Isolation, Genomic Characterization, and Immunogenicity Evaluation of a G9P[23] Porcine Rotavirus Strain
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Cells, Antibodies, and Viruses
2.2. Clinical Samples Preparation
2.3. Virus Isolation
2.4. Immunofluorescence Assay (IFA)
2.5. Transmission Electron Microscopic (TEM) Observation
2.6. Viral Growth Curve Determination
2.7. Whole-Genome Sequencing Analysis
2.8. Neutralization Test
2.9. Preparation of Inactivated Vaccines
2.10. Immunization of Piglets with Inactivated PoRVA RHeN2 Vaccine
2.11. Statistical Analysis
3. Results
3.1. Virus Isolation
3.2. Virus Growth Characterization
3.3. Whole-Genome Sequence of the RHeN2 Strain
3.4. Phylogenetic Analysis
3.5. Immunogenicity of the RHeN2 Strain in Piglets
3.6. The Cross-Neutralizing Activity of the Inactivated RHeN2 Vaccine Against 11 Strains of PoRVA Strains
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Caddy, S.; Papa, G.; Borodavka, A.; Desselberger, U. Rotavirus research: 2014–2020. Virus Res. 2021, 304, 198499. [Google Scholar] [CrossRef]
 - Kim, H.H.; Matthijnssens, J.; Kim, H.J.; Kwon, H.J.; Park, J.G.; Son, K.Y.; Ryu, E.H.; Kim, D.S.; Lee, W.S.; Kang, M.I.; et al. Full-length genomic analysis of porcine G9P[23] and G9P[7] rotavirus strains isolated from pigs with diarrhea in South Korea. Infect. Genet. Evol. 2012, 12, 1427–1435. [Google Scholar] [CrossRef] [PubMed]
 - Vlasova, A.N.; Amimo, J.O.; Saif, L.J. Porcine Rotaviruses: Epidemiology, Immune Responses and Control Strategies. Viruses 2017, 9, 48. [Google Scholar] [CrossRef]
 - Ferrari, E.; Salogni, C.; Martella, V.; Alborali, G.L.; Scaburri, A.; Boniotti, M.B. Assessing the Epidemiology of Rotavirus A, B, C and H in Diarrheic Pigs of Different Ages in Northern Italy. Pathogens 2022, 11, 467. [Google Scholar] [CrossRef]
 - Hou, W.; Fan, M.; Zhu, Z.; Li, X. Establishment and Application of a Triplex Real-Time RT-PCR Assay for Differentiation of PEDV, PoRV, and PDCoV. Viruses 2023, 15, 1238. [Google Scholar] [CrossRef] [PubMed]
 - Xin, Z.; Li, S.; Lu, X.; Liu, L.; Gao, Y.; Hu, F.; Yu, K.; Ma, X.; Li, Y.; Huang, B.; et al. Development and Clinical Application of a Molecular Assay for Four Common Porcine Enteroviruses. Vet. Sci. 2024, 11, 305. [Google Scholar] [CrossRef] [PubMed]
 - Zhang, F.; Luo, S.; Gu, J.; Li, Z.; Li, K.; Yuan, W.; Ye, Y.; Li, H.; Ding, Z.; Song, D.; et al. Prevalence and phylogenetic analysis of porcine diarrhea associated viruses in southern China from 2012 to 2018. BMC Vet. Res. 2019, 15, 470. [Google Scholar] [CrossRef] [PubMed]
 - Collins, P.J.; Martella, V.; Sleator, R.D.; Fanning, S.; O’Shea, H. Detection and characterisation of group A rotavirus in asymptomatic piglets in southern Ireland. Arch. Virol. 2010, 155, 1247–1259. [Google Scholar] [CrossRef]
 - Xue, R.; Tian, Y.; Zhang, Y.; Zhang, M.; Li, Z.; Chen, S.; Liu, Q. Diversity of group A rotavirus of porcine rotavirus in Shandong province China. Acta Virol. 2018, 62, 229–234. [Google Scholar] [CrossRef] [PubMed]
