A.H. Classification of Fowl Adenovirus Serotypes by Use of High-Resolution Melting-Curve Analysis of the Hexon Gene Region. J. Clin. Microbiol. 2009, 47, 311–321. [Google Scholar] [CrossRef] [Scilit]
- Steer, P.; O’Rourke, D.; Ghorashi, S.; Noormohammadi, A. Application of high-resolution melting curve analysis for typing of fowl adenoviruses in field cases of inclusion body hepatitis. Aust. Vet. J. 2011, 89, 184–192. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xie, Z.; Tang, Y.; Fan, Q.; Liu, J.; Pang, Y.; Deng, X.; Xie, Z.; Peng, Y.; Xie, L.; Khan, M.I. Rapid detection of group I avian adenoviruses by a loop-mediated isothermal amplification. Avian Dis. 2011, 55, 575–579. [Google Scholar] [CrossRef] [Scilit]
- Niczyporuk, J.S.; Woźniakowski, G.; Samorek-Salamonowicz, E. Application of cross-priming amplification (CPA) for detection of fowl adenovirus (FAdV) strains. Arch. Virol. 2015, 160, 1005–1013. [Google Scholar] [CrossRef] [Scilit]
- Hou, L.; Su, Q.; Zhang, Y.; Liu, D.; Mao, Y.; Zhao, P. Development of a PCR-based dot blot assay for the detection of fowl adenovirus. Poult. Sci. 2022, 101, 101540. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Raue, R.; Hess, M. Hexon based PCRs combined with restriction enzyme analysis for rapid detection and differentiation of fowl adenoviruses and egg drop syndrome virus. J. Virol. Methods 1998, 73, 211–217. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xie, Z.; Fadl, A.A.; Girshick, T.; Khan, M.I. Detection of avian adenovirus by polymerase chain reaction. Avian Dis. 1999, 43, 98–105. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schonewille, E.; Jaspers, R.; Paul, G.; Hess, M. Specific-Pathogen-Free Chickens Vaccinated with a Live FAdV-4 Vaccine Are Fully Protected Against a Severe Challenge Even in the Absence of Neutralizing Antibodies. Avian Dis. 2010, 54, 905–910. [Google Scholar] [CrossRef] [Scilit]
- Grafl, B.; Berger, E.; Wernsdorf, P.; Hess, M. Successful reproduction of adenoviral gizzard erosion in 20-week-old SPF layer-type chickens and efficacious prophylaxis due to live vaccination with an apathogenic fowl adenovirus serotype 1 strain (CELO). Vaccine 2020, 38, 143–149. [Google Scholar] [CrossRef] [Scilit]
| Type | Molecular Assay | Forward Primer | Reverse Primer | Primer Position | Target Gene | Sequence (5′ to 3′) | Product Size (bp) | Test Performance | Reference |
|---|---|---|---|---|---|---|---|---|---|
| Universal test | cPCR | 52K-F | 52K-R | 12,788–12,806 13,542–13,526 | 52K + PIIIa (FAdV-1) | TGT ACG AYT TCG TSC ARA C TARATGGCG CCYTGCTC | 755-794 | -Universal detection of FAdV. | [80] |
| cPCR + RFLP | H1 | H2 | 296–314 1514–1496 | Hexon | TGGACATGGGGGGCGACCTA AAGGG ATTGACGTTGTCCA | 1291 | -Universal amplification of FAdVs. -Differentiation between serotypes using Hae II digestion except FAdV-5 and FAdV-4. | [94] | |