 - Wu, F.T.; Liu, L.T.; Jiang, B.; Kuo, T.Y.; Wu, C.Y.; Liao, M.H. Prevalence and diversity of rotavirus A in pigs: Evidence for a possible reservoir in human infection. Infect. Genet. Evol. 2022, 98, 105198. [Google Scholar] [CrossRef] [PubMed]
 - Tao, R.; Chang, X.; Zhou, J.; Zhu, X.; Yang, S.; Li, K.; Gu, L.; Zhang, X.; Li, B. Molecular epidemiological investigation of group A porcine rotavirus in East China. Front. Vet. Sci. 2023, 10, 1138419. [Google Scholar] [CrossRef] [PubMed]
 - Amimo, J.O.; Vlasova, A.N.; Saif, L.J. Detection and genetic diversity of porcine group A rotaviruses in historic (2004) and recent (2011 and 2012) swine fecal samples in Ohio: Predominance of the G9P[13] genotype in nursing piglets. J. Clin. Microbiol. 2013, 51, 1142–1151. [Google Scholar] [CrossRef]
 - Malakalinga, J.J.; Misinzo, G.; Msalya, G.M.; Shayo, M.J.; Kazwala, R.R. Prevalence and genomic characterization of rotavirus group A genotypes in piglets from southern highlands and eastern Tanzania. Heliyon 2022, 8, e11750. [Google Scholar] [CrossRef] [PubMed]
 - Ndebe, J.; Harima, H.; Chambaro, H.M.; Sasaki, M.; Yamagishi, J.; Kalonda, A.; Shawa, M.; Qiu, Y.; Kajihara, M.; Takada, A.; et al. Prevalence and Genomic Characterization of Rotavirus A from Domestic Pigs in Zambia: Evidence for Possible Porcine-Human Interspecies Transmission. Pathogens 2023, 12, 1199. [Google Scholar] [CrossRef] [PubMed]
 - Wang, J.; Zhou, J.; Zhu, X.; Bian, X.; Han, N.; Fan, B.; Gu, L.; Cheng, X.; Li, S.; Tao, R.; et al. Isolation and characterization of a G9P[23] porcine rotavirus strain AHFY2022 in China. Microb. Pathog. 2024, 190, 106612. [Google Scholar] [CrossRef] [PubMed]
 - Bergman, H.; Henschke, N.; Hungerford, D.; Pitan, F.; Ndwandwe, D.; Cunliffe, N.; Soares-Weiser, K. Vaccines for preventing rotavirus diarrhoea: Vaccines in use. Cochrane Database Syst. Rev. 2021, 11, Cd008521. [Google Scholar] [PubMed]
 - Groome, M.J.; Fairlie, L.; Morrison, J.; Fix, A.; Koen, A.; Masenya, M.; Jose, L.; Madhi, S.A.; Page, N.; McNeal, M.; et al. Safety and immunogenicity of a parenteral trivalent P2-VP8 subunit rotavirus vaccine: A multisite, randomised, double-blind, placebo-controlled trial. Lancet Infect. Dis. 2020, 20, 851–863. [Google Scholar] [CrossRef]
 - Burke, R.M.; Tate, J.E.; Kirkwood, C.D.; Steele, A.D.; Parashar, U.D. Current and new rotavirus vaccines. Curr. Opin. Infect. Dis. 2019, 32, 435–444. [Google Scholar] [CrossRef] [PubMed]
 - Huang, W.T.; Juan, Y.C.; Liu, C.H.; Yang, Y.Y.; Chan, K.A. Intussusception and Kawasaki disease after rotavirus vaccination in Taiwanese infants. Vaccine 2020, 38, 6299–6303. [Google Scholar] [CrossRef] [PubMed]
 - Reddy, S.N.; Nair, N.P.; Tate, J.E.; Thiyagarajan, V.; Giri, S.; Praharaj, I.; Mohan, V.R.; Babji, S.; Gupte, M.D.; Arora, R.; et al. Intussusception after Rotavirus Vaccine Introduction in India. N. Engl. J. Med. 2020, 383, 1932–1940. [Google Scholar] [CrossRef]
 - Zhang, B.; Yi, S.; Ma, Y.; Zhang, G.; Zhang, Y.; Xie, T.; Li, H.; Sun, M. Immunogenicity of a scalable inactivated rotavirus vaccine in mice. Hum. Vaccin. 2011, 7, 248–257. [Google Scholar] [CrossRef] [PubMed]
 - Zhou, Y.; Wu, J.; Hu, X.; Chen, R.; Lin, X.; Yin, N.; Lu, C.; Ye, J.; Zhao, Y.; Song, X.; et al. Immunogenicity of inactivated rotavirus in rhesus monkey, and assessment of immunologic mechanisms. Hum. Vaccines Immunother. 2023, 19, 2189598. [Google Scholar] [CrossRef] [PubMed]
 - Resch, T.K.; Wang, Y.; Moon, S.S.; Joyce, J.; Li, S.; Prausnitz, M.; Jiang, B. Inactivated rotavirus vaccine by parenteral administration induces mucosal immunity in mice. Sci. Rep. 2018, 8, 561. [Google Scholar] [CrossRef] [PubMed]
 - Wang, Y.; Azevedo, M.; Saif, L.J.; Gentsch, J.R.; Glass, R.I.; Jiang, B. Inactivated rotavirus vaccine induces protective immunity in gnotobiotic piglets. Vaccine 2010, 28, 5432–5436. [Google Scholar] [CrossRef] [PubMed]
 - Yin, N.; Wu, J.; Kuang, X.; Lin, X.; Zhou, Y.; Yi, S.; Hu, X.; Chen, R.; Liu, Y.; Ye, J.; et al. Vaccination of pregnant rhesus monkeys with inactivated rotavirus as a model for achieving protection from rotavirus SA11 infection in the offspring. Hum. Vaccines Immunother. 2021, 17, 5656–5665. [Google Scholar] [CrossRef] [PubMed]
 - Liang, W.; Zhou, D.; Geng, C.; Yang, K.; Duan, Z.; Guo, R.; Liu, W.; Yuan, F.; Liu, Z.; Gao, T.; et al. Isolation and evolutionary analyses of porcine epidemic diarrhea virus in Asia. PeerJ 2020, 8, e10114. [Google Scholar] [CrossRef] [PubMed]
 - Arnold, M.; Patton, J.T.; McDonald, S.M. Culturing, storage, and quantification of rotaviruses. Curr. Protoc. Microbiol. 2009, 15, 15C.3.1–15C.3.24. [Google Scholar] [CrossRef]
 - Thakur, A.K.; Fezio, W.L. A computer program for estimating ld50 and its confidence limits using modified behrens-reed-muench cumulant method. Drug Chem. Toxicol. 1981, 4, 297–305. [Google Scholar] [CrossRef] [PubMed]
 - Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
 - Pandey, M.K.; Rajukumar, K.; Senthilkumar, D.; Kombiah, S.; Singh, F.; Venkatesh, G.; Kumar, M.; Shrivas, S.; Shrivastava, D.; Singh, V.P.; et al. Evaluation of dynamics of immune responses and protective efficacy in piglets immunized with an inactivated porcine reproductive and respiratory syndrome vaccine candidate. Vaccine 2023, 41, 6327–6338. [Google Scholar] [CrossRef]
 - Phan, T.G.; Okitsu, S.; Maneekarn, N.; Ushijima, H. Genetic heterogeneity, evolution and recombination in emerging G9 rotaviruses. Infect. Genet. Evol. 2007, 7, 656–663. [Google Scholar] [CrossRef] [PubMed]
 - Bohl, E.H.; Theil, K.W.; Saif, L.J. Isolation and serotyping of porcine rotaviruses and antigenic comparison with other rotaviruses. J. Clin. Microbiol. 1984, 19, 105–111. [Google Scholar] [CrossRef] [PubMed]