| cPCR + RFLP | H3 | H4 | 1501–1522 2819–2801 | Hexon (FAdV-1) | AACGT CAACCCCTTCAACCAC CTTGCC TGTGGCGAAAGGCG | 1319 | -Universal detection of FAdV. -Differentiation between FAdV-1 and other serotypes using Hpa II. | [94] | |
| cPCR + RFLP | HexonA | HexonB | 144–161 1041–1021 | Hexon (FAdV-1) | CCCTCCCACCGCTTACCA CCCTCCCACCGCTTACCA | 900 | -Universal detection of FAdV. LOD: 102 copies/mL. -Successive digestion using BsiWI, Sty1, and Mlu1. Asp1, Bgl1, and Sca1 allow serotype differentiation. | [79] | |
| cPCR | MK 89 | MK 90 | 811–828 1229–1211 | Hexon | CCCTCCCACCGCTTACCA CCCTCCCACCGCTTACCA | 418 | -Detection of adenovirus from group I, II, III. | [95] | |
| cPCR + Sequencing | FAdVF JSN | FAdVR JSN | NR | Hexon (FAdV-1) | AATGTCACNACCGARAAGGC CBGCBTRCATGTACTGGTA | 830 | -Universal cPCR coupled with sequencing for serotype determination. -Used in phylogenetic and geographic analyses of avian adenovirus. | [82] | |
| Nested PCR | polF outer PolF inner | PolR outer PolR inner | NR | DNA-Polymerase | TNMGNGGNGGNMGNTGYTAYCC GTDGCRAANSHNCCRTABARNGMRTT GTNTWYGAYATHTGYGGHATGTAYGC CCANCCBCDRTTRTGNARNGTRA | 321 | -Universal cPCR followed by sequencing was initially used to complete panel of DNA Polymerase sequences for FAdV-6, -8b, -7, -8a, -2, -3, -6, -1, and FAdV-11. -Proved to be effective for FAdV detection. | [81] | |
| Real-Time PCR (Syber Green) | 52K-fw | 52K-fw | 13,075–13,093 13,250–13,232 | 52K + PIII (FAdV-1) | ATG GCK CAG ATG GCY AAG AGCGCCTGGGTCAAACCGA | 176 | -Detection and quantification of 12 serotypes. -LOD: 6.73 copies/reaction. -LOQ: 6.73 x 108 copies/reaction. -Efficiency: 98%. | [80] | |
| PCR/HRM Analysis | Hex L1-s | Hex L1-as | 301–323 890–868 | Hexon L1 | ATGGGAGCSACCTAYTTCGACAT AAATTGTCCCKRAANCCGATGTA | 590 | -Universal detection of FAdV. -Rapid differentiation between 12 FAdV serotypes using HRM curve analysis. | [89] | |
| Cross-Priming Amplification (CPA) | FAdV-5a FAdV-2a FAdV-1s | FAdV-4s FAdV-3a | 83–106 211–233 130–151 170–192 130–151 193–211 | Hexon | ATACTTTGCCATCAAGAATCTGCT AGGTTCACYTGCCGAATAGAC ACGAGTGGGTSCTCAGAAAGGA TCCAGTCTSGGGAACGACCTGC ACGAGTGGGTSCTCAGAAAGGA GATAGAGGCGCCGTCGGCGC | 151 | -Universal detection of FAdV. -No thermocycler is required. -LOD: 10−2 TCID50. | [92] | |
| Recombinase Polymerase Amplification (RPA) | FAdV-RPA Fw | FAdV-RPA Rev | NR | Hexon | CKCCYACTCGCAATGTCACCACCGARAAGGCH TKAHGCTGTASCGCACGCCGRTARCTGTTGGGC | 108 | - Universal detection of FAdV serotypes. -Rapid detection in 14 min. -No thermocycler is required. -LOD: 0.1 fg. | [88] | |
| Specific test for FAdV-1 | cPCR | Flong | Rlong | 2812–2831 30,478–30,497 | Long fiber (CELO) | TCATGAACGAGGAGGTTG GTTCATTGATGATAC CCC | 2382 | -Amplification of long fiber of FAdV-1. | [87] |
| cPCR | F700 | R800 | 31,201–31,223 31,304–31,323 | Short fiber (CELO) | TACGGGCAATTTTGTGAGCTCTA CCCATGGTGGTTGTGTCGAC | 1233 | -Amplification of short fiber of FAdV-1. | [86,87] | |