 - de Sautu, M.; Herrmann, T.; Scanavachi, G.; Jenni, S.; Harrison, S.C. The rotavirus VP5*/VP8* conformational transition permeabilizes membranes to Ca2+. PLoS Pathog. 2024, 20, e1011750. [Google Scholar] [CrossRef]
 - Luo, S.; Chen, X.; Yan, G.; Chen, S.; Pan, J.; Zeng, M.; Han, H.; Guo, Y.; Zhang, H.; Li, J.; et al. Emergence of human-porcine reassortment G9P[19] porcine rotavirus A strain in Guangdong Province, China. Front. Vet. Sci. 2023, 9, 1111919. [Google Scholar] [CrossRef] [PubMed]
 - Memon, A.M.; Chen, F.; Khan, S.B.; Guo, X.; Khan, R.; Khan, F.A.; Zhu, Y.; He, Q. Development and evaluation of polyclonal antibodies based antigen capture ELISA for detection of porcine rotavirus. Anim. Biotechnol. 2023, 34, 1807–1814. [Google Scholar] [CrossRef]
 - Shao, L.; Fischer, D.D.; Kandasamy, S.; Rauf, A.; Langel, S.N.; Wentworth, D.E.; Stucker, K.M.; Halpin, R.A.; Lam, H.C.; Marthaler, D.; et al. Comparative In Vitro and In Vivo Studies of Porcine Rotavirus G9P[13] and Human Rotavirus Wa G1P[8]. J. Virol. 2016, 90, 142–151. [Google Scholar] [CrossRef]
 - Ghonaim, A.H.; Yi, G.; Lei, M.; Xie, D.; Ma, H.; Yang, Z.; Usama, U.; Wu, H.; Jiang, Y.; Li, W.; et al. Isolation, characterization and whole-genome analysis of G9 group a rotaviruses in China: Evidence for possible Porcine–Human interspecies transmission. Virology 2024, 597, 110129. [Google Scholar] [CrossRef] [PubMed]
 - Sadiq, A.; Khan, J.; Basit, A.; Sardar, N.; Ajmal, M.N. Rotavirus genotype dynamics in Pakistan: G9 and G12 emerging as dominant strains in vaccinated children (2019). Acta Trop. 2024, 257, 107300. [Google Scholar] [CrossRef]
 - Teodoroff, T.A.; Tsunemitsu, H.; Okamoto, K.; Katsuda, K.; Kohmoto, M.; Kawashima, K.; Nakagomi, T.; Nakagomi, O. Predominance of porcine rotavirus G9 in Japanese piglets with diarrhea: Close relationship of their VP7 genes with those of recent human G9 strains. J. Clin. Microbiol. 2005, 43, 1377–1384. [Google Scholar] [CrossRef]
 - Lycke, E.; Melen, B.; Wrange, G. Studies of the inactivation of poliomyelitis virus by formaldehyde. Arch. Gesamte Virusforsch. 1957, 7, 378–383. [Google Scholar] [CrossRef]
 - Umeshappa, C.S.; Singh, K.P.; Pandey, A.B.; Singh, R.P.; Nanjundappa, R.H. Cell-mediated immune response and cross-protective efficacy of binary ethylenimine-inactivated bluetongue virus serotype-1 vaccine in sheep. Vaccine 2010, 28, 2522–2531. [Google Scholar] [CrossRef] [PubMed]
 





| Primer | Primer Sequences (5′→3′) | Product (bp) | 
|---|---|---|
| PoRVA-VP7-F | CCCCGGTATTGAATATACCACAGT | 333 | 
| PoRVA-VP7-R | TTTCTGTTGGCCACCCTTTAGT | 
| Primer | Primer Sequences (5′→3′) | Product (bp) | 
|---|---|---|
| VP1-F | GGCTATTAAAGCTRTACAATGGGGAAG | 3302 | 
| VP1-R | GGTCACATCTAAGCGCTCTAATCTTS | |
| VP2-F | GGCTATTRAAGGYTCAATGGCGTACAG | 2690 | 
| VP2-R | GTCATATCTCCACARTGGGGTTGG | |
| VP3-F | GGCTWTTAAAGCARTATTAGTAGTG | 2591 | 
| VP3-R | GGTCACATCATGACTAGTGTG | |
| VP4-F | GGCTATAAAATGGCTTCGCTAATTTACAG | 2362 | 
| VP4-R | GGTCACATCCTTTAGAAGCTACTTATAGTCTACATTG | |
| VP6-F | GGCTTTWAAACGAAGTCTTC | 1356 | 
| VP6-R | GGTCACATCCTCTCACT | |
| VP7-F | GGCTTTAAAAGAGAGAATTTC | 1062 | 
| VP7-R | GGTCACATCATACAATTC | |
| NSP1-F | GGCTTTTTTTATGAAAAGTCTTGT | 1581 | 
| NSP1-R | GGTTCACATTTTTTGCTACCTAGG | |
| NSP2-F | GGCTTTTAAAGCGTCTCAG | 1059 | 
| NSP2-R | GGTCACATAAGCGCTTTC | |
| NSP3-F | GGCTTTTAATGCTTTTCAGTG | 1104 | 
| NSP3-R | GGTCACATAACGCCCCTATAG | |
| NSP4-F | GGCTTTTAAAAGTTCTGTTCC | 751 | 
| NSP4-R | GGWYACRYTAAGACCRTTCC | |
| NSP5-F | GGCTTTTAAAGCGCTACAG | 667 | 
| NSP5-R | GGTCACAAAACGGGAGT | 
| Group | Number of Piglets | Immunization Dose | 
|---|---|---|
| 0.005mol/L BEI-inactivated | 5 | 2 mL | 
| 0.2% formaldehyde-inactivated | 5 | |
| DMEM | 5 | 
| Gene | Segment Number  | Genotype | Best Hit Accession | Query Coverage%  | Identity% | 
|---|---|---|---|---|---|
| VP7 | 9 | G9 | CHN/CY/LH9/2022/G9 (OQ743917.1) | 100 | 99.68 | 
| VP4 | 4 | P[23] | RVA/Pig/China/NMTL/2008/G9P[23] (JF781161.1) | 100 | 95.71 | 
| VP6 | 6 | I5 | CHN/GZ/GX3/2022/G5 (OQ799862.1) | 100 | 96.21 | 
| VP1 | 1 | R1 | Porcine rotavirus strain K71 (JX971580.1) | 100 | 99.94 | 
| VP2 | 2 | C1 | RVA/Pig-wt/CHN/923E/2021/G9P[23] (PQ141607.1) | 99 | 97.23 | 
| VP3 | 3 | M1 | RVA/Human-tc/VNM/NT0042/2007/G4P[6] (LC095893.1) | 100 | 96.84 | 
| NSP1 | 5 | A8 | Human rotavirus A strain Mc345 (JN104623.1) | 100 | 95.57 | 
| NSP2 | 8 | N1 | Porcine rotavirus strain JSJR2023 (PP100157.1) | 100 | 97.36 | 
| NSP3 | 7 | T1 | Human rotavirus A isolate LL3354 (KC139787.1) | 99 | 96.83 | 
| NSP4 | 10 | E1 | RVA/Pig-wt/CHN/GDFZ/2023/G9P[23] (PP566184.1) | 99 | 97.97 | 
| NSP5 | 11 | H1 | RVA/Pig-wt/CHN/CN127/2021/G12P[7] (ON989012.1) | 100 | 97.74 | 
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.  | 
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Z.; Huang, W.; Yan, G.; Tian, Y.; Wang, C.; Mao, X.; Sun, M.; Zhou, L.; Yu, C.; Xia, H. Isolation, Genomic Characterization, and Immunogenicity Evaluation of a G9P[23] Porcine Rotavirus Strain. Vet. Sci. 2025, 12, 180. https://doi.org/10.3390/vetsci12020180
Wang Z, Huang W, Yan G, Tian Y, Wang C, Mao X, Sun M, Zhou L, Yu C, Xia H. Isolation, Genomic Characterization, and Immunogenicity Evaluation of a G9P[23] Porcine Rotavirus Strain. Veterinary Sciences. 2025; 12(2):180. https://doi.org/10.3390/vetsci12020180
Chicago/Turabian StyleWang, Zixuan, Wen Huang, Gengxuan Yan, Yuan Tian, Chune Wang, Xue Mao, Meng Sun, Lu Zhou, Chong Yu, and Haihua Xia. 2025. "Isolation, Genomic Characterization, and Immunogenicity Evaluation of a G9P[23] Porcine Rotavirus Strain" Veterinary Sciences 12, no. 2: 180. https://doi.org/10.3390/vetsci12020180
APA StyleWang, Z., Huang, W., Yan, G., Tian, Y., Wang, C., Mao, X., Sun, M., Zhou, L., Yu, C., & Xia, H. (2025). Isolation, Genomic Characterization, and Immunogenicity Evaluation of a G9P[23] Porcine Rotavirus Strain. Veterinary Sciences, 12(2), 180. https://doi.org/10.3390/vetsci12020180
        