| cPCR | F3 | F4 | NR | Short fiber (CELO) | GCA TGG CTG ACC AGA AAA TTG TTC AGA CCG TAA CGG | 1233 | -Amplification of short fiber of FAdV-1. | [86] | |
| cPCR | F | R | 18,691–19,518 | Hexon (CELO) | ATTTTCAACACCTGGGTGGAGAGCA CACGTTGCCCTTATCTTGC | 828 | -Specific amplification of FAdV-1. | [84] | |
| Duplex PCR | FAdV1 F FAdV5 F | FAdV1R FAdV5 R | NR | Hexon | TTCGAGATCAAGAGGCCAGT GGTCGAAGTTGCGTAGGAAG TACTGCCGTTTCCACATTCA AGCTGATTGCTGGTGTTGTG | 227pb for FAdV-1 178 pb for FAdV-5 | -Differentiation of FAdV-1 and FAdV-5 in one reaction based on amplification product size. -Highly specific for FAdV-1 and 178pb for FAdV-5. LOD: 0.0001 ng/µL. | [85] | |
| Real-Time PCR (TaqMan Probe) | FAdV-1F | FAdV-1R | NR | Hexon | TTCGAGATCAAGAGGCCAGT GGTCGAAGTTCGTAGGAAG Probe: AATCCCTACTCCAACACCCC | -Specific amplification of FAAdV-1. -LOD: 8 copies/µL. -R-squared: 0.991. -Efficiency: 95.03%. | [88] | ||
| Amplification Refractory Mutation Systems Quantitative PCR (ARMS-qPCR) | CELO-f PA7127-f | CELO-r PA7127-r | NR | Short fiber | CGTGTTCAATATGAACCAAAACAT C D AGCCGGTGAAGATAGGCCD CGTGTTCAATATGAACCAGAACAC CGCCGGTGAGGATAGGCTD FAM-CCCGAATCGGGAAGCGTAGTAGGG-BHQ1 | NR | -Quantification of and differentiation between two FAdV-1 strains (CELO: apathogenic strain and PA7127: European pathogenic strain) by using SNPs in gene coding for short fiber protein. | [61] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kardoudi, A.; Benani, A.; Allaoui, A.; Kichou, F.; Biskri, L.; Ouchhour, I.; Fellahi, S. Fowl Adenovirus Serotype 1: From Gizzard Erosion to Comprehensive Insights into Genome Organization, Epidemiology, Pathogenesis, Diagnosis, and Prevention. Vet. Sci. 2025, 12, 378. https://doi.org/10.3390/vetsci12040378
Kardoudi A, Benani A, Allaoui A, Kichou F, Biskri L, Ouchhour I, Fellahi S. Fowl Adenovirus Serotype 1: From Gizzard Erosion to Comprehensive Insights into Genome Organization, Epidemiology, Pathogenesis, Diagnosis, and Prevention. Veterinary Sciences. 2025; 12(4):378. https://doi.org/10.3390/vetsci12040378
Chicago/Turabian StyleKardoudi, Amina, Abdelouhab Benani, Abdelmounaaim Allaoui, Faouzi Kichou, Latefa Biskri, Ikram Ouchhour, and Siham Fellahi. 2025. "Fowl Adenovirus Serotype 1: From Gizzard Erosion to Comprehensive Insights into Genome Organization, Epidemiology, Pathogenesis, Diagnosis, and Prevention" Veterinary Sciences 12, no. 4: 378. https://doi.org/10.3390/vetsci12040378
APA StyleKardoudi, A., Benani, A., Allaoui, A., Kichou, F., Biskri, L., Ouchhour, I., & Fellahi, S. (2025). Fowl Adenovirus Serotype 1: From Gizzard Erosion to Comprehensive Insights into Genome Organization, Epidemiology, Pathogenesis, Diagnosis, and Prevention. Veterinary Sciences, 12(4), 378. https://doi.org/10.3390/vetsci12040378

